ID: 1163000215

View in Genome Browser
Species Human (GRCh38)
Location 19:14362475-14362497
Sequence CAACAAAGTGAGACCGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163000207_1163000215 2 Left 1163000207 19:14362450-14362472 CCTAGGAGTTCAAGACCAGCCTG 0: 8973
1: 18765
2: 29718
3: 28061
4: 18506
Right 1163000215 19:14362475-14362497 CAACAAAGTGAGACCGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163000215 Original CRISPR CAACAAAGTGAGACCGGGGA AGG Intergenic
No off target data available for this crispr