ID: 1163003324 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:14382332-14382354 |
Sequence | TGCCCCCAAGAAACCCAAGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1163003324_1163003331 | 17 | Left | 1163003324 | 19:14382332-14382354 | CCACCTTGGGTTTCTTGGGGGCA | No data | ||
Right | 1163003331 | 19:14382372-14382394 | TGCCAAGACCTGGCTTCCCAAGG | No data | ||||
1163003324_1163003330 | 7 | Left | 1163003324 | 19:14382332-14382354 | CCACCTTGGGTTTCTTGGGGGCA | No data | ||
Right | 1163003330 | 19:14382362-14382384 | TGGGGGCAGTTGCCAAGACCTGG | No data | ||||
1163003324_1163003332 | 18 | Left | 1163003324 | 19:14382332-14382354 | CCACCTTGGGTTTCTTGGGGGCA | No data | ||
Right | 1163003332 | 19:14382373-14382395 | GCCAAGACCTGGCTTCCCAAGGG | No data | ||||
1163003324_1163003329 | -10 | Left | 1163003324 | 19:14382332-14382354 | CCACCTTGGGTTTCTTGGGGGCA | No data | ||
Right | 1163003329 | 19:14382345-14382367 | CTTGGGGGCACACTTGTTGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1163003324 | Original CRISPR | TGCCCCCAAGAAACCCAAGG TGG (reversed) | Intronic | ||