ID: 1163003324

View in Genome Browser
Species Human (GRCh38)
Location 19:14382332-14382354
Sequence TGCCCCCAAGAAACCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163003324_1163003332 18 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1163003332 19:14382373-14382395 GCCAAGACCTGGCTTCCCAAGGG No data
1163003324_1163003330 7 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1163003330 19:14382362-14382384 TGGGGGCAGTTGCCAAGACCTGG 0: 1
1: 0
2: 2
3: 22
4: 191
1163003324_1163003331 17 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1163003331 19:14382372-14382394 TGCCAAGACCTGGCTTCCCAAGG 0: 1
1: 0
2: 4
3: 19
4: 259
1163003324_1163003329 -10 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA 0: 1
1: 0
2: 2
3: 14
4: 148
Right 1163003329 19:14382345-14382367 CTTGGGGGCACACTTGTTGGGGG 0: 1
1: 0
2: 0
3: 7
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163003324 Original CRISPR TGCCCCCAAGAAACCCAAGG TGG (reversed) Intronic
900198174 1:1387970-1387992 GGGCGCCAAGAAAGCCAAGGCGG - Exonic
901857479 1:12053591-12053613 GGCCCCAAGGAAACACAAGGTGG + Intergenic
902112736 1:14096487-14096509 TGCCTCCAAGAAACTTAAGCAGG - Intergenic
902674617 1:18000029-18000051 TGCCTCCAAGGGACCCAAAGGGG + Intergenic
903730941 1:25494823-25494845 TACTCCCCAGAAACCCAAGTAGG + Intronic
904968444 1:34399592-34399614 AGCCTCACAGAAACCCAAGGAGG - Intergenic
906244462 1:44263247-44263269 TGGGCCCAAGCGACCCAAGGAGG + Intronic
911753039 1:101520746-101520768 TACTGCCAAGAAACCCAAGGTGG + Intergenic
912103641 1:106243148-106243170 TGCCCGCAAGAAAAGCAAGGTGG - Intergenic
912435226 1:109656832-109656854 TGGCACCAAGCAACCCATGGTGG + Intronic
912439627 1:109688290-109688312 TGGCACCAAGCAACCCATGGTGG + Intronic
912442944 1:109712738-109712760 TGGCACCAAGCAACCCATGGTGG + Intronic
913524736 1:119679934-119679956 AGCCCCCAAAAAAGCCAAGCAGG + Intronic
919790077 1:201284916-201284938 AGCACCCAGGAAACTCAAGGAGG + Intronic
920209284 1:204316346-204316368 TGCCCACAAGAAACCCAAGTAGG + Intronic
921972608 1:221166506-221166528 TCCCACCAAGAAATCAAAGGTGG - Intergenic
1067223812 10:44362788-44362810 TGGCCCCAAACAGCCCAAGGAGG + Intergenic
1068831211 10:61497370-61497392 TTCCCCCAAAAAACCCCAAGTGG + Intergenic
1069042877 10:63712764-63712786 TGCCCCCAGAAGACCCAAAGAGG - Intergenic
1069698183 10:70402901-70402923 TGCCCACAACATGCCCAAGGTGG - Intergenic
1069786050 10:70988620-70988642 TACCCAAAAGACACCCAAGGTGG - Intergenic
1076906802 10:133366634-133366656 AGCCCCACAGAAACCCAGGGCGG - Intronic
1076906861 10:133366818-133366840 AGCCCCACAGAAACCCAGGGCGG - Intronic
1077095553 11:797609-797631 TACCCCCAAGAAAGGCAATGGGG + Exonic
1077210743 11:1370003-1370025 TGCCCCCATGAGCCCCATGGAGG + Intergenic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1079491470 11:20993291-20993313 TGCCCACAAGGAACCCATTGTGG - Intronic
1079966798 11:26989915-26989937 TGCAGCCTAGAAACCCAAAGGGG - Intergenic
1081654651 11:44849465-44849487 TGCCCCCAACAGAGGCAAGGGGG + Intronic
1083298272 11:61726913-61726935 CGCCCCAGAGAGACCCAAGGGGG - Intronic
1083626165 11:64073132-64073154 TGGCCCTCAGAAACCCACGGTGG - Intronic
1083835225 11:65262223-65262245 TGCGCCCAAGAAGCCCACGGGGG - Exonic
1085137114 11:74101477-74101499 TCCACCTAAGAAACACAAGGTGG + Intronic
1086931260 11:92695389-92695411 TGCCACCAAGAAGGTCAAGGAGG - Intronic
1088891127 11:114045066-114045088 TCTCCACAAGGAACCCAAGGAGG + Intergenic
1091081636 11:132674536-132674558 ACACTCCAAGAAACCCAAGGTGG + Intronic
1091353970 11:134921436-134921458 GGCCCCAAAGAAACCCACGGAGG - Intergenic
1091514963 12:1169909-1169931 TGCCCCAAAGAAACCCCTAGAGG + Intronic
1092241228 12:6837631-6837653 TGCCCCCAAGAGCCCCGGGGTGG + Intronic
1101960991 12:109249927-109249949 TAGCCCCAAAAAATCCAAGGTGG - Intronic
1106504700 13:30360953-30360975 TGCCCACAAGAGACCTAGGGGGG + Intergenic
1107377665 13:39821925-39821947 TGCCCTGAAGACACCCTAGGAGG - Intergenic
1108388065 13:49919888-49919910 TGCCTCAAAATAACCCAAGGAGG + Intronic
1113877579 13:113604236-113604258 AGCCCACAAGAAATGCAAGGAGG + Intronic
1116981265 14:51173630-51173652 TGCCCCCAGCAAACCTCAGGTGG - Intergenic
1117875611 14:60248548-60248570 TGACCCCAGGAAGCCCAAGCAGG - Intronic
1119046462 14:71321629-71321651 TGTCCCCAAGACCCCCAAAGGGG - Intronic
1121419955 14:93806325-93806347 TGCCCCCAAGGAACTCTGGGAGG + Intergenic
1122999045 14:105282249-105282271 TGTCCCCAGCAAACCAAAGGAGG + Intronic
1142234411 16:88915105-88915127 TGCCCCCAAGCCACCAAGGGAGG + Intronic
1143417083 17:6758176-6758198 TGTCCCCAAGGAAACCATGGAGG + Exonic
1150210873 17:63440773-63440795 AGACCCAAAGATACCCAAGGAGG - Intronic
1151124664 17:71831918-71831940 AGCCACCAAGAAGCTCAAGGTGG + Intergenic
1152246230 17:79186038-79186060 TGGCCCAAAGAAAGCCAGGGTGG + Intronic
1152784168 17:82239401-82239423 TGTCCCCAAGACACTCAAGAGGG - Exonic
1156395158 18:36692768-36692790 TGCCCCCCATATACCAAAGGGGG - Intronic
1157167349 18:45370272-45370294 TTCCCCCAAGAGACCCCAGAAGG + Intronic
1161304112 19:3557462-3557484 TGCCCCCACGGCACCCAAGAAGG - Exonic
1161769258 19:6222462-6222484 TGCCTTCAAGGAACCCAAGATGG - Exonic
1162022698 19:7874833-7874855 TGCCCCCCAGAGACCCTGGGCGG - Intergenic
1162084480 19:8240304-8240326 TCCCCCCAAAGACCCCAAGGTGG - Intronic
1162833374 19:13300596-13300618 TGCCCTACAGAAAGCCAAGGAGG - Exonic
1163003324 19:14382332-14382354 TGCCCCCAAGAAACCCAAGGTGG - Intronic
1163328040 19:16617970-16617992 GCCCCCCCAGAAACACAAGGTGG + Intronic
1164602677 19:29573638-29573660 TGCCCCCATGATACTCCAGGAGG + Intergenic
1166073035 19:40397694-40397716 TCCCCCCAGGAAAGCCAAGGTGG - Exonic
1167241648 19:48347238-48347260 TGCTCCCAAGAGACACATGGAGG - Intronic
925903071 2:8522509-8522531 TGGGCCCAGGAGACCCAAGGAGG - Intergenic
926185051 2:10683767-10683789 TGTCCCCAGGAGACCCAAGAGGG + Intronic
927248644 2:20978698-20978720 TGCTCCCAAGAAGACCATGGTGG + Intergenic
929893195 2:45936206-45936228 TGCCCCCAAGCACCCCTTGGGGG + Intronic
932409170 2:71535100-71535122 TGCCCCCAGCAAACCCAAGGAGG + Intronic
933725054 2:85421942-85421964 TGCCCCCAAGAGAGCCCAGGAGG - Intronic
934164609 2:89282701-89282723 GGTGCCCAAGAAACCAAAGGAGG + Intergenic
934202665 2:89899823-89899845 GGTGCCCAAGAAACCAAAGGAGG - Intergenic
940030836 2:149259574-149259596 TGCACCCAAGGAAGCCAAGGTGG + Intergenic
942223238 2:173791596-173791618 TGCCCCCAAGCACAACAAGGAGG - Intergenic
944226595 2:197354876-197354898 TTCCCCCAAGGAAGACAAGGAGG + Intergenic
944341978 2:198612048-198612070 TCCCACTAAGAAAGCCAAGGGGG + Intergenic
947715284 2:232336056-232336078 TGCCCCCAAGGAAGGGAAGGTGG - Intronic
1168804994 20:667218-667240 TACCCCCATGACACACAAGGTGG + Intronic
1173606930 20:44338072-44338094 AGCCCCCAAGAAGTCAAAGGAGG + Intronic
1173840503 20:46153651-46153673 TACCCCAAAGAAAGCTAAGGTGG + Intergenic
1174039401 20:47688330-47688352 TGCCCCTAAGAAGGCAAAGGGGG + Intronic
1174563540 20:51448193-51448215 TGCCCCCAAGAAAACAGAGCCGG + Intronic
1175732923 20:61366336-61366358 TGAACCCAAGAAACATAAGGCGG + Intronic
1175796086 20:61771885-61771907 TGTCCCCAGGAAACTCTAGGTGG - Intronic
1176090182 20:63315146-63315168 TGCCCCCAAGACAGCCCAGTGGG - Intronic
1179320682 21:40288162-40288184 TTCCGCCCAGAAAACCAAGGAGG + Intronic
1179603817 21:42499228-42499250 TGCACCCAGGAAGCCCCAGGAGG + Intronic
1180867389 22:19127300-19127322 TCCCACCAAGAAACTCATGGTGG + Intergenic
1181166843 22:20988535-20988557 TGCCCCCAAAATATCAAAGGGGG - Intronic
1183018353 22:35008075-35008097 TTTCCCCGAGAAACCCAGGGTGG - Intergenic
1185238666 22:49728956-49728978 TGCCTCCGACAGACCCAAGGAGG + Intergenic
950655842 3:14435662-14435684 TGCCCCCAGGTCACCTAAGGTGG - Intronic
951745402 3:25972271-25972293 TGACTCCAAGAAACACAAGTGGG - Intergenic
952409824 3:33037681-33037703 TGCTCCCAAGAAAATCAAGGAGG - Intronic
952871505 3:37904969-37904991 TGCCTACAAGAAACAGAAGGTGG + Intronic
952966558 3:38624574-38624596 TGCCCCCACCACCCCCAAGGTGG + Intronic
953883667 3:46704154-46704176 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883722 3:46704342-46704364 TGTCCCCTAGACACCCAAGGTGG + Intronic
953883736 3:46704395-46704417 TGTCCCCTAGAGACCCAGGGTGG + Intronic
953883803 3:46704615-46704637 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883860 3:46704807-46704829 TGTCCCCTAGACACCCAGGGTGG + Intronic
953883869 3:46704834-46704856 TGTCCCCTAGACACCCAGGGTGG + Intronic
954874420 3:53792339-53792361 TGAGCCCAAGACACCCAAAGTGG + Intronic
957405271 3:79767351-79767373 TGCCCCCAAGAAGCCAAAAGCGG + Intronic
963146575 3:142000931-142000953 TGCCCCCAATAAAGTCATGGGGG - Intronic
964643138 3:158931173-158931195 TTCTGCCAAGAAACCCACGGTGG + Intergenic
974053788 4:56965393-56965415 TGCCCCCAAGGAAATCAAAGGGG + Intronic
974526958 4:63058176-63058198 TGCAGCGAAAAAACCCAAGGAGG + Intergenic
977666464 4:99651009-99651031 TGCCCCCAATAAGCCCGAGCAGG - Exonic
984526511 4:180864986-180865008 TGCCCTCAAGCAAGCTAAGGGGG - Intergenic
985886460 5:2683942-2683964 TGTCCCCCAGAAACCCACGATGG + Intergenic
986160585 5:5224809-5224831 TGCCTGCATGAAACACAAGGTGG + Intronic
994775486 5:104032625-104032647 TGCCCCCAAGAAAGGCAGAGAGG - Intergenic
995090388 5:108168744-108168766 TACCCCCAAGAAAACCAGTGTGG + Intronic
997963209 5:138338149-138338171 TCCCCCCAAGCCACCCATGGAGG - Exonic
998168818 5:139860103-139860125 AGTCCCCAAGAGCCCCAAGGAGG + Intronic
999119130 5:149195501-149195523 TGCCCCCAAGGAGCTGAAGGAGG - Intronic
999134845 5:149311762-149311784 TGTCCTCAGGCAACCCAAGGAGG + Intronic
1004492207 6:16128232-16128254 TGCCTCCAAGCAACCCACTGTGG + Intergenic
1005003445 6:21265194-21265216 TTCCCCCCAGTAACCCAATGAGG - Intergenic
1005135952 6:22570040-22570062 CGCCCCCAAACGACCCAAGGAGG + Exonic
1005391545 6:25339090-25339112 TGACCACAACAAACTCAAGGAGG + Intronic
1007341614 6:41194313-41194335 TGCTCCCCAGGAACCCAATGTGG - Intronic
1007740480 6:44006568-44006590 TGACCCCAGGAAGCCCAAGGCGG + Intergenic
1008887132 6:56443940-56443962 GGCCCCCAAGAGGCCCAGGGAGG - Intergenic
1011273146 6:85600393-85600415 TGAGCCAAAGAAACACAAGGCGG + Intronic
1015493447 6:133854775-133854797 TGACCCCACGAAACCCAGAGGGG + Intergenic
1019657289 7:2202634-2202656 TGCCCCAAAGAAAACCAAACCGG + Intronic
1020036455 7:4966247-4966269 AGCCTCCAAAAAACCCAAGAAGG + Intergenic
1022829400 7:34050034-34050056 TTCCCCTAAGAAACCCAAATAGG - Intronic
1024125020 7:46285117-46285139 TGGCCCCAGGCAACCCAAAGAGG - Intergenic
1025592661 7:62882166-62882188 TGCCCCCAAATATCCCATGGTGG - Intergenic
1028969015 7:96836110-96836132 TGTTCCCAAGAAACTTAAGGAGG - Intergenic
1028985462 7:97005641-97005663 AGCCCCCAAAAAATCCAAGGGGG + Exonic
1029116590 7:98240958-98240980 GGCCCCCAAGAAACCCCCAGTGG + Intronic
1032325123 7:130920817-130920839 TGCCAGAAAGAAACCCAAGAAGG + Intergenic
1032767544 7:135012666-135012688 GGCACCAAAGAAACCCAATGAGG + Intronic
1033605540 7:142925579-142925601 TGCCACCACGAAACTTAAGGGGG + Exonic
1034384884 7:150732735-150732757 AGCCCCCCAAAACCCCAAGGTGG - Intronic
1037057107 8:14456545-14456567 TGTACCAAAGAAACACAAGGAGG + Intronic
1037836364 8:22216972-22216994 TCCTCCCAAGAAACCCAAAAGGG + Intergenic
1039461662 8:37750422-37750444 TGCCGCCCAGAAACAGAAGGTGG + Exonic
1040392618 8:46962590-46962612 TGCCCTTAAGTAACCCAGGGAGG + Intergenic
1042582622 8:70297848-70297870 TGTTCCCAAGAAACACAATGAGG + Intronic
1045242863 8:100417526-100417548 TGTCCCCAAGAGATCCAAGACGG - Intergenic
1049337806 8:142095850-142095872 TGCCCCCTAGACACCCCAAGGGG - Intergenic
1050307080 9:4315691-4315713 TGGCCCCAAAAGACCCAGGGAGG - Intronic
1056793387 9:89640341-89640363 TGCCTCCCAGGAGCCCAAGGTGG - Intergenic
1059176437 9:112173735-112173757 TGCCCTCATAAACCCCAAGGAGG - Intronic
1059544276 9:115160609-115160631 TGCTCTCAAGAAGCTCAAGGAGG - Intronic
1060479069 9:124007372-124007394 TGCCCCCAGGAAACCCCCAGTGG - Intronic
1062315191 9:135963716-135963738 TGGCTCCATGAAACACAAGGCGG + Intergenic
1062657990 9:137614022-137614044 TCCCCCCAAGCAACCCAACGTGG + Exonic
1185734242 X:2485434-2485456 GGCCCCCAAGAAACACAGGAAGG - Intronic
1189179365 X:38988759-38988781 TGCCCCAAAGAAAACCCTGGGGG + Intergenic
1192163661 X:68808892-68808914 TGCCCCAAAGAATCCCAGAGAGG - Intergenic
1193889642 X:87028871-87028893 TGCTCCTAAGTAACTCAAGGTGG - Intergenic
1195532231 X:105969968-105969990 TGCACCCAAGAAAGCCATGGAGG - Intergenic
1196007440 X:110851382-110851404 AACCCCCAAGGAACCCAGGGTGG - Intergenic
1198865602 X:141120222-141120244 TGCACCCAACAAATCCAAAGGGG - Intergenic
1200150113 X:153947195-153947217 TCCCCCCAACCCACCCAAGGAGG + Intergenic
1200301802 X:154983933-154983955 TCCCCCCAGGGAACCCAAGAAGG + Intronic