ID: 1163003324

View in Genome Browser
Species Human (GRCh38)
Location 19:14382332-14382354
Sequence TGCCCCCAAGAAACCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163003324_1163003331 17 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA No data
Right 1163003331 19:14382372-14382394 TGCCAAGACCTGGCTTCCCAAGG No data
1163003324_1163003330 7 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA No data
Right 1163003330 19:14382362-14382384 TGGGGGCAGTTGCCAAGACCTGG No data
1163003324_1163003332 18 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA No data
Right 1163003332 19:14382373-14382395 GCCAAGACCTGGCTTCCCAAGGG No data
1163003324_1163003329 -10 Left 1163003324 19:14382332-14382354 CCACCTTGGGTTTCTTGGGGGCA No data
Right 1163003329 19:14382345-14382367 CTTGGGGGCACACTTGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163003324 Original CRISPR TGCCCCCAAGAAACCCAAGG TGG (reversed) Intronic