ID: 1163004148

View in Genome Browser
Species Human (GRCh38)
Location 19:14387066-14387088
Sequence CAGTAAATGCTCAGGCACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163004148 Original CRISPR CAGTAAATGCTCAGGCACAC CGG Intronic
902433518 1:16381979-16382001 CAGCAAATGCTAAGGCCCAGAGG + Intronic
906674313 1:47682213-47682235 CAGTAAGTGCAAAGGCACAGAGG - Intergenic
907377759 1:54057884-54057906 CAGTATATGCAAAGGCACAGAGG - Intronic
910499040 1:87867737-87867759 CAGGAAAGTCACAGGCACACGGG - Intergenic
913638131 1:120785088-120785110 CTGTAAACCCTGAGGCACACCGG - Intergenic
913938339 1:125078321-125078343 CAGTAACTACTCATTCACACTGG - Intergenic
913944497 1:125145735-125145757 CAGTAACTACTCATTCACACTGG + Intergenic
915800104 1:158781805-158781827 TAGCAAATGCTCAGGTAAACAGG - Intergenic
916578105 1:166084972-166084994 CTGTCAATGCCCAGGCACAAAGG - Intronic
917562439 1:176173346-176173368 CAGTAATTGGCCAGGCACAATGG + Intronic
918863895 1:189869435-189869457 CAGAAAATGGCCAGGCACAGTGG + Intergenic
920679296 1:208060397-208060419 GAGGAAATGCTCAGTCACACTGG + Intronic
922185135 1:223267522-223267544 CAGAACATGCTCAGCAACACTGG + Intronic
924043778 1:240008692-240008714 CTGTCAATGCTCACACACACGGG - Intergenic
924751535 1:246897024-246897046 CAGTAACTGGCCAGGCACAGTGG + Intronic
1066693952 10:38061467-38061489 CAGGCCACGCTCAGGCACACTGG - Intronic
1066949965 10:42107795-42107817 CAGTAACTACTCATTCACACTGG - Intergenic
1066998871 10:42587715-42587737 CAGGCCATGCTCAGGCACACTGG + Intronic
1067716506 10:48694773-48694795 CAGTAAGTGGACAGGCACCCCGG - Intronic
1067725245 10:48765472-48765494 CAGAACATGCACAGGGACACAGG + Intronic
1068561409 10:58518845-58518867 CAGTAAAACCTCACGCTCACGGG + Intronic
1069185585 10:65418337-65418359 AAGTAAATGATGATGCACACAGG - Intergenic
1070891665 10:79945945-79945967 CAGTGAATGCCCAAGCACAAGGG + Intronic
1071136866 10:82463621-82463643 CAGTAAATTATCAAGCACAGAGG - Intronic
1071312741 10:84358975-84358997 CAGTAAATGCCTAGGTTCACAGG - Intronic
1072688601 10:97554532-97554554 AAATAAATGGTCAGGCACAGTGG - Intronic
1073347980 10:102799001-102799023 CAGTAAAAGGTTAGGTACACTGG - Intronic
1074203071 10:111257059-111257081 CTGTTAATGGTCAGGCACAGTGG + Intergenic
1074665420 10:115717352-115717374 CTGTAAATCATTAGGCACACAGG - Intronic
1075150888 10:119929934-119929956 AAGTAAAAGGTCAGGCACAGTGG - Intronic
1075700300 10:124464981-124465003 CAGTAAAGCTGCAGGCACACAGG + Intronic
1076563638 10:131383361-131383383 CAGGAAAGTCCCAGGCACACTGG + Intergenic
1076657006 10:132031393-132031415 CTCTGAATGCTCAGGGACACAGG + Intergenic
1079649337 11:22907364-22907386 CAGTAAATGCTAAAGAAAACTGG - Intergenic
1080122116 11:28690184-28690206 CAGTAAATGCCCAGGTACACAGG - Intergenic
1083859697 11:65413410-65413432 CAGAAAATGTTAAGGCACAATGG - Exonic
1085869654 11:80334387-80334409 CTGAAAATTTTCAGGCACACAGG + Intergenic
1088422740 11:109667165-109667187 CAGTTAATGCTCAATTACACAGG - Intergenic
1089881422 11:121777258-121777280 CAGTAAATGCTTGGCCAGACCGG + Intergenic
1091147650 11:133293769-133293791 CAGTAAATCCACTAGCACACAGG + Intronic
1091868420 12:3863822-3863844 CAGTAACAGGTCAGTCACACAGG - Intronic
1093524578 12:20092069-20092091 CACTAAAGTTTCAGGCACACTGG - Intergenic
1093529423 12:20143232-20143254 CAGTAATTGCTAAAGCACACAGG - Intergenic
1094505594 12:31058379-31058401 CAGTACATGGCCAGGCACAGTGG + Intergenic
1094552479 12:31465664-31465686 CAGATAATGCTCAGTCACATTGG - Intronic
1096081191 12:48833652-48833674 CAGTAAAGGCTCCTGCAAACTGG + Intronic
1099334404 12:81335453-81335475 CAATAAATGGCCAGGCACAGTGG + Intronic
1100345374 12:93724712-93724734 CAATAAATGATAAGGCACATTGG + Intronic
1100819740 12:98420180-98420202 GAGTACATGCTCAGTCCCACAGG + Intergenic
1102022118 12:109690698-109690720 CAGAAAATGACCAGGCACAGTGG - Intergenic
1102652851 12:114455015-114455037 CAGTAAATGTTCTTGCCCACTGG + Intergenic
1105233949 13:18528012-18528034 CAGTAACTACTCATTCACACTGG + Intergenic
1105374929 13:19834970-19834992 AAGAAAATGATCAGGCACAGTGG - Intronic
1108449700 13:50548882-50548904 CAGGAAAGTCTCAGGCAAACTGG + Intronic
1108831435 13:54484229-54484251 CTGGAAATGCTCCAGCACACAGG + Intergenic
1109218134 13:59613689-59613711 CAGTAAAGGCTAAGGGACTCAGG - Intergenic
1109316296 13:60753792-60753814 CAGTCATTCCTCAGGCAAACAGG - Intergenic
1109364519 13:61338736-61338758 CAGTAAAGGGTCAGGCACGGTGG + Intergenic
1113905171 13:113815993-113816015 CAGTCACTGCTCAGGGACACGGG + Exonic
1113905182 13:113816069-113816091 CAGTCACTGCTCAGGGACACGGG + Exonic
1116183645 14:41568501-41568523 CAGTAAATGCTCATGTGCTCAGG - Intergenic
1116972525 14:51081589-51081611 CAGTAAAGGATCAGTCCCACAGG + Intronic
1117453678 14:55876514-55876536 CAGTAAATGAGCAGGGACTCAGG + Intergenic
1117978492 14:61320847-61320869 CAGAAAATGTTCACACACACAGG - Intronic
1118990436 14:70792629-70792651 CAGCTAAGGCTCAGGCACCCTGG - Intronic
1119084950 14:71731026-71731048 CAGCAAATGATCAAGAACACTGG - Intronic
1119429203 14:74555019-74555041 GAGAAAATGTCCAGGCACACAGG + Intronic
1120825117 14:88948028-88948050 CCTTATATGCACAGGCACACCGG + Intergenic
1122440866 14:101730966-101730988 CAGTGATTGCTCAGGTACCCAGG + Intronic
1122742472 14:103880196-103880218 GAGTCAGTGCTCAGGGACACAGG - Intergenic
1122882310 14:104695605-104695627 CAGGAAATGCCCCGGCTCACTGG - Intronic
1127492556 15:59479062-59479084 CAGTAATGGCCCAAGCACACAGG + Intronic
1127634238 15:60853964-60853986 TAGTAAATGATCAGGTACAGTGG + Intronic
1127994280 15:64143771-64143793 CAGTGAATGTTCTGACACACAGG - Intronic
1128013765 15:64323650-64323672 CAGTAATTGGCCAGGCACAGTGG - Intronic
1131343494 15:91625058-91625080 CAAAAAATGGCCAGGCACACTGG + Intergenic
1133149157 16:3813928-3813950 CACCAAATGCCCAGGCACCCTGG + Intronic
1133619620 16:7513832-7513854 CTGTAAACTCACAGGCACACAGG - Intronic
1135302741 16:21345068-21345090 CTGTAACTGCTCAGGCGGACAGG + Intergenic
1136299499 16:29324282-29324304 CTGTAACTGCTCAGGCAGACAGG + Intergenic
1136949176 16:34694204-34694226 CAGTAATTACTCATTCACACTGG + Intergenic
1136968605 16:34944965-34944987 CAGTAACTACTCATTCACACTGG + Intergenic
1137089066 16:36165488-36165510 CAGTAACTACTCATTCACACTGG + Intergenic
1137218437 16:46423843-46423865 CAGTAACTACTCATTCACACTGG - Intergenic
1139325889 16:66152315-66152337 CAGTAAAAGCTTTGGCCCACGGG + Intergenic
1139781582 16:69356022-69356044 CAGCAAATGCCAAGGCAGACAGG + Exonic
1141900095 16:86985437-86985459 CAGTAAATCCCCAGGCAGAAAGG + Intergenic
1142061245 16:88031111-88031133 CCGTAACTGCTCAGGCAGACAGG + Intronic
1142141921 16:88476331-88476353 CAGCAAATGCTGATGGACACGGG - Intronic
1142515994 17:429363-429385 AAATAAATGGCCAGGCACACTGG - Intergenic
1147563025 17:41520472-41520494 AAGAACATGCTCAGGCTCACAGG - Exonic
1151393689 17:73804903-73804925 CAGTAGGTGCTCAGCAACACTGG - Intergenic
1203184162 17_KI270729v1_random:96287-96309 CAGTAACTACTCATTCACACTGG + Intergenic
1153615190 18:6927774-6927796 CATTGAATGCTGAGCCACACGGG - Intergenic
1154515593 18:15161864-15161886 CAGTAACTACTCATTCACACTGG - Intergenic
1157622921 18:49026562-49026584 CAGTGACAGCCCAGGCACACAGG + Intergenic
1158010433 18:52721735-52721757 AAGTAAATGGCCAGGCACAGTGG + Intronic
1159370590 18:67522958-67522980 AAGTAAATGCTCAGGAGCAGAGG - Intergenic
1159518703 18:69490964-69490986 CAGCAAATGCTCAGGGACTGCGG - Intronic
1160157211 18:76442882-76442904 CAGCACATGCGCAAGCACACGGG - Exonic
1160795140 19:941926-941948 TCCCAAATGCTCAGGCACACAGG - Intronic
1161135657 19:2618041-2618063 CAGCACATGCCCAGACACACTGG - Intronic
1161572970 19:5040351-5040373 GGGTACATGCACAGGCACACAGG + Intronic
1162266726 19:9582016-9582038 AAGTAAGTGTTCAGGCACAGTGG + Intronic
1163004148 19:14387066-14387088 CAGTAAATGCTCAGGCACACCGG + Intronic
1163464680 19:17460433-17460455 CAGTATATGGACTGGCACACAGG + Intronic
1165822671 19:38686466-38686488 TATGAAATGATCAGGCACACGGG - Intronic
1166069471 19:40378619-40378641 CAGTACATGCTAACCCACACTGG - Intronic
1166077688 19:40423235-40423257 CAGTAAGTTGTCAGCCACACTGG + Exonic
1166400152 19:42472708-42472730 CAGTAAATGCTCATAGTCACAGG + Intergenic
925793821 2:7521488-7521510 AAGTATATGCAAAGGCACACAGG + Intergenic
925822397 2:7813177-7813199 CAGTAAATGCTCAAGATCAGTGG + Intergenic
933186105 2:79280826-79280848 CTGTAAATCCTCAGGCACCCAGG - Intronic
933413110 2:81950506-81950528 CTGTAAATACCCAGGCAAACAGG - Intergenic
934332117 2:92078319-92078341 CAGTAACTACTCATTCACACTGG + Intergenic
934867974 2:97830997-97831019 CAGAAAATGCTGAAACACACAGG + Intronic
935544645 2:104387754-104387776 CGGGAAATTCTCAGTCACACTGG - Intergenic
937558785 2:123194390-123194412 CAGTAATGGCTTAGGCCCACAGG + Intergenic
937880817 2:126863194-126863216 CAGGAACTACTCAGGCACAGAGG - Intergenic
938515855 2:132006653-132006675 CAGTAACTACTCATTCACACTGG - Intergenic
938790952 2:134675431-134675453 CATTAGATGGTCAGGCACACTGG - Intronic
939756146 2:146114853-146114875 AAGGAAATGCTCAGGCATTCTGG + Intergenic
940319988 2:152366676-152366698 CTGTAAATGGCCAGGCACAGTGG + Intronic
946940969 2:224769920-224769942 CATTAAATGCTGAGGAACACTGG - Intronic
1168856473 20:1012804-1012826 CAGTAAATGCAGAGGCCCAGAGG + Intergenic
1168903491 20:1385788-1385810 CAGCAAATGCAAAGGCCCACGGG - Intronic
1169083405 20:2812153-2812175 GAGTAAATGTTCAGTTACACTGG - Intergenic
1171411904 20:24953191-24953213 CAGTAGATGCTCAGAAACACGGG + Intronic
1172108220 20:32529173-32529195 CAGTAAGTGCTCGGGGTCACAGG - Intronic
1172982138 20:38951296-38951318 CACTAAATGCTCAGCCTCAGAGG - Intronic
1172984299 20:38970725-38970747 TAGTAAATGCTCAAGTACAAGGG + Intronic
1175886141 20:62291945-62291967 CAGTAACTGCCCAGCCACAGGGG - Intronic
1176284737 21:5013368-5013390 CAGCAAAGGCTCTGGCCCACAGG - Intergenic
1176777936 21:13156288-13156310 CAGTAACTACTCATTCACACTGG + Intergenic
1179872444 21:44250107-44250129 CAGCAAAGGCTCTGGCCCACAGG + Intronic
1180525712 22:16257712-16257734 CAGTAACTACTCATTCACACTGG + Intergenic
1182734102 22:32518709-32518731 CATTAAAGTCTGAGGCACACTGG - Intronic
1182811402 22:33119867-33119889 GAGAAAATGCTCTGGCAGACAGG - Intergenic
1183387902 22:37525541-37525563 CAGTGATTCCACAGGCACACTGG - Intergenic
1184907207 22:47496871-47496893 CAATGCATGCTCAGGCACACAGG + Intergenic
1203322658 22_KI270737v1_random:83200-83222 CAGTAACTACTCATTCACACTGG - Intergenic
949216390 3:1574201-1574223 CAGTATATGCAAAGGCACAAAGG - Intergenic
949759952 3:7459371-7459393 CAATAAAGGCTTTGGCACACTGG - Intronic
958980874 3:100718212-100718234 CAGTTAAAGGCCAGGCACACTGG - Intronic
960573256 3:119205926-119205948 CAGGAATTGCTCAGGCAGTCGGG - Intergenic
961501491 3:127339186-127339208 CACTACATGCACATGCACACAGG + Intergenic
962975179 3:140440053-140440075 CAGTAAATTCTCAGGGAGAGTGG + Intronic
963666658 3:148196892-148196914 TAGTAGATACTCAGGCACACAGG + Intergenic
963766018 3:149336665-149336687 CAGTAATTTTTCAGCCACACTGG - Intergenic
967318125 3:188169708-188169730 CAGGAAATGCTCTGGTACAAAGG - Intronic
969631556 4:8341651-8341673 CAGTCACTTCCCAGGCACACAGG - Intergenic
971124105 4:23733606-23733628 CATTTTATCCTCAGGCACACTGG - Intergenic
972512220 4:39778856-39778878 AAGTAAATTCACAGGCACAGAGG - Exonic
975800620 4:78056751-78056773 CAGTTCTTGCTCAGGCACACCGG - Intergenic
978125652 4:105132037-105132059 TAGTAAATGGCCAGGCACAGTGG - Intergenic
980176885 4:129356740-129356762 CAGTAATTCCTCAGGTACTCGGG - Intergenic
981739855 4:147990373-147990395 CAGTCTTAGCTCAGGCACACTGG + Intronic
982988781 4:162244432-162244454 CAGTAAGTAATCAGGCAGACAGG + Intergenic
983479624 4:168256916-168256938 CAGTAAATAAACTGGCACACTGG + Intronic
985011985 4:185592130-185592152 CAGGAAATGCTGAGCCAGACTGG + Intronic
989388843 5:40879918-40879940 CACTGAATGCTCAGGGAGACTGG - Intergenic
992685297 5:79193664-79193686 CAGAAACTGATCAGGCTCACAGG - Intronic
993237002 5:85324109-85324131 GAGTAAATGCTCAGAGACAAAGG + Intergenic
993517019 5:88850129-88850151 CAATAAAAGCACATGCACACAGG - Intronic
997791502 5:136766372-136766394 CAGTAAATGCAGAGACAAACTGG - Intergenic
999959208 5:156735868-156735890 CAGCAGCTTCTCAGGCACACAGG - Intronic
1000009071 5:157214969-157214991 CAGTAAAGGCTCAGGTCCAGGGG + Intronic
1001064064 5:168521306-168521328 CAGTGAATGGCCAGGCACAGTGG - Intergenic
1001502930 5:172253180-172253202 TAGTAAATGGCCAGGCACAGTGG - Intronic
1002298317 5:178243586-178243608 CAGTCAATGCTCAGTGACAGAGG + Intronic
1003986242 6:11437911-11437933 CAGTAAAGGCTTTGGCCCACAGG + Intergenic
1004415961 6:15424253-15424275 CAGTCAATGGCCAGGCACAGTGG - Intronic
1011027146 6:82881454-82881476 CACCAGATGCTCAGGCACCCAGG - Intergenic
1011113642 6:83866038-83866060 CAGAAAACACTCAGGCACAATGG - Intronic
1013042981 6:106454521-106454543 CAGGAAATGCTCAGGCTCACTGG - Intergenic
1013993289 6:116279087-116279109 CTGTGAATGCTCAGGCCGACAGG - Exonic
1015240132 6:131012769-131012791 CATTAAATGATTAGGTACACAGG + Intronic
1015731321 6:136351146-136351168 CAGTGAATGATCAGTCACAATGG + Intronic
1016728138 6:147399247-147399269 CAGAAGATGGCCAGGCACACAGG + Intergenic
1017201694 6:151761529-151761551 CAGAAATTGCTCAGGGTCACAGG - Intronic
1018992326 6:168683726-168683748 CATAAAATGCTTAGGCACAGGGG - Intergenic
1019441595 7:1050214-1050236 CAGTGACTCCTCAGGCACAGTGG + Intronic
1023841593 7:44101421-44101443 CAGTCAGAACTCAGGCACACTGG + Intergenic
1024295473 7:47838492-47838514 CAGCAAATGGTCATGCACAGTGG + Intronic
1025487859 7:61074370-61074392 CAGTAACTACTCATTCACACTGG - Intergenic
1025511961 7:61581253-61581275 CAGTAACTACTCATTCACACTGG - Intergenic
1025556517 7:62316288-62316310 CAGTAACTACTCATTCACACTGG - Intergenic
1025563410 7:62399984-62400006 CAGTAACTACTCATTCACACTGG + Intergenic
1025566125 7:62436101-62436123 CAGTAACTACTCATTCACACTGG + Intergenic
1026915776 7:74119618-74119640 CAGAAAATGGTCAGGCACAGTGG + Intronic
1034367611 7:150565212-150565234 CTGGACATGCTCAGTCACACTGG - Intergenic
1035060241 7:156063612-156063634 CGGTTATTGCTCAGGCATACCGG - Intergenic
1036456976 8:8918244-8918266 CAGTATATGGCCAGGCACAATGG + Intergenic
1038572737 8:28676806-28676828 CAGGTGATGCTTAGGCACACGGG - Intronic
1038697317 8:29817987-29818009 CTGTAAATGGTCAGGCGCAGTGG + Intergenic
1039203955 8:35128910-35128932 CCCTCAATGCTCAGACACACAGG + Intergenic
1039233496 8:35475080-35475102 CAGTAAATACTCAGGGATAAGGG + Intronic
1039553996 8:38464025-38464047 CAATAAGTGGTCAGGCACAATGG + Intronic
1042727445 8:71893452-71893474 CAGTCAACCCTCAGGCTCACAGG + Intronic
1044417721 8:91954936-91954958 CAGTCTATTCTCAGTCACACTGG - Intergenic
1046198726 8:110894085-110894107 AAGTACATGCTCAGTCCCACAGG - Intergenic
1046820991 8:118634206-118634228 CAGTCAATGCACATACACACAGG - Intergenic
1050652717 9:7790826-7790848 AAGTACATGCTCAGTCCCACAGG - Intergenic
1050658690 9:7858649-7858671 CAGTAAGTGCTCAGAAATACAGG + Intronic
1053398850 9:37800515-37800537 CAGTACATACTCAGCCTCACAGG + Exonic
1053946628 9:43315740-43315762 CAGTAAGTACTCATTCACACTGG + Intergenic
1057777091 9:98020041-98020063 CATAAAATGCTTAGGGACACAGG + Intergenic
1057862474 9:98652424-98652446 CAGTAAACTCTCAGGGACTCAGG - Intronic
1058956393 9:109952632-109952654 CACTAAATGCTTAGGTACATAGG - Intronic
1059455211 9:114396197-114396219 CAGTAAAAGCCCTGGCACAGCGG + Intergenic
1059865113 9:118505375-118505397 CAGGTAATGCCCAGGCAAACAGG + Intergenic
1060792450 9:126495687-126495709 CAGTAAACCCTCAGTCTCACAGG - Intronic
1061201631 9:129141559-129141581 GGGGATATGCTCAGGCACACAGG + Intronic
1203589758 Un_KI270747v1:44298-44320 CAGTAAGTACTCATTCACACTGG + Intergenic
1186359634 X:8826809-8826831 CAGAATATGCTCATCCACACGGG - Intergenic
1191846018 X:65548829-65548851 CAGAAAATGTTAAGGCACAATGG + Intergenic
1192664652 X:73076812-73076834 CAGTATTTTCTCAGGGACACAGG - Intergenic
1194249894 X:91561581-91561603 CTGTAAATGGCCAGGCACAATGG + Intergenic
1199919886 X:152388790-152388812 TAATACATGCTCAAGCACACAGG + Intronic
1200860684 Y:7988580-7988602 CAGGGAAGTCTCAGGCACACTGG + Intergenic
1201052577 Y:9952878-9952900 CAATAAGTGCTCAAACACACTGG - Intergenic
1201776349 Y:17670320-17670342 GAGAACATGCTCAAGCACACTGG - Intergenic
1201825207 Y:18235672-18235694 GAGAACATGCTCAAGCACACTGG + Intergenic
1202114473 Y:21457566-21457588 CAGAAAAAGCTCAGGAGCACTGG + Intergenic