ID: 1163004439

View in Genome Browser
Species Human (GRCh38)
Location 19:14388750-14388772
Sequence GAACCCTGGATTGCAGCGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163004439_1163004443 24 Left 1163004439 19:14388750-14388772 CCTGTCGCTGCAATCCAGGGTTC 0: 2
1: 0
2: 0
3: 5
4: 58
Right 1163004443 19:14388797-14388819 ACCCCGACGGAGACTTGTGACGG 0: 1
1: 0
2: 1
3: 2
4: 30
1163004439_1163004441 11 Left 1163004439 19:14388750-14388772 CCTGTCGCTGCAATCCAGGGTTC 0: 2
1: 0
2: 0
3: 5
4: 58
Right 1163004441 19:14388784-14388806 TGAGATCATCACCACCCCGACGG 0: 1
1: 1
2: 1
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163004439 Original CRISPR GAACCCTGGATTGCAGCGAC AGG (reversed) Exonic
904969006 1:34404421-34404443 AAACCCTGTATTGCAGTGAATGG - Intergenic
905272277 1:36794893-36794915 GGACCCTGGATTGCAGCTCTAGG + Intergenic
1064189118 10:13189862-13189884 CACCCCTGGATTACAGCGTCAGG - Intronic
1065403304 10:25331699-25331721 TAACCTTGGAGTGCAGTGACTGG - Intronic
1075883959 10:125880744-125880766 AATCCCTGGATTCCAGCGATGGG - Exonic
1078739100 11:14049972-14049994 CCACCCTGGATTGCATCGACAGG - Intronic
1081964510 11:47161428-47161450 GAAGCCTGGAGGGCAGCGAGAGG - Exonic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1083547444 11:63559422-63559444 GGACCCTGGATTCCTGGGACAGG - Intronic
1090769390 11:129906447-129906469 GACCCCTGGATTTCAACGCCTGG - Intronic
1092716466 12:11394138-11394160 GAACTCTGGAGTGGAGCGCCAGG + Intronic
1098167745 12:67715460-67715482 CATCCCAGGATTGCAGCCACTGG - Intergenic
1101215399 12:102576639-102576661 GAGATCTGGATTGCAGAGACCGG + Intergenic
1101895851 12:108756014-108756036 GAACTCTGGCCTGCAGAGACAGG - Intergenic
1104304330 12:127595629-127595651 GAACTCTGGATTGCAGCAGCTGG + Intergenic
1117690141 14:58298183-58298205 GAACCCAGAATTGCAGCCAGGGG - Intergenic
1122447549 14:101781021-101781043 GAACCATGGAATGCAGCGTGGGG + Intronic
1130846610 15:87753635-87753657 GAATCCAGGATAGCAGGGACAGG + Intergenic
1133255092 16:4511798-4511820 GAACCCTGTATTGCTGGGGCCGG - Exonic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1137282746 16:46992343-46992365 GAGCCCTGAATAGCAGCGGCAGG - Intergenic
1146495347 17:33317276-33317298 GAACCCTTGATTGCAGCAGGAGG - Intronic
1147755228 17:42762956-42762978 GATCCCTGGATTGCTGGGAATGG + Exonic
1148140241 17:45323053-45323075 GACCCCTGGGTTGGAGGGACTGG + Intergenic
1148240008 17:45994062-45994084 GAACCCTGCATTGCAGAAAAGGG - Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
926271586 2:11370873-11370895 GAACCCTGGAATGCAAGGGCAGG - Intergenic
926405801 2:12551506-12551528 GAACCCTGGGCTGCAACCACAGG + Intergenic
927854279 2:26518088-26518110 GAAGCCAGGACTGCAGCCACAGG - Intronic
928311912 2:30218241-30218263 GAACCCTTGATTTAAGGGACAGG - Intergenic
930509814 2:52330301-52330323 GAACACTGGTTAGCAGAGACTGG + Intergenic
932412141 2:71553789-71553811 GCACCCTGGAATGGAGAGACGGG - Exonic
943840286 2:192571962-192571984 GAATCCTGGATTGGATTGACTGG - Intergenic
946177861 2:217932850-217932872 GGCCCCTAGATGGCAGCGACAGG + Intronic
947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG + Intergenic
948795945 2:240402165-240402187 GAATCCTGGGGTGCAGGGACAGG - Intergenic
1170462369 20:16589215-16589237 TCACCCTGGAGTGCAGTGACAGG - Intergenic
1170540522 20:17382851-17382873 GAATCCTGGATTGTAGAGTCTGG - Intronic
1174417921 20:50379717-50379739 GAACCCTGCATCGCAAGGACAGG - Intergenic
957719643 3:83977561-83977583 GAACAATGGATGGCAGAGACTGG - Intergenic
964229172 3:154442883-154442905 GAACCCTGGCTTATAGGGACAGG + Intergenic
965611593 3:170549533-170549555 GCAGCCTGGATTGCAGAGAGGGG - Intronic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
974487818 4:62526713-62526735 GAACCATGGAATCCAGTGACTGG + Intergenic
984041782 4:174744155-174744177 CAACCCAGCATTGCAGCCACTGG + Intronic
985535950 5:465878-465900 GAATCCTGGAGTGGAGCGGCAGG + Intronic
990350595 5:54911738-54911760 GAGCCCTGGACTTCAGAGACAGG - Intergenic
991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG + Intergenic
998178115 5:139914460-139914482 GAACCCTGGAAAGCAGCGAGAGG - Intronic
998382144 5:141733370-141733392 AAACCAAGGATTGCAGCCACCGG + Intergenic
1007402964 6:41614975-41614997 GAGCCCTGGATTGCAGCCATGGG - Intergenic
1014887425 6:126798704-126798726 GAACCCTGAATATCAGAGACAGG + Intergenic
1031544490 7:123034892-123034914 GAACCCAGAATTGCAGGAACAGG - Intergenic
1032298176 7:130661500-130661522 GAACCCTGAATTTCTGCTACAGG + Intronic
1034369875 7:150585575-150585597 GAACCATGGATCCCAGCCACAGG + Intergenic
1039400350 8:37263737-37263759 GGACCCGGGACTGCAGCAACAGG - Intergenic
1042286214 8:67113818-67113840 GAACTCAGGGTTGCAGCGTCTGG + Exonic
1056887430 9:90456970-90456992 TCACCCTGCATTGCAGGGACAGG - Intergenic
1061368966 9:130187285-130187307 GACCCAGGGATGGCAGCGACGGG - Intronic
1190063534 X:47225523-47225545 GAACCTGGGATTGCAGCCCCAGG - Intronic
1191845294 X:65542754-65542776 GAACCCTGAATAGCTGAGACAGG - Intergenic
1199571804 X:149273922-149273944 GAACCCTGGAGTCCAGGTACAGG + Intergenic
1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG + Intergenic