ID: 1163004441

View in Genome Browser
Species Human (GRCh38)
Location 19:14388784-14388806
Sequence TGAGATCATCACCACCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 1, 2: 1, 3: 2, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163004435_1163004441 17 Left 1163004435 19:14388744-14388766 CCACCGCCTGTCGCTGCAATCCA 0: 2
1: 0
2: 0
3: 2
4: 72
Right 1163004441 19:14388784-14388806 TGAGATCATCACCACCCCGACGG 0: 1
1: 1
2: 1
3: 2
4: 83
1163004437_1163004441 14 Left 1163004437 19:14388747-14388769 CCGCCTGTCGCTGCAATCCAGGG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1163004441 19:14388784-14388806 TGAGATCATCACCACCCCGACGG 0: 1
1: 1
2: 1
3: 2
4: 83
1163004439_1163004441 11 Left 1163004439 19:14388750-14388772 CCTGTCGCTGCAATCCAGGGTTC 0: 2
1: 0
2: 0
3: 5
4: 58
Right 1163004441 19:14388784-14388806 TGAGATCATCACCACCCCGACGG 0: 1
1: 1
2: 1
3: 2
4: 83
1163004440_1163004441 -3 Left 1163004440 19:14388764-14388786 CCAGGGTTCAGCTCTTTTTCTGA 0: 2
1: 0
2: 4
3: 21
4: 261
Right 1163004441 19:14388784-14388806 TGAGATCATCACCACCCCGACGG 0: 1
1: 1
2: 1
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163004441 Original CRISPR TGAGATCATCACCACCCCGA CGG Exonic
901751138 1:11409757-11409779 TGAGAGCAGCACCACCCCACTGG - Intergenic
903613235 1:24632305-24632327 TGTGAACAACACCACCCCTATGG - Intronic
908312010 1:62893870-62893892 TCACATCATCACCACCCTCAGGG + Intergenic
909085587 1:71166560-71166582 TAAAAACATCACCACCACGACGG - Intergenic
912871660 1:113312008-113312030 TGAGAAACTCACCACCCTGAAGG + Intergenic
1064404329 10:15047568-15047590 TGGGATTACCACCACCCTGAGGG - Intronic
1064787139 10:18910715-18910737 TGAAACCATCACCACACTGAAGG - Intergenic
1066681777 10:37941880-37941902 TGTCATCCTCACCACGCCGATGG + Intergenic
1067283905 10:44893876-44893898 TGAGATCATCAAGGCCCAGAGGG + Intergenic
1067565031 10:47330320-47330342 TGAGAAGATCACCATCCTGATGG - Intergenic
1068118586 10:52761285-52761307 TGAGTCCATCACCACCCTCATGG - Intergenic
1068135554 10:52948900-52948922 TGTCATCCTCACCACGCCGACGG - Intergenic
1068936133 10:62637372-62637394 AGAGATCATCCCCACCCTGAAGG - Intronic
1069757546 10:70782400-70782422 TGAGACCATCCCCATCCCCAGGG - Intronic
1076713106 10:132349883-132349905 TGAGACCACAACCACCCCGTGGG - Intronic
1076985138 11:230659-230681 TGAGGACATCACAACCCCAAGGG - Intronic
1080616279 11:33947472-33947494 TGATATCACCTCCACCCAGAGGG - Intergenic
1084398346 11:68929527-68929549 TGAGATCATGTACTCCCCGAGGG + Intronic
1091625038 12:2115294-2115316 TGAGCACATCCCCACCCCGGGGG + Exonic
1091802781 12:3334851-3334873 GGGGATCATCCCCACCCCAATGG - Intergenic
1102385661 12:112507364-112507386 TGAGAGCAGCACCACCCCACTGG + Exonic
1106741634 13:32649410-32649432 AGAGATCACCACCACCCTAAAGG - Intronic
1109078925 13:57872981-57873003 TGAGATCATAACGACTCAGATGG - Intergenic
1113015318 13:105822527-105822549 TGGAGTCATCACCACCCAGATGG - Intergenic
1116234502 14:42261079-42261101 TGAAATCATCACCACCATCATGG + Intergenic
1118056825 14:62087477-62087499 TGTGATCATGACCGCCCCGTCGG - Intronic
1119334855 14:73824528-73824550 TGAGATAATCACTTCCCCTAAGG + Intergenic
1119600538 14:75973209-75973231 TGAGCTTATAATCACCCCGAGGG + Intronic
1122814173 14:104304118-104304140 TGAGCTCTTCCCCAGCCCGAGGG - Intergenic
1124045733 15:26148312-26148334 TGAGCTCAATGCCACCCCGAGGG - Intergenic
1129704995 15:77789064-77789086 TGAGATGCTCACCACCGCCAAGG + Intronic
1138684469 16:58712580-58712602 TCAGATTATAACCACCCTGAGGG + Intronic
1142312968 16:89324568-89324590 TGAGATCATGCCCCCCCAGATGG - Intronic
1143880957 17:10029922-10029944 TGAGATCATGAGAACACCGAGGG + Intronic
1154381209 18:13851657-13851679 TGAAATCATCACCACACTCAAGG - Intergenic
1155393532 18:25362571-25362593 TGAGATATGCACCATCCCGATGG + Intergenic
1163004441 19:14388784-14388806 TGAGATCATCACCACCCCGACGG + Exonic
1163063021 19:14773950-14773972 TGAGATCATCACCACCCCCATGG - Exonic
1165830301 19:38727343-38727365 TGGCATCCTCACCACCCCCAGGG + Intronic
1165923659 19:39314247-39314269 TGTGACCATCACCACCTTGAGGG - Exonic
925106965 2:1299928-1299950 TGTGACCATCACCACTCTGAAGG + Intronic
925970268 2:9101648-9101670 TGTGATCATTACCTCCCCAAAGG - Intergenic
927785765 2:25973627-25973649 TGAAATCATCACCACCATCAAGG + Intronic
931989879 2:67779348-67779370 AGAGAACCTCACCACCCTGAAGG + Intergenic
932820224 2:74893610-74893632 TGAAATTAGCACCACCCTGAGGG + Intergenic
936238376 2:110766471-110766493 TGAGATCATCCCCTCCCCACTGG + Intronic
937239437 2:120450754-120450776 AGAGATCATCCCGACCCCGTTGG - Intergenic
946072432 2:217046025-217046047 TGAGACCAACACCAGCCCCAAGG - Intergenic
948302162 2:236915606-236915628 TGTGCTCATCACCACCCTCAGGG - Intergenic
1171440928 20:25162306-25162328 TGAAATCATCACCACCATCAAGG + Intergenic
1175362551 20:58424955-58424977 TGAGATCATGACCACCTTGGTGG - Intronic
1178233840 21:30819381-30819403 TGAGATCATCTTCACACTGAGGG - Intergenic
1178784023 21:35635486-35635508 TGACATCATGACCTCCCCAAGGG - Intronic
1179271645 21:39856072-39856094 TGAGGTCATCACCTCCACCAGGG - Intergenic
1180750646 22:18122062-18122084 TGAGGTTATACCCACCCCGAGGG - Intronic
1183705014 22:39470772-39470794 TGAGGCCATCCCAACCCCGAGGG - Intronic
951758161 3:26115391-26115413 TGAGACCATCACCATGCCAAGGG - Intergenic
952832222 3:37574798-37574820 TCAGACCTTCACCACCCGGAAGG - Intronic
961824564 3:129592292-129592314 TGGGATCCTCACCACTGCGAGGG + Intronic
964852296 3:161107555-161107577 TGAGATTATCAGCAACCTGAGGG + Intronic
970231328 4:13914132-13914154 TGAAACCATCACCACCACCAAGG + Intergenic
982287059 4:153746672-153746694 TGGGGGCATCCCCACCCCGAAGG + Intronic
983266604 4:165514118-165514140 TGATCTAATCACCACCCCAAAGG + Intergenic
987847177 5:23301993-23302015 TGAGAGCAGCACCACCCCACTGG - Intergenic
997322411 5:132989293-132989315 TGAAATCATCACCACAAGGAAGG - Intergenic
998154250 5:139775459-139775481 TGAGCTCATCACCATCCCAGTGG + Intergenic
999240848 5:150126586-150126608 TGAGATCACCACCACCTTAAAGG + Exonic
1002358724 5:178652661-178652683 TGAAACCATCACCACCACCAAGG + Intergenic
1002859735 6:1070334-1070356 TGAGACCCTCTCCACCCCGGCGG + Intergenic
1006008959 6:31026376-31026398 TGAGATCACCACCACCTCTACGG + Exonic
1009301697 6:62031799-62031821 GGGGGTCATCACCACCCAGAAGG + Intronic
1015863492 6:137704697-137704719 TGAGAGCAGCACCACCCCACTGG - Intergenic
1036913008 8:12774693-12774715 AGAGATCATCACTACCCACACGG + Intergenic
1037834030 8:22205825-22205847 TGAGGTCCTGAGCACCCCGAAGG + Intronic
1043316989 8:78935300-78935322 TGAAATCATCACCACTACCAAGG + Intergenic
1044611235 8:94094391-94094413 TGTCTTCATCACCACCCCTAGGG - Intergenic
1045063409 8:98426762-98426784 TGTTATTATCACCACCCCCAGGG - Intronic
1045408347 8:101890499-101890521 TGACTTAATCACCACCCCCAAGG - Intronic
1047956194 8:129977849-129977871 TGAGATCATAAGCACCTTGAGGG + Intronic
1051743261 9:20271526-20271548 TGAGATTATCAGCACACAGAAGG + Intergenic
1055162432 9:73146495-73146517 TGAGGTCATCACCACCCTGATGG + Intergenic
1059269387 9:113062420-113062442 TGAGATCAGGACCATCCCGGCGG + Intergenic
1185831931 X:3310777-3310799 TGAAGGCATCCCCACCCCGAGGG - Exonic
1194592882 X:95821671-95821693 TGACCTAAACACCACCCCGAAGG + Intergenic
1194695563 X:97045426-97045448 TGAGATCATTAGCACATCGATGG + Intronic
1194766242 X:97847129-97847151 CGTGATCCTCACCACTCCGAGGG + Intergenic
1198519928 X:137442281-137442303 TGAAATCATCAAATCCCCGAAGG + Intergenic
1201244075 Y:11986303-11986325 TGAAGGCATCCCCACCCCGAGGG + Intergenic