ID: 1163004443

View in Genome Browser
Species Human (GRCh38)
Location 19:14388797-14388819
Sequence ACCCCGACGGAGACTTGTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 30}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163004435_1163004443 30 Left 1163004435 19:14388744-14388766 CCACCGCCTGTCGCTGCAATCCA 0: 2
1: 0
2: 0
3: 2
4: 72
Right 1163004443 19:14388797-14388819 ACCCCGACGGAGACTTGTGACGG 0: 1
1: 0
2: 1
3: 2
4: 30
1163004437_1163004443 27 Left 1163004437 19:14388747-14388769 CCGCCTGTCGCTGCAATCCAGGG 0: 2
1: 0
2: 1
3: 7
4: 113
Right 1163004443 19:14388797-14388819 ACCCCGACGGAGACTTGTGACGG 0: 1
1: 0
2: 1
3: 2
4: 30
1163004439_1163004443 24 Left 1163004439 19:14388750-14388772 CCTGTCGCTGCAATCCAGGGTTC 0: 2
1: 0
2: 0
3: 5
4: 58
Right 1163004443 19:14388797-14388819 ACCCCGACGGAGACTTGTGACGG 0: 1
1: 0
2: 1
3: 2
4: 30
1163004440_1163004443 10 Left 1163004440 19:14388764-14388786 CCAGGGTTCAGCTCTTTTTCTGA 0: 2
1: 0
2: 4
3: 21
4: 261
Right 1163004443 19:14388797-14388819 ACCCCGACGGAGACTTGTGACGG 0: 1
1: 0
2: 1
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163004443 Original CRISPR ACCCCGACGGAGACTTGTGA CGG Exonic
900641558 1:3690212-3690234 CCCCCGAGGGAGACAGGTGACGG - Intronic
1087164579 11:94988830-94988852 ACCAGGAAGGAGACTTGAGATGG + Intronic
1096078307 12:48818316-48818338 ACCCGGGCGGAGACTGGAGAGGG - Intronic
1102887711 12:116534193-116534215 TCCCCCACGGGGACTTGGGAAGG - Intergenic
1121312822 14:92944353-92944375 AGCCTGGCGGAGACTGGTGAGGG - Intronic
1123126961 14:105953737-105953759 ACCCCCATGGACACTTGTGCTGG + Intergenic
1123407424 15:20029557-20029579 ACCCCCATGGACACTTGTGCTGG + Intergenic
1123516751 15:21036213-21036235 ACCCCCATGGACACTTGTGCTGG + Intergenic
1125765240 15:42131128-42131150 ACCCCAAGGGAGACTTGAGAAGG + Intergenic
1128144362 15:65324363-65324385 AGCCTGGCTGAGACTTGTGATGG + Intergenic
1139477155 16:67208508-67208530 ACTCCTACAGAGACTTGGGAGGG + Intronic
1163004443 19:14388797-14388819 ACCCCGACGGAGACTTGTGACGG + Exonic
1163063019 19:14773937-14773959 ACCCCCATGGAGACTTGTGACGG - Exonic
1167646701 19:50709913-50709935 ACCCTGACTGACACTGGTGATGG + Intronic
938023743 2:127926879-127926901 AACCCGAAGGAGATTTCTGATGG - Intergenic
938840476 2:135157427-135157449 ACACCGACGGGGATTGGTGAAGG + Intronic
946177689 2:217931443-217931465 ACCACCACGGGGACATGTGAGGG + Intronic
1184424541 22:44401826-44401848 ACCGCGAAGGAGAATTCTGAGGG - Intergenic
1184638624 22:45856596-45856618 CCCCTGAAGGAGACTGGTGAAGG - Intergenic
1185269387 22:49922010-49922032 ACCCCGACCTTGAGTTGTGATGG + Intronic
969297410 4:6278105-6278127 TCCCTGAGGGAGACTTGTGAGGG + Intronic
986273010 5:6250412-6250434 AGCCTGAGGGAGGCTTGTGAAGG - Intergenic
998594763 5:143516924-143516946 ACCCCGAAAGAACCTTGTGACGG - Intergenic
1003631601 6:7792383-7792405 ACCCAGAGGGAGAACTGTGAGGG - Intronic
1004181004 6:13380553-13380575 CCCCTGGCGGAGACTTGTGTTGG + Intronic
1005756682 6:28931225-28931247 ACCCTGAGGGATCCTTGTGATGG + Intergenic
1018186055 6:161265815-161265837 ACCCCCACGCAGACTTATCAGGG + Intronic
1019064781 6:169287943-169287965 ACCCCCACGGAGACTCTGGAGGG - Intergenic
1060550634 9:124483352-124483374 TCCCCGAGGGAGGCTGGTGATGG - Intronic
1186496275 X:10015003-10015025 ACCCCGAGGGAGACTGGGGGCGG + Intergenic
1190327653 X:49216489-49216511 ACCCAGATGGAGACGTGTCACGG - Exonic
1194749791 X:97671391-97671413 AGCCAGAGGGAGGCTTGTGAAGG - Intergenic
1201071983 Y:10155492-10155514 ACCCAGACTGAGCCTGGTGATGG - Intergenic
1201632815 Y:16088126-16088148 CCCCCCAAGGACACTTGTGAGGG + Intergenic