ID: 1163004912

View in Genome Browser
Species Human (GRCh38)
Location 19:14391105-14391127
Sequence CTTTCCATCCATGAGGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163004904_1163004912 -5 Left 1163004904 19:14391087-14391109 CCACCCCACGTCCTCTGACTTTC 0: 1
1: 0
2: 0
3: 24
4: 247
Right 1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1163004903_1163004912 11 Left 1163004903 19:14391071-14391093 CCTGTCAAGGTAAGAACCACCCC 0: 1
1: 0
2: 1
3: 7
4: 60
Right 1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1163004906_1163004912 -9 Left 1163004906 19:14391091-14391113 CCCACGTCCTCTGACTTTCCATC 0: 1
1: 0
2: 0
3: 16
4: 171
Right 1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1163004907_1163004912 -10 Left 1163004907 19:14391092-14391114 CCACGTCCTCTGACTTTCCATCC 0: 1
1: 0
2: 1
3: 29
4: 308
Right 1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 215
1163004905_1163004912 -8 Left 1163004905 19:14391090-14391112 CCCCACGTCCTCTGACTTTCCAT 0: 1
1: 0
2: 2
3: 13
4: 195
Right 1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG 0: 1
1: 0
2: 2
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163004912 Original CRISPR CTTTCCATCCATGAGGTTTG GGG Intronic
901856541 1:12047888-12047910 TTTTCCAGCCATCAGGTTTGGGG + Intergenic
902257878 1:15202387-15202409 GTTTTCAGCCATGAAGTTTGGGG - Intronic
902805819 1:18860690-18860712 CATTCCAGCCATGTGGTGTGTGG - Intronic
903983897 1:27210726-27210748 CATTCAGTCCACGAGGTTTGGGG - Intergenic
906145697 1:43558794-43558816 CTTTCCCTCCAGGAGGTTGAGGG + Intronic
908888167 1:68813880-68813902 GTTTCAAGCCATGAAGTTTGTGG + Intergenic
909381697 1:75005991-75006013 CTTTCCTCCCCTGAGGTTAGAGG - Intergenic
909420029 1:75453499-75453521 CTTTTCTTCCGTTAGGTTTGGGG - Intronic
910479716 1:87645443-87645465 CTTTCCTTCTGTGAGGTTTATGG + Intergenic
911822264 1:102437086-102437108 CTTCCCATCCTTTGGGTTTGAGG - Intergenic
912625781 1:111203992-111204014 CCTTCCATCCAGGAAGCTTGTGG - Intronic
913343136 1:117780173-117780195 TTTTGCATCCTTGAGATTTGGGG - Intergenic
913580053 1:120217381-120217403 ATTTCTTTCCTTGAGGTTTGAGG + Intergenic
913628121 1:120681011-120681033 ATTTCTTTCCTTGAGGTTTGAGG - Intergenic
914561980 1:148828813-148828835 ATTTCTTTCCTTGAGGTTTGAGG + Intronic
914610849 1:149301400-149301422 ATTTCTTTCCTTGAGGTTTGAGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918236080 1:182582007-182582029 CTTTCCATCCTGGAGGCCTGTGG + Intronic
920814294 1:209316456-209316478 CTTTCTACCCAAGAGTTTTGTGG + Intergenic
923578612 1:235185683-235185705 CTCTCAATCAATGAAGTTTGAGG - Intronic
923789061 1:237095652-237095674 CTTGCCATCTGTGAGGTTTTGGG + Intronic
923852085 1:237807302-237807324 CTTTCCATTTCTGAGCTTTGTGG + Intronic
924711716 1:246534967-246534989 CTTCCCATCCTTTGGGTTTGAGG - Intergenic
924826933 1:247549671-247549693 CTTTCCATCCATCAGCTTCGTGG + Intronic
1063290746 10:4744368-4744390 GTTTCAAGCCATGAAGTTTGTGG + Intergenic
1064265175 10:13820193-13820215 TTTTCCAGCCATCAGGTTTGTGG + Intronic
1067457117 10:46427030-46427052 CTTTTAAACCATGAAGTTTGTGG + Intergenic
1067630084 10:47957608-47957630 CTTTTAAACCATGAAGTTTGTGG - Intergenic
1067824136 10:49557508-49557530 CTCTCCATCCATCAGCTTGGTGG + Intergenic
1069154344 10:65007362-65007384 CATTTCATCCACTAGGTTTGTGG + Intergenic
1069907641 10:71741053-71741075 GTTCCCATCCATGAGATCTGAGG - Intronic
1070683853 10:78467638-78467660 CCTTCCGTCCATGTGGTTTAGGG - Intergenic
1072536580 10:96368899-96368921 CTTTCAAACTATGAGGTCTGTGG - Intronic
1073800249 10:107033862-107033884 CTTTCCAGCCATGTGGGGTGAGG + Intronic
1076581636 10:131516101-131516123 CTTGCTTTCCATGAGTTTTGTGG - Intergenic
1076591816 10:131588718-131588740 CTTTCCATCCTCGGGGTTTGGGG + Intergenic
1076923445 10:133467468-133467490 CTTTGCATCCATGAGCCCTGTGG - Intergenic
1081044474 11:38254081-38254103 CTTACCCTCCATTAGCTTTGTGG - Intergenic
1085221309 11:74875909-74875931 CTTCCCATCCTTTAGGTTTGAGG - Intronic
1086591618 11:88521802-88521824 CTTTCCCAGCATGAGGGTTGAGG + Intronic
1088350076 11:108876445-108876467 CTTTGGAGCCATGAGGTATGAGG + Intronic
1091039682 11:132265356-132265378 TTTTCCAGCCATGAGATTTTGGG + Intronic
1091517978 12:1204863-1204885 CTTTCCCTCCATCATTTTTGCGG - Intronic
1091700062 12:2653297-2653319 CTTTCTATCTGTGAGGGTTGGGG - Intronic
1093594894 12:20948303-20948325 CTTCCCATCCTTTGGGTTTGAGG + Intergenic
1094447040 12:30542801-30542823 CTTTTCTTCTACGAGGTTTGGGG + Intergenic
1095640563 12:44481160-44481182 CTTCCCATCCTTTGGGTTTGAGG - Intergenic
1096485792 12:51980147-51980169 CTTACCTTCCAGGTGGTTTGGGG + Intronic
1097519096 12:60645758-60645780 CTTTCTATCCTTTGGGTTTGAGG + Intergenic
1098114523 12:67161001-67161023 CTTTCCTACAATGATGTTTGAGG + Intergenic
1098835999 12:75425095-75425117 CTGTCCATACATGAGGTTTGGGG + Intronic
1099794362 12:87379283-87379305 GATCCCATTCATGAGGTTTGAGG - Intergenic
1102228191 12:111244252-111244274 CTTTCCACCCAGGAAGTGTGTGG + Intronic
1104560059 12:129835255-129835277 TTTTCTGTCCATGAGGTTTTGGG + Intronic
1106012837 13:25842041-25842063 CTTTCAACACATGAGCTTTGCGG + Intronic
1107296968 13:38919644-38919666 CTGTGAATCCATCAGGTTTGAGG + Intergenic
1107686153 13:42901268-42901290 CTTTTCATCAAGGAAGTTTGGGG - Intronic
1109000166 13:56791108-56791130 CTTTGCATCCTTGAGGTATATGG + Intergenic
1109258289 13:60111084-60111106 TTATCCATCCATGAGATTTCAGG - Intronic
1109981152 13:69909644-69909666 CATTCCATGCATGAGTTCTGGGG + Intronic
1110896125 13:80754631-80754653 CCTTCCATCCATTAGGATGGAGG + Intergenic
1110943694 13:81386149-81386171 CTGTCCATCCATTACTTTTGGGG + Intergenic
1112674357 13:101681519-101681541 TTGTCAATCCATGAGGTTAGTGG + Intronic
1113681513 13:112248066-112248088 CTTTCTGTCCCTGAGGGTTGTGG - Intergenic
1115259201 14:31436216-31436238 ATTTCTATCCAAGTGGTTTGTGG - Intronic
1118993506 14:70817175-70817197 ATTTCCCTCCATGAGGTATGAGG - Intergenic
1119776303 14:77250954-77250976 CTTTCCAGGCATGCGCTTTGGGG + Intronic
1121573574 14:94965505-94965527 TTTTCCAACCATGAGGGTTTGGG + Intergenic
1121779975 14:96616056-96616078 CTTTCCCTCCAAGGGGTTTCTGG + Intergenic
1121791890 14:96704994-96705016 AGTTTTATCCATGAGGTTTGGGG - Intergenic
1122542373 14:102505592-102505614 TTTTCCATTCAGGAGGTTTTGGG - Exonic
1124052335 15:26209132-26209154 GTTTCCACCCATGAATTTTGGGG + Intergenic
1126731412 15:51686972-51686994 CTTTTCTTCCATGGGTTTTGGGG - Intronic
1127555952 15:60087959-60087981 CTTTCCATCCATGATGCTTCTGG - Intergenic
1127591019 15:60423434-60423456 CTTTTCACCCTTGAAGTTTGAGG - Exonic
1132686854 16:1165817-1165839 CTTTCTCCCCAGGAGGTTTGGGG + Intronic
1133846678 16:9460727-9460749 CTTTTCCTCCACGAGGTCTGAGG - Intergenic
1135295417 16:21275580-21275602 ATTTCCATCCATGACCTTGGAGG + Exonic
1136569606 16:31088747-31088769 CTTACCCTCCATGAGGACTGTGG + Exonic
1137351664 16:47718780-47718802 TTCTCCATCCATGAGGTTCCTGG + Intergenic
1137488200 16:48909223-48909245 ATTTCCATCCAAGTGGTTTAGGG + Intergenic
1142430159 16:90022071-90022093 CTTTTCATCCGTGAGGAGTGGGG + Intronic
1142556003 17:777935-777957 CTTTCCTTCCCAGAGGTTGGTGG - Intronic
1142560637 17:807116-807138 GTGTCCATCCATGAGGCTCGGGG + Intronic
1142594485 17:1022866-1022888 CCTTCCTCCCATGAGGCTTGGGG - Intronic
1142595995 17:1030334-1030356 CTTGCCAACCCTGACGTTTGGGG + Intronic
1144421685 17:15104618-15104640 CTTTGCATCCATCAGGCATGAGG + Intergenic
1147933336 17:43996444-43996466 CTTTCAAGCCATGGGGTTTTGGG + Intronic
1149511050 17:57242061-57242083 CTTTACCTCCTTGAGCTTTGGGG - Intergenic
1150458348 17:65326428-65326450 CCGTTCATCCATGAGGTTTCTGG - Intergenic
1151290037 17:73143087-73143109 CTTTCCAGACATTAGGTTTTGGG + Intergenic
1151806104 17:76406400-76406422 CTCTCCAGCCATGTGGTTTGGGG - Intronic
1151987062 17:77550267-77550289 CTTTCCTGCCTAGAGGTTTGGGG - Intergenic
1152112475 17:78365002-78365024 CTTCCCATCCATGAGATTTGGGG - Intergenic
1152335042 17:79695874-79695896 CTCCCCATCCATGTGGTTTCTGG - Intergenic
1155444211 18:25893886-25893908 CTTCCTATTCATGTGGTTTGGGG - Intergenic
1155652192 18:28155820-28155842 GATTCCATCCATGATGTTGGAGG + Intronic
1155988094 18:32252023-32252045 CATTCCATTCATGAAGGTTGTGG + Intronic
1158121615 18:54054819-54054841 CTGTCCATCCATGAGATCTGAGG + Intergenic
1159517463 18:69476085-69476107 CTTTATATCCATGAGGCCTGGGG + Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161901841 19:7125134-7125156 CTTCCCATCCTAGAGGTGTGAGG - Intronic
1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG + Intronic
1167519713 19:49946798-49946820 CTTTGTTTCCATGAGTTTTGTGG - Intronic
1168200191 19:54809441-54809463 GTTTCCATCCACGAAGCTTGTGG - Intronic
930937566 2:56973329-56973351 CTGTGAATCCATCAGGTTTGAGG - Intergenic
934081967 2:88476527-88476549 TTTTCCACCCATGAGACTTGTGG + Intergenic
934162982 2:89269990-89270012 CTTTCCATGCTTGGGGTGTGGGG + Intergenic
934204291 2:89912534-89912556 CTTTCCATGCTTGGGGTGTGGGG - Intergenic
935200910 2:100855847-100855869 CTTTTCCTCCAAGAGTTTTGGGG - Intronic
937352106 2:121172515-121172537 CTTCCCAGCCATGTGTTTTGTGG + Intergenic
937932563 2:127218595-127218617 TTTTCCATTAATGAGGGTTGGGG + Intronic
939118486 2:138088549-138088571 CTTCACAGCCAGGAGGTTTGGGG - Intergenic
940864781 2:158807206-158807228 TTTTCCAACCCAGAGGTTTGAGG + Intronic
942599982 2:177630923-177630945 CTTTTAAACCATGAGGTTTTGGG + Intronic
943388550 2:187232617-187232639 TTTTCCATGGATGAGGGTTGGGG - Intergenic
943555212 2:189395022-189395044 CTTTTTATCCAGGAGGTTTGTGG - Intergenic
948695530 2:239731414-239731436 TTTTCCCACCATGGGGTTTGGGG + Intergenic
1168812750 20:716702-716724 CTTTGCCTCCATGAGGTTACAGG + Intergenic
1172270526 20:33653329-33653351 CCTTCCTTCCAAGAGGCTTGGGG + Intergenic
1173263678 20:41459196-41459218 ATTTTCAGCCATGAGGTTAGGGG - Intronic
1173936505 20:46870652-46870674 GTTTCAATCCATGTGGTTGGGGG + Intergenic
1174333749 20:49842599-49842621 CTCTCAATCCATGAGGTCAGTGG + Intronic
1174392722 20:50227886-50227908 GTTTCACTTCATGAGGTTTGTGG + Intergenic
1175053851 20:56179503-56179525 ATTACCATCCATGATGTTTCAGG + Intergenic
1175119346 20:56706368-56706390 CTTTCCTTCAATTAGGTTTTTGG - Intergenic
1175884829 20:62283820-62283842 CTGTCCATCCTTTAGGTTTCCGG + Intronic
1177352608 21:19963851-19963873 CTTACCAGCCAGGAGGTTGGTGG - Intergenic
1177925932 21:27215304-27215326 CTTTCTGCCCATGAGGTTTGGGG + Intergenic
1182052799 22:27325905-27325927 TTTTCCTTCCAGGAGGTTGGTGG - Intergenic
1183253386 22:36745604-36745626 CTTCCCATCCATGTGATTTGAGG + Intergenic
1185077261 22:48690119-48690141 CTTTCCATGCAGGAGGGGTGGGG - Intronic
949262396 3:2117513-2117535 CTTTCCTTCCAGGAGGTTGGGGG + Intronic
951059161 3:18184339-18184361 CTTTGCTTCCATGAGGATTCTGG + Intronic
951735920 3:25863599-25863621 CTTTCATGCCATGAGGTTAGGGG - Intronic
952851159 3:37730742-37730764 CTTGCCATCCATGAGTGTTTGGG + Intronic
953269846 3:41430886-41430908 CTTACAAGCAATGAGGTTTGGGG + Intronic
955648488 3:61166846-61166868 CTTTCCATCCTGGAAGTGTGAGG + Intronic
955853041 3:63241498-63241520 CTTTTAATCAATGAGATTTGGGG + Intronic
955999003 3:64708821-64708843 CTTTCCTTCCCAGAGGTCTGTGG + Intergenic
960323367 3:116264925-116264947 CCTTCCTTCCCTGAGGTCTGTGG + Intronic
961395086 3:126580876-126580898 CTTTCAAGACGTGAGGTTTGTGG + Intronic
964552947 3:157905008-157905030 CTTTCTATCCATCAGGCTTATGG + Intergenic
965106436 3:164361277-164361299 TTTTCCATAAATGAGGTGTGGGG - Intergenic
967139508 3:186542924-186542946 CTTGTCATTCAGGAGGTTTGGGG - Intronic
967664780 3:192158134-192158156 GTGTACAACCATGAGGTTTGGGG - Intronic
969185973 4:5474564-5474586 CTTCCCAGCAGTGAGGTTTGTGG - Intronic
971813495 4:31458799-31458821 CTTTTCCTCCATCAGGCTTGAGG + Intergenic
971848665 4:31954390-31954412 ATTTCTAACCATGAGCTTTGAGG - Intergenic
973757223 4:54087203-54087225 CTTTCCTTCCCTGGGGTCTGAGG - Intronic
974468326 4:62286381-62286403 CCTTCCATTCAGGAGGTCTGAGG + Intergenic
974843987 4:67329352-67329374 ATTTCAATACATGAGTTTTGTGG - Intergenic
980104045 4:128570277-128570299 CTATACATACATCAGGTTTGGGG + Intergenic
980368380 4:131836478-131836500 GTTTCTATGCATGAGGTTTTTGG - Intergenic
981240941 4:142474897-142474919 CTTACCATCCAGGTGGTTTCTGG - Intronic
982706014 4:158710788-158710810 CTTGCCATCCTTGAGCTCTGCGG + Exonic
983016824 4:162623658-162623680 TTTTCCATGCATGAGGCTGGGGG + Intergenic
984841171 4:184069117-184069139 CTTTCCATTCTGAAGGTTTGTGG - Intergenic
985550798 5:532628-532650 CTCTCCATCCAGGAGGTCTGAGG - Intergenic
985658534 5:1144190-1144212 CTTCCCCTCCCTGAGGTTGGCGG - Intergenic
986105159 5:4652703-4652725 CTTCCCTTCCCTGAGGTTTGCGG + Intergenic
988439856 5:31220764-31220786 CTTTTCATCCTTCAGGTTGGGGG - Intronic
989185860 5:38625412-38625434 CTTTCCAACCATCAGAATTGTGG - Intergenic
990533605 5:56698214-56698236 CATTCGATCCATGAAATTTGAGG - Intergenic
990697912 5:58443013-58443035 GTTTCCAACCATGAAATTTGGGG - Intergenic
991496930 5:67236120-67236142 CTTTGCATCCATGGAGTCTGTGG - Intergenic
994429410 5:99637779-99637801 CTATCTATCTATGAGGTATGAGG + Intergenic
995926930 5:117386022-117386044 CTTGCCATCCATGAGCTCTCTGG + Intergenic
995992273 5:118255148-118255170 CTTGCCATCCATGTGGTATGTGG - Intergenic
996081777 5:119265636-119265658 CTTCCCATCCATGATGCTGGAGG + Intergenic
996923738 5:128799182-128799204 GTTTCCATACATGAATTTTGGGG - Intronic
997453799 5:134003754-134003776 CTCTCCTTCGATGAGTTTTGGGG - Intronic
998812813 5:145983464-145983486 CTTTTCATCCCTGAGGATTTGGG - Intronic
998929553 5:147165759-147165781 CTTTGCACCAATGAGATTTGGGG + Intergenic
1000267783 5:159654817-159654839 CTTTCCAACCTTAAAGTTTGAGG + Intergenic
1001090989 5:168740824-168740846 TTTTCGTTCCATGAGCTTTGGGG + Intronic
1001350224 5:170955120-170955142 GTTTCCATGGATGGGGTTTGGGG - Intronic
1002185087 5:177450657-177450679 CTTCCCATCCCTGAGGGGTGAGG + Intronic
1003315529 6:5008226-5008248 ATTTCAATACATGAGCTTTGGGG - Intergenic
1006719305 6:36139715-36139737 GTTTCAATCCACCAGGTTTGTGG - Exonic
1007371792 6:41430921-41430943 CTTTCCTTCCCTGAGGGATGAGG - Intergenic
1008447149 6:51605912-51605934 GTTTTAATCCATGAAGTTTGTGG + Intergenic
1008684676 6:53911838-53911860 CTTTCCTTCCATGATATTTCTGG + Intronic
1010573702 6:77507832-77507854 CTTCCCATCCTTTGGGTTTGAGG + Intergenic
1010583481 6:77628123-77628145 CTTTTAATCCATCACGTTTGTGG + Intergenic
1011184094 6:84655088-84655110 CTTTCCATTCAGTAGGATTGGGG + Intergenic
1017778111 6:157695377-157695399 CTCTCGCTCCGTGAGGTTTGAGG - Intergenic
1018389180 6:163329760-163329782 CTTTCCTTCCAGGTGGTGTGAGG + Intergenic
1019833139 7:3353886-3353908 CTCCTCATCCATGAGGTTGGAGG + Intronic
1021502750 7:21348155-21348177 CTTTTAACCCATGAGGTCTGTGG + Intergenic
1021879963 7:25085378-25085400 CTTTCCATTCATTCTGTTTGGGG - Intergenic
1021985611 7:26095543-26095565 CTTTCCATGCTTGACGTTAGAGG + Intergenic
1022317101 7:29255461-29255483 CCTTCCAGCCATGAGGTCAGAGG + Intronic
1022369254 7:29755170-29755192 CTTTGCATTCCTGAGGGTTGTGG + Intergenic
1023806071 7:43873959-43873981 CTGCACACCCATGAGGTTTGTGG - Intronic
1023950492 7:44840109-44840131 CTTTGAACCCAGGAGGTTTGAGG + Intronic
1025067694 7:55872048-55872070 CTTTCTCTCCAGGAGGTATGCGG - Intergenic
1026073791 7:67147343-67147365 TTTGCCATCCATGAGGTTCCTGG + Intronic
1026113932 7:67480516-67480538 TTCTCCATCCATCAGGTGTGAGG + Intergenic
1027160046 7:75795806-75795828 TCTGCCATCCATGAGTTTTGTGG - Intergenic
1029737923 7:102474728-102474750 CTCTGCATCCATGAGGTTGAAGG + Intronic
1029755055 7:102568378-102568400 CTCTGCATCCATGAGGTTGAAGG + Intronic
1029773005 7:102667458-102667480 CTCTGCATCCATGAGGTTGAAGG + Intronic
1030172003 7:106612399-106612421 TTTCCCATACATGAGCTTTGGGG - Intergenic
1030560582 7:111079748-111079770 CTTTCAACACATGAAGTTTGGGG - Intronic
1030688345 7:112508710-112508732 CTTTGCATCCCTGAGATGTGAGG - Intergenic
1031696591 7:124863574-124863596 CTTTGCATCTTTGACGTTTGAGG - Exonic
1033048767 7:137985439-137985461 CTCTCCATCCACGAGGCCTGGGG - Intronic
1033980430 7:147157483-147157505 CTTTTCATCCACCAGGGTTGAGG + Intronic
1035243681 7:157548672-157548694 CTTTCCATTCACTAGATTTGGGG - Intronic
1040396751 8:47007854-47007876 CTTCCCATCCTTTGGGTTTGAGG + Intergenic
1042866756 8:73363249-73363271 CTTGCCATCCATGTGATCTGGGG - Intergenic
1044744782 8:95361582-95361604 CTTTCCATCCATGACGGAGGTGG - Intergenic
1044908943 8:97036068-97036090 TTTACCCTGCATGAGGTTTGTGG + Intronic
1044938628 8:97317893-97317915 CTTTTGCTTCATGAGGTTTGTGG + Intergenic
1046356080 8:113087171-113087193 CTTTCCACGTATGTGGTTTGTGG - Intronic
1047201469 8:122771176-122771198 ATTTTCAACCATGACGTTTGTGG - Intergenic
1050271308 9:3948405-3948427 CTTTCCATCGATGACCTTTTGGG + Intronic
1050663320 9:7907748-7907770 TTTTCCATGCCTGAGATTTGTGG - Intergenic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1051790104 9:20792192-20792214 GTTTCTATCCATAAGGTTTAAGG + Intronic
1051875261 9:21786483-21786505 CTTTCCATCCATGGAGTAAGGGG - Intergenic
1055739169 9:79367087-79367109 CTTTCCATCTATGAGCATTAGGG + Intergenic
1057796559 9:98161929-98161951 CTCTCCATCCAGGAGGAGTGAGG + Intronic
1058237838 9:102515193-102515215 TTTTCCATCCATGAGCTATGAGG - Intergenic
1058649134 9:107158689-107158711 CTGTCCTTCCATGATGTTTGGGG - Intergenic
1059487714 9:114639625-114639647 CTTTTCAGCCAAGAGATTTGGGG + Intronic
1060165268 9:121408432-121408454 GGTTCCATTCATAAGGTTTGGGG + Intergenic
1060806801 9:126582823-126582845 CTTCCCAAGGATGAGGTTTGTGG - Intergenic
1062468873 9:136693500-136693522 TTTTCCATCCCAGAGGGTTGGGG + Intergenic
1187626859 X:21124133-21124155 CTCTCCAGCCAAGAGGTTTTGGG + Intergenic
1189303490 X:39969684-39969706 CTATCCATCCCTGGGGTGTGGGG + Intergenic
1189380638 X:40500124-40500146 CTTTCCAGCCAGGAGATATGAGG - Intergenic
1192807979 X:74526507-74526529 ATTTCCATCCAAGATATTTGAGG - Intronic
1193911449 X:87311403-87311425 CTTACCATGCATGAAGCTTGTGG - Intergenic
1194474981 X:94347332-94347354 CTTTCCAGCCACCAAGTTTGTGG - Intergenic