ID: 1163007436

View in Genome Browser
Species Human (GRCh38)
Location 19:14405825-14405847
Sequence CCTGCTGGTGCGGCCCATCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163007431_1163007436 1 Left 1163007431 19:14405801-14405823 CCTGCTGCTGTGCATCCTCACTT 0: 1
1: 0
2: 1
3: 40
4: 349
Right 1163007436 19:14405825-14405847 CCTGCTGGTGCGGCCCATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163007436 Original CRISPR CCTGCTGGTGCGGCCCATCC AGG Exonic
900176014 1:1291685-1291707 GCTGCTGGTCTGGCCCACCCTGG - Exonic
900242715 1:1624635-1624657 CCTGCTGGACCGGCCATTCCCGG + Intronic
900265591 1:1755639-1755661 CCTGGTGGCCCGGCCCACCCTGG - Intronic
900595579 1:3478805-3478827 ACTGTTGGTGCGTCCCCTCCCGG - Intronic
901492157 1:9602126-9602148 CCTGCAGGTGCTGCTCAGCCAGG - Exonic
901641182 1:10694007-10694029 CCCGCAGGAGCGGCCCGTCCCGG + Intronic
902376439 1:16032237-16032259 CCAGCTGGTGCAGGCCCTCCAGG + Exonic
902747296 1:18482367-18482389 CCTGCAGGTGCTGCGCAGCCCGG + Exonic
903166747 1:21525480-21525502 CCTGATGGAGCGGCCTCTCCTGG + Intronic
903189044 1:21646232-21646254 CCTGCTGGGAAGGCCCATCTGGG - Intronic
903339327 1:22644077-22644099 CCTGCTGCTGCTGCCCCTCAGGG + Exonic
903370511 1:22832136-22832158 CCTGCTGTTGCACCCCAGCCTGG - Intronic
906529219 1:46513611-46513633 CCTGCTGCTGCTCTCCATCCAGG - Exonic
912438667 1:109681044-109681066 TCAGCTGGTGCAGCCCATGCAGG - Intronic
912441188 1:109699489-109699511 TCAGCTGGTGCAGCCCATGCAGG - Intronic
915735869 1:158084540-158084562 CCTCCTGCTGCGTCCCGTCCCGG - Exonic
915934849 1:160084444-160084466 GCTGCTGCTGCAGGCCATCCTGG + Exonic
918477453 1:184940239-184940261 TCTGCTGGTGCCGGCAATCCAGG - Intronic
919739059 1:200971739-200971761 CCTGCTGGTGCTGGCCCTGCTGG - Intronic
921183929 1:212654253-212654275 CCTGCTGGTGATGCACATACTGG + Intergenic
1065866742 10:29921103-29921125 CCAGCTGCTGCTGCCCTTCCAGG - Intergenic
1067066330 10:43106075-43106097 CCTGCTGGCAGGTCCCATCCAGG - Intronic
1072207801 10:93220566-93220588 CCTGCTGGTGGGGACCCTGCAGG - Intergenic
1075402660 10:122172324-122172346 CCTGTTGTTGCTGCCCACCCAGG + Intronic
1075564178 10:123491806-123491828 CCAGCTGGGGCGGCCGATCTGGG - Intergenic
1076686725 10:132201532-132201554 CCTGCTGGTCTGCCCCTTCCTGG - Intronic
1076846556 10:133072124-133072146 CCTGCAGATGAGGCCCTTCCAGG + Intronic
1076870017 10:133188565-133188587 CCAGCTGGGCCGGCCCTTCCGGG + Exonic
1077469730 11:2751549-2751571 ACTGCTGGTGGGCACCATCCCGG + Intronic
1079128112 11:17733058-17733080 CGGCCTGGTGTGGCCCATCCTGG - Intergenic
1083106448 11:60362878-60362900 CCTGCTGGTGCGGGCAAGTCTGG + Intronic
1084392877 11:68890256-68890278 GCTCCTGGTCCCGCCCATCCCGG - Intergenic
1084495741 11:69502059-69502081 CCTCCTGGTGAGGGCCATTCTGG - Intergenic
1084734964 11:71098977-71098999 CCTGTTGGTGTGGCTCATCTTGG - Intronic
1085386566 11:76161336-76161358 CCTGCTTGGGCGCCCCACCCTGG - Intergenic
1086399163 11:86446733-86446755 CCTCCTGGTGGGGCCAACCCAGG + Intronic
1089491433 11:118886602-118886624 CCTGCTGGAAAGGCCGATCCTGG + Intronic
1089491936 11:118889298-118889320 CATGCTGGTGTGGCCCATCTTGG + Intronic
1089895810 11:121929108-121929130 CCTGCTGGTGTGGCCAAATCTGG - Intergenic
1090274228 11:125408468-125408490 CCTCCTGGTGTGGCTCCTCCGGG - Intronic
1091416419 12:290096-290118 CCAGCTGCAGTGGCCCATCCTGG - Intronic
1094218593 12:27970596-27970618 CCTGCCGGCGCGGCGGATCCGGG + Intronic
1095491471 12:42739120-42739142 TCTCCTCGTGTGGCCCATCCTGG + Intergenic
1096596619 12:52699955-52699977 CCTGCTGGTGTGGGCTATCCAGG + Intronic
1101331827 12:103763200-103763222 CCTGCTGGTGCCTGCCACCCAGG - Intronic
1102284429 12:111644208-111644230 CCTCTTGCTGCGGCCCTTCCTGG + Exonic
1102475286 12:113184983-113185005 CCTGCTCGTGGGGCGGATCCTGG - Intronic
1105978529 13:25495155-25495177 CCTCCTGCTGCTGCCCTTCCAGG + Intronic
1110630336 13:77698660-77698682 CCTGCTGGGTCGGCCCCTCCGGG - Intronic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1117982121 14:61352005-61352027 CCTGATGGTGAGGGCCACCCAGG - Intronic
1118946058 14:70388487-70388509 CCTCCTGGAGCCGCCCATCCAGG + Exonic
1121239467 14:92418335-92418357 CCTCCTGGTTCTGCCCATCTTGG + Intronic
1121734220 14:96206518-96206540 CCTGCCGGTGGGACCCAACCTGG + Intronic
1122512392 14:102280122-102280144 CCTGGTGGTGAGGTACATCCTGG + Intronic
1122821184 14:104345974-104345996 CCTGCTGGGGCTGCCCATCCAGG + Intergenic
1122860799 14:104581596-104581618 CCTGCTGGTGCTGTACCTCCGGG - Intronic
1122930041 14:104928926-104928948 CCAGCTGGTGCGCCCCGCCCTGG + Exonic
1128290937 15:66477814-66477836 CCTGCTGGGGCGGCACACCAAGG - Intronic
1129756335 15:78101389-78101411 CTTGCTGGGGTGGCCCAGCCAGG + Exonic
1131248981 15:90818746-90818768 CCAGCTGGTGGGGCGCACCCAGG + Intergenic
1132651686 16:1024074-1024096 GCTGCTGGTGGGGGCCAGCCCGG - Intergenic
1132703001 16:1229915-1229937 GCTGCTGGCGCTGCCCGTCCTGG - Exonic
1132705322 16:1240953-1240975 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132708451 16:1256316-1256338 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1136247829 16:28985453-28985475 GCTCCTGCTGCTGCCCATCCTGG + Exonic
1136275173 16:29175579-29175601 CCTCCAGGTGGGGACCATCCTGG + Intergenic
1136590604 16:31215667-31215689 CCTTCTGGTGAGGCCCCGCCTGG - Intronic
1137721784 16:50631802-50631824 CACACTGGTGAGGCCCATCCTGG + Intronic
1138279184 16:55760282-55760304 CCTGCTGGTGCGGGCCTTTGGGG + Intergenic
1139531991 16:67546972-67546994 CCTGCAGGTGGGGCCTACCCTGG + Intergenic
1142079532 16:88141647-88141669 CCTCCAGGTGGGGACCATCCTGG + Intergenic
1142190149 16:88713676-88713698 GGTGGTGGTGCGGCCCATGCGGG + Exonic
1142765000 17:2059726-2059748 CCAGCGGGCGCAGCCCATCCAGG - Intronic
1143345072 17:6243271-6243293 CCTGCTGCTGCAGCCCAGGCAGG + Intergenic
1143380456 17:6492811-6492833 CCTGCTGTTGCACTCCATCCTGG + Intronic
1143600724 17:7944138-7944160 CCTGCTGGTGCTGTCCACTCAGG - Exonic
1144703757 17:17354274-17354296 CCTGCTCCTGAGGCCCAGCCTGG - Intergenic
1144851997 17:18248521-18248543 CCTGCTGCTGAGGCCCACCTTGG - Intronic
1146054072 17:29572585-29572607 CCTGCTGGTGCTGCTCACCCTGG + Exonic
1147998428 17:44374371-44374393 CCTGCTGCTGCTCACCATCCTGG - Exonic
1148178042 17:45584752-45584774 CCGGCTACTGCTGCCCATCCTGG + Intergenic
1151679553 17:75616237-75616259 GGAGTTGGTGCGGCCCATCCAGG + Intergenic
1151829008 17:76538687-76538709 CCTCCTGGTGGGCCCTATCCAGG + Intronic
1152733498 17:81985303-81985325 CATGCTGGTGCAGCCCTGCCGGG + Intronic
1154047154 18:10916545-10916567 CCTGCTGGTGCCGCACGCCCTGG - Intronic
1154097617 18:11432553-11432575 CCGGCTGGCGCTGCCCAGCCCGG - Intergenic
1157250025 18:46087168-46087190 CCTGGTCGTGAGGCCTATCCTGG - Exonic
1157696044 18:49724515-49724537 TCTGCTTGTGCGGCCCACCACGG - Intergenic
1160792433 19:928879-928901 CCTGTTGGAGCGGCCCAGCCTGG - Intronic
1161447997 19:4328721-4328743 CCTGCTGCTGCGGCCCAGCGGGG - Exonic
1162524646 19:11200417-11200439 CCTTCTGGTCCGGCCCAATCAGG + Exonic
1163007436 19:14405825-14405847 CCTGCTGGTGCGGCCCATCCAGG + Exonic
1164912674 19:32025535-32025557 CCTGCAGGTGGGGCCTACCCTGG - Intergenic
1165147274 19:33739017-33739039 CCTGTGGATGCGGCCCATACTGG - Intronic
1168268929 19:55239276-55239298 CCTGCAGCTGTGGCCCCTCCTGG - Intronic
927522217 2:23705982-23706004 CCTGGTGCTGCTGCCCACCCAGG - Intronic
928270719 2:29852407-29852429 CTGGCTGGTGTGGCCCATCTTGG - Intronic
929827240 2:45318501-45318523 CCTGCTGGTGAGGGCTTTCCAGG - Intergenic
932766369 2:74473066-74473088 CCTTCTGGTGTGGATCATCCCGG - Exonic
937093897 2:119223769-119223791 CCTGCAGGTCCGGCCCTCCCGGG + Intergenic
937294687 2:120802847-120802869 GTTGCTGGTGCGGCCCACACTGG - Intronic
942121462 2:172782038-172782060 CCTGCTGCTGGTGCCCACCCTGG - Intronic
944772062 2:202924736-202924758 GCTGCTGCTGTTGCCCATCCAGG - Intronic
946164847 2:217857705-217857727 CCTGCAGGCGTGGGCCATCCAGG - Intronic
948577894 2:238965882-238965904 GCTGATGGTGCGGCCCAGCTGGG + Intergenic
948630738 2:239301046-239301068 CCTGCTGCTGCTGCTCAGCCGGG + Intronic
1168898193 20:1338304-1338326 CCTGCTGGAGCCGCTCCTCCGGG + Intronic
1171458074 20:25283043-25283065 TCTGCTTGTCCGGCCCCTCCGGG - Intronic
1172038856 20:32029759-32029781 CCGGCTGGGGCTGCCCATCCAGG + Exonic
1173618678 20:44419794-44419816 CGAGCTGGTGCTGCCCTTCCAGG + Exonic
1173924089 20:46768005-46768027 CCTGTTGGTGGAGCCCATGCAGG - Intergenic
1175889707 20:62310745-62310767 GCTGCCGGTGCGGCCCCTCCTGG + Exonic
1175892945 20:62323342-62323364 CCTGATGCTGGGGCCCAGCCAGG - Intronic
1176246100 20:64097868-64097890 CCTGCTGACGCTGCCCTTCCAGG + Exonic
1176520047 21:7817672-7817694 TCTGCTGGGGCAGCCCCTCCGGG + Exonic
1178845301 21:36169569-36169591 CCTGCTGCTGTAGCCCCTCCTGG + Intronic
1180076916 21:45467729-45467751 CCTGCTGGAGCAGCCCAGGCCGG - Intronic
1181585019 22:23848462-23848484 CCAGCTGAGGCGGCCCCTCCTGG - Intergenic
1183328603 22:37207503-37207525 CATGCTGGGGCTGCCCTTCCTGG - Exonic
1184913200 22:47549741-47549763 CCTGCTGTTGCTGCCAACCCAGG - Intergenic
1185014651 22:48335833-48335855 CCTGCTGGGGCAGCTCCTCCTGG + Intergenic
1185346730 22:50313664-50313686 CCTGCTGCGGCGGCACCTCCTGG - Exonic
952011291 3:28903428-28903450 CCAGCTGGTGCCGCCGGTCCCGG - Intergenic
953905781 3:46867660-46867682 CCTGCCGGTCCCGCCCCTCCTGG + Intronic
954069351 3:48131457-48131479 CCTGCTGCTGCGGCTGCTCCAGG + Intergenic
961349243 3:126288499-126288521 CCTGCTTCTGCAGCCCAGCCTGG + Intergenic
963838306 3:150079277-150079299 CCTGCCTGTGTGGCCCAGCCTGG - Intergenic
965550463 3:169959787-169959809 CCTGCTGCTGCTGCCCAGCAAGG + Intergenic
967869753 3:194220306-194220328 GCTGCTGGTGTGGCCCAGCCCGG + Intergenic
967946910 3:194811290-194811312 CCTGCCCGTGGGGCCCGTCCTGG - Intergenic
968276833 3:197446616-197446638 CATGCTGGTGCTGCTGATCCTGG - Intergenic
968555558 4:1244850-1244872 CCTGGCGGTGCTGCCCAGCCAGG + Intronic
968619178 4:1596046-1596068 CCTGCTGATGTGGCCCATGAGGG + Intergenic
969434889 4:7183299-7183321 TCTGCTGCTGCAGCCCAGCCTGG + Intergenic
975028062 4:69576596-69576618 GCTGCTGGTGCCGCCCGCCCTGG - Intergenic
985616804 5:927473-927495 CCTGCTGTTCCAGCCCCTCCTGG + Intergenic
985727147 5:1522508-1522530 CCCGATGGTGCCGCCCCTCCTGG - Intronic
985727572 5:1524048-1524070 CCGGCTGGTGCCGCCCCTGCCGG - Intergenic
985872552 5:2568865-2568887 GCTGATGGTGTGGCCCATGCAGG + Intergenic
995511749 5:112917637-112917659 CCTCCTGGTGCAGTCCCTCCAGG - Intronic
1000759548 5:165205364-165205386 CCTGCTGATGCCTCTCATCCTGG - Intergenic
1001542484 5:172549340-172549362 GCCTCTGGGGCGGCCCATCCTGG + Intergenic
1002269962 5:178064839-178064861 CTTGCTGGTGGGTCCCATCTGGG - Intergenic
1002319480 5:178366364-178366386 CCTGCTGGTGTGGCTCCACCTGG + Intronic
1006425400 6:33960041-33960063 CCTGCTGGTGATGCCCCTGCAGG + Intergenic
1007826639 6:44605823-44605845 CCTGCTGGAGAGGCCCAAGCTGG - Intergenic
1011853781 6:91663356-91663378 CCACCTGGTGCTGTCCATCCAGG + Intergenic
1017156305 6:151325524-151325546 CCTGCTTGTGCGGCCCGGGCGGG + Intronic
1018786970 6:167116086-167116108 CCTGCTGGTGTGCTCCCTCCTGG - Intergenic
1019004491 6:168784753-168784775 CCTGCAGGTCCGGCCAAGCCCGG + Intergenic
1019216516 6:170447360-170447382 GCTGCTGGTGCGGGCCCTGCCGG + Intergenic
1019472164 7:1226932-1226954 CCTGGTGCTGGGGCCCAGCCTGG + Intergenic
1019713602 7:2528614-2528636 ACTACAGGTGCGGCCCACCCAGG + Intronic
1020094908 7:5362790-5362812 CCTGGTGGCGCGGCCCTCCCTGG - Exonic
1024992402 7:55245645-55245667 CCTTTGGGTGCGGCCCATCTGGG - Intronic
1029552517 7:101244944-101244966 CCTGCTGGTGAGGCCTGGCCCGG - Exonic
1029994067 7:104989385-104989407 CCTGCAGGTGCGGCCGATCAGGG + Intergenic
1034818789 7:154197917-154197939 CCAGCAGGAGCGGCCCACCCAGG + Intronic
1034875321 7:154720233-154720255 CCTGCTGGTGCCTCCTCTCCTGG - Intronic
1035062405 7:156079334-156079356 CCAGCAGGGGCTGCCCATCCAGG - Intergenic
1037910754 8:22742326-22742348 CCCGCTGGTGCAGGCCATCGAGG - Intronic
1038537620 8:28365103-28365125 CCTGGTGATGCTGCCCAGCCTGG - Intronic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1043861782 8:85326027-85326049 CCAGCTGGTGAGGCCCAGCGTGG - Intergenic
1044613760 8:94119503-94119525 CCTGCTGGAGCGGCCGCTGCAGG + Intergenic
1045000178 8:97871513-97871535 CCTGCAGGAGCGTCCCTTCCAGG + Intronic
1048575003 8:135683344-135683366 CCTGCTGCTGCTGCCGGTCCCGG + Intergenic
1048807092 8:138250929-138250951 CCTGGTGGTGCAGACCATTCCGG + Exonic
1049656860 8:143802834-143802856 ACTGCTGGTCCGTCCCTTCCTGG - Intronic
1049711126 8:144063838-144063860 GCGGCTGGTGCAGCTCATCCAGG - Intergenic
1049715066 8:144085897-144085919 CCTGCTGGTGCTGACCAGCCCGG + Exonic
1050325209 9:4491235-4491257 CCTAAGGGTCCGGCCCATCCCGG - Intronic
1051433730 9:17007747-17007769 CCTGCCTGTGCAGCCCATCCAGG - Intergenic
1053157405 9:35791080-35791102 GCTGCTGGAGGGGCCCGTCCAGG + Intergenic
1053206429 9:36190505-36190527 CCTGCTCTTGCGCCCCCTCCCGG - Intergenic
1053605529 9:39654841-39654863 CCTGGTTGTGAGGCCTATCCTGG - Intergenic
1053863450 9:42411470-42411492 CCTGGTTGTGAGGCCTATCCTGG - Intergenic
1054248013 9:62687574-62687596 CCTGGTTGTGAGGCCTATCCTGG + Intergenic
1054562126 9:66722099-66722121 CCTGGTTGTGAGGCCTATCCTGG + Intergenic
1057535654 9:95901686-95901708 CCTGCTGGTACTGCCCTTCCAGG + Intronic
1061578980 9:131525189-131525211 CCTGATCGTGCAGCACATCCAGG - Exonic
1195131821 X:101860983-101861005 CCTGCTGGGGCCCCCCATCATGG - Intergenic