ID: 1163008177

View in Genome Browser
Species Human (GRCh38)
Location 19:14409231-14409253
Sequence ACTTGAGGAAAAGCAGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163008171_1163008177 -4 Left 1163008171 19:14409212-14409234 CCACAGATACTACCTCAGGACTT 0: 1
1: 0
2: 1
3: 6
4: 142
Right 1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG 0: 1
1: 0
2: 1
3: 31
4: 349
1163008167_1163008177 24 Left 1163008167 19:14409184-14409206 CCTGCAGGCAGACAGGATCAGGG 0: 1
1: 0
2: 5
3: 34
4: 314
Right 1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG 0: 1
1: 0
2: 1
3: 31
4: 349
1163008165_1163008177 27 Left 1163008165 19:14409181-14409203 CCACCTGCAGGCAGACAGGATCA 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG 0: 1
1: 0
2: 1
3: 31
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163008177 Original CRISPR ACTTGAGGAAAAGCAGGGCT GGG Intronic
900343135 1:2198006-2198028 ACTTGAGGACAGGCAGGACAAGG - Intronic
902142714 1:14370180-14370202 GCTTGAGGGAGAGCAGGGTTGGG + Intergenic
902643342 1:17780714-17780736 ATTGGAGGAAGAGCAGGGGTGGG + Intronic
904655461 1:32042460-32042482 ACTTAGGGATAAGCAGGGATAGG - Intronic
904908295 1:33914503-33914525 CCATGAGCAAAAGCTGGGCTTGG - Intronic
905570666 1:39001943-39001965 AGTAGAGTAAAAGCAAGGCTAGG + Intronic
905647346 1:39633602-39633624 AGTTGAGGAAGGGAAGGGCTGGG - Intronic
906255597 1:44347042-44347064 ACATGAGGAAACTAAGGGCTCGG + Intronic
906537583 1:46560192-46560214 GCTTGAGGAAGAGCATGGCGTGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907771542 1:57469991-57470013 ACTTGAGGAAATGCTGAACTAGG + Intronic
908015953 1:59836296-59836318 ACTTCAGGAAAAGCAGACTTTGG + Intronic
908482160 1:64552258-64552280 ACTTATGGAACATCAGGGCTAGG + Intronic
908758006 1:67486542-67486564 ATTTTAGGACAAGCAGGCCTTGG + Intergenic
910012835 1:82486620-82486642 AGGTGAGGAAAACCAGGCCTAGG + Intergenic
910523065 1:88145512-88145534 ACTTGAAGGAAAACAGGTCTGGG - Intergenic
912947471 1:114096929-114096951 ATTTGAGAAAAAGCAGGCCTGGG + Intronic
913198919 1:116480370-116480392 AATTGTGGATAAGCAGGGATGGG + Intergenic
914692782 1:150046235-150046257 ACTGAAGGAAAAGCAGGTTTTGG - Intergenic
914807898 1:151005150-151005172 GCTTGAAGAAAAGCAGGCCTTGG + Intronic
916859453 1:168787119-168787141 ATTCTAGGAAAAGCAGGGCGGGG + Intergenic
917266589 1:173227615-173227637 ACGTGAGCCAAAGCAGGGCGAGG + Intergenic
917719120 1:177769217-177769239 CTTTGAGGAGAAGCAGGGGTAGG - Intergenic
917736587 1:177926751-177926773 ACTTGAGGAGAAGCTGGCTTTGG - Intronic
917787546 1:178475027-178475049 ACTTGGTGAAAAGGAGGGCTTGG - Intronic
919776897 1:201200110-201200132 ACTCGAGGAAACGCAGAGCCTGG - Intronic
920851568 1:209631642-209631664 ATTTGAGGACCACCAGGGCTGGG + Intronic
921406789 1:214789022-214789044 ACTCTATGAAAAGGAGGGCTTGG + Intergenic
922853083 1:228750899-228750921 ACCTGAGCAAAAGAAGTGCTTGG - Intergenic
923143776 1:231183819-231183841 ATTTGAGGAAAATGAGGGCAGGG + Intronic
924285406 1:242481238-242481260 ACTTGAGCCAAAGCAGGGCGAGG + Intronic
1064823887 10:19373021-19373043 ACTTGAGAATAAGCATGGCCAGG - Intronic
1066151876 10:32630207-32630229 GCTTGAGGAACAGCAGGGACAGG - Intronic
1067571669 10:47376318-47376340 CCTAGTGGAAAAGAAGGGCTGGG + Intronic
1069517267 10:69087899-69087921 ACTTTTGAAAAAGCAGGCCTGGG + Intergenic
1070778289 10:79122997-79123019 TTGTGGGGAAAAGCAGGGCTGGG - Intronic
1071639455 10:87291450-87291472 ACTTGTGGAAGAGGAGGGGTAGG + Intergenic
1072016001 10:91347135-91347157 GCTTGAGGTAAAGAAGGGCATGG - Intergenic
1072320190 10:94241813-94241835 TCTAGAGGAACAGCTGGGCTGGG + Intronic
1072573208 10:96676479-96676501 ACCTGAGGATCAGCAAGGCTGGG - Intronic
1072815862 10:98508700-98508722 ATTTGAGGAAAAGAAGGGAGGGG + Intronic
1074079976 10:110160012-110160034 ACTAGTGAAATAGCAGGGCTAGG - Intergenic
1074492068 10:113947301-113947323 GCTTGATAAAAGGCAGGGCTCGG - Intergenic
1075644114 10:124086461-124086483 CCATGGGGAAAGGCAGGGCTGGG - Intronic
1075964777 10:126601992-126602014 ACGTTAGGAAAAGCAGGGGATGG + Intronic
1076335128 10:129701824-129701846 ACCTGAGGCACAGCAGAGCTGGG - Intronic
1076893636 10:133297799-133297821 ACCTGAGGAAAGGCAGGCCCGGG + Intronic
1077594971 11:3523999-3524021 TCTCGAGGAACAGCAGGCCTGGG + Intergenic
1077790504 11:5434488-5434510 ACTTAAGGGACAGAAGGGCTTGG + Intronic
1078166356 11:8889422-8889444 ACATGAGCCAAAGCAGGGCGAGG + Intronic
1078759582 11:14241653-14241675 ACTGGAGGAAAACCAGGTCTGGG + Intronic
1080042961 11:27778517-27778539 ACTAGAGGGAAAGAACGGCTAGG + Intergenic
1082785449 11:57313863-57313885 ACTTGAGGGAATCCAGGGCTTGG + Exonic
1082793317 11:57362399-57362421 ACTTGGGGAAAATCAAGGCTTGG + Intronic
1082956672 11:58877250-58877272 ACATGAGCCAAAGCAGGGCGAGG - Intronic
1082991435 11:59210777-59210799 AATTGAGGAAAGGCAGAGTTTGG - Exonic
1084166764 11:67378707-67378729 ACTTCAGCAACAGCAGGACTTGG + Intronic
1084250883 11:67897987-67898009 TCTCGAGGAATAGCAGGCCTGGG + Intergenic
1084938234 11:72598676-72598698 ACATGAGGAAAAGGAGGGGGTGG + Intronic
1086636011 11:89086885-89086907 ACTTGTGCACAAGGAGGGCTAGG - Intergenic
1088394458 11:109351087-109351109 AGTTGCGGAAATGCAGGGCTAGG - Intergenic
1088396489 11:109375581-109375603 AATTGAGGAGATGCAGGACTGGG - Intergenic
1089052912 11:115561558-115561580 CCTTCAGGAAAAGGAGGGATGGG - Intergenic
1090063868 11:123487201-123487223 AGTTTAGGAAAACCAAGGCTCGG + Intergenic
1090093769 11:123724203-123724225 CCTTGAGGAAAGGAAGGGTTGGG - Exonic
1090112264 11:123925992-123926014 AATTAAGTAAATGCAGGGCTAGG - Intergenic
1092421140 12:8332771-8332793 TCTCGAGGAACAGCAGGCCTGGG + Intergenic
1093156016 12:15686392-15686414 CCTTGAGCAAATGCAGGGATTGG - Intronic
1095360282 12:41329851-41329873 ACTTGAGTAAAAACAGTACTTGG - Intronic
1096225979 12:49867264-49867286 GCTTGAGGAAACGCAGGGCCTGG - Exonic
1097176896 12:57148567-57148589 AGCTTAGGAAATGCAGGGCTGGG - Intronic
1098415401 12:70229364-70229386 ACTTAAGTAAAGCCAGGGCTGGG - Intergenic
1098530154 12:71532763-71532785 ACTTGAGGAAGAGCTGCACTGGG - Intronic
1100156241 12:91803982-91804004 AAATGAAGAAAAGCAGGGCGGGG + Intergenic
1101454788 12:104819822-104819844 ACAGGAGGAAAAGAAGGGTTGGG - Intronic
1103602573 12:122063626-122063648 ACTGGAGGAATACCAGGCCTGGG + Intergenic
1103733873 12:123046180-123046202 CCTTCAGGAAAGGCAGGACTGGG - Intronic
1105382371 13:19899525-19899547 AGTAGAGGAAAGGCTGGGCTCGG + Intergenic
1105414536 13:20197945-20197967 ACTTAAGGCACAGCAGAGCTGGG - Intergenic
1105432482 13:20350066-20350088 TCTGGAGGAAAAGCAGAGCGTGG - Intergenic
1106107162 13:26742836-26742858 ACTGGGGGAGGAGCAGGGCTAGG - Intergenic
1108078619 13:46709305-46709327 ATTAGAGGGAAAGCTGGGCTGGG - Intronic
1108546643 13:51501794-51501816 TCTTGAAGGACAGCAGGGCTTGG - Intergenic
1109188770 13:59300720-59300742 GCTTGAGGCAAAGCAGTGCAGGG + Intergenic
1109915305 13:68977232-68977254 ACATGAAGGAAAACAGGGCTAGG - Intergenic
1110467259 13:75815899-75815921 ACAAGAGGAAAAGCAGGTTTGGG + Intronic
1111877673 13:93917362-93917384 ACTTGAAAAAAAACAGTGCTGGG - Intronic
1112154468 13:96802255-96802277 ACCAGAAGAAAATCAGGGCTGGG + Intronic
1112560694 13:100511078-100511100 ACTTGAGGAAAAGCAGAGCAAGG - Intronic
1113785346 13:112999562-112999584 ACTGGAGGACACGGAGGGCTGGG - Intronic
1113843827 13:113374965-113374987 ATGTGAGGAAAAGAAGAGCTGGG + Intergenic
1115814487 14:37148131-37148153 ACATAAGGAAAATAAGGGCTGGG - Intronic
1116215001 14:42004687-42004709 ACTGGAGGAAAAGCTTGCCTTGG - Intergenic
1117015419 14:51512785-51512807 AATAGAGGAAAAGCAAGGATTGG + Intronic
1117585540 14:57199316-57199338 ACCTTAGGAAAAGTAGGTCTAGG - Intergenic
1121648838 14:95540541-95540563 ACTAGAGGAAAAGCAAGGCACGG - Intronic
1122812830 14:104297463-104297485 ACTGAAGGCAAAGCAGGGGTGGG - Intergenic
1124456156 15:29844658-29844680 ACTTCTGGAAAAGCAGGTTTTGG + Intronic
1126747081 15:51837045-51837067 ACTAGAAGAAAATGAGGGCTGGG + Intronic
1128271719 15:66316216-66316238 ACGTGGGGAAGAGCAGGTCTAGG - Intronic
1129314406 15:74732500-74732522 ACTCAAGGAAAAGCAGATCTGGG + Intergenic
1129625682 15:77196265-77196287 ATTTGAGGAAAATCAGAGCATGG - Intronic
1130064836 15:80594864-80594886 ACTGGAGGAACAGCAGCTCTGGG + Exonic
1131227674 15:90638792-90638814 TGTTGAGGAAAGGCAGGGCCTGG - Exonic
1131308864 15:91269622-91269644 ACTTTAGGAAAGGAATGGCTGGG + Intronic
1131986341 15:98045717-98045739 ACATTAGGAGAAGCAGGGATAGG - Intergenic
1132364897 15:101250550-101250572 CCTTGGGGAAAAGCAGTTCTTGG - Intronic
1133359872 16:5165836-5165858 TCTCGAGGAACAGCAGGCCTGGG + Intergenic
1133846387 16:9457850-9457872 TCTTGGGGAAAAGCCTGGCTTGG + Intergenic
1134129659 16:11640719-11640741 ACTTGAGGAGAAGCCAAGCTGGG - Intergenic
1136058992 16:27711907-27711929 TCTGGAGGCAAAGCAGGGATAGG - Intronic
1136684013 16:31983645-31983667 ACAAGAGGGGAAGCAGGGCTAGG + Intergenic
1136784639 16:32927197-32927219 ACAAGAGGGGAAGCAGGGCTAGG + Intergenic
1136885144 16:33926609-33926631 ACAAGAGGGGAAGCAGGGCTAGG - Intergenic
1137054212 16:35735658-35735680 TCTGTAAGAAAAGCAGGGCTGGG + Intergenic
1137562943 16:49514632-49514654 AATTGATTAAAAGCAGAGCTAGG - Intronic
1138477073 16:57277696-57277718 CCCTGGGGAAAAGCATGGCTTGG + Intronic
1138791224 16:59906348-59906370 GCATGAGGAAAGGAAGGGCTTGG - Intergenic
1139179096 16:64724736-64724758 CCTTGTGGATAAGTAGGGCTGGG - Intergenic
1139375536 16:66494216-66494238 ACAGGAGGAGAAGCAGGGCACGG + Intronic
1139376771 16:66503799-66503821 ACTTTAGGAGAAGCAGGGCCAGG - Intronic
1139455060 16:67067718-67067740 ACTTTATTAAAAGCAGGGCTTGG + Intronic
1139870714 16:70106965-70106987 CATTAAGGAAATGCAGGGCTGGG + Intergenic
1140305149 16:73796034-73796056 AATTGGGGAACAGCAGAGCTTGG + Intergenic
1140384734 16:74525589-74525611 CATTAAGGAAATGCAGGGCTGGG - Intronic
1142181904 16:88675323-88675345 TCTTGAGGAGGAGTAGGGCTAGG - Intergenic
1203087298 16_KI270728v1_random:1191203-1191225 ACAAGAGGGGAAGCAGGGCTAGG + Intergenic
1142531924 17:585364-585386 ACTTGAGGAATGGCTGGGCAAGG + Intronic
1142813069 17:2405002-2405024 ACTTAAGGAACAGCCGGGCGCGG - Intergenic
1143376284 17:6469459-6469481 ACGTGCGGAAGAGCAGGGCTGGG - Intronic
1144242632 17:13328283-13328305 ACTTGAAGAAAGGAAGGGCATGG + Intergenic
1144581640 17:16462569-16462591 AGTTGAGGAAGAGCAGGGACTGG + Intronic
1146791565 17:35753422-35753444 AGTGGAGGGAAAGCAGGGGTAGG + Intronic
1147144939 17:38479348-38479370 ACAAGAGGGGAAGCAGGGCTAGG + Intronic
1148320605 17:46748571-46748593 AGATGAGGAAAAGGAAGGCTGGG + Intronic
1149467230 17:56889739-56889761 ACTTGGGAAACAGCTGGGCTTGG - Exonic
1150321267 17:64216582-64216604 AGTTGAGGATAAGAAGGCCTGGG + Intronic
1151973136 17:77469345-77469367 ATTTGAGGAAAGGAAGGGCTGGG + Intronic
1153138757 18:1947759-1947781 CCTTGAGGAAATACAGTGCTAGG + Intergenic
1156063926 18:33117092-33117114 AATTGATGAAAAGGAGGTCTGGG + Intronic
1156584738 18:38419638-38419660 AGATGAGGAAAAGAAAGGCTAGG - Intergenic
1157503515 18:48208373-48208395 ACTTGATGCAAATCAGGGGTGGG - Intronic
1158760477 18:60379942-60379964 ACTTTAGGAAAAGCACTGCATGG + Intergenic
1159614182 18:70561420-70561442 TCATGAGGAAAAACAGGGTTAGG - Intergenic
1160524596 18:79527444-79527466 ACTGATGGAGAAGCAGGGCTGGG + Intronic
1161156773 19:2735894-2735916 GCACGAGGAAAAGCAGGGCCAGG + Intronic
1161439621 19:4283278-4283300 AGATGAGGAAATGCAGGGATGGG - Intronic
1162079672 19:8210444-8210466 ACTTGAGGAGAAGCTGCTCTGGG + Intronic
1162821509 19:13226240-13226262 ACTTGAGGAAAACCGGGGGGGGG + Intronic
1162881333 19:13661957-13661979 ACTTGAAGATGGGCAGGGCTTGG + Intergenic
1163008177 19:14409231-14409253 ACTTGAGGAAAAGCAGGGCTGGG + Intronic
1163176034 19:15564499-15564521 ACTTGAGCCAAAGCAGGCTTAGG - Intergenic
1163758796 19:19121766-19121788 ACTTCTGAAGAAGCAGGGCTGGG - Exonic
1164857638 19:31537367-31537389 ACTTGAAGCCAAGAAGGGCTTGG - Intergenic
1164980000 19:32606805-32606827 CCTTAAAGAAAAGCAGGGCCTGG + Intronic
1167195328 19:48024182-48024204 ACTAGAAGAAAAGGAGGGATAGG - Intronic
1167298170 19:48663956-48663978 TCTTGAGGAAAAGGAGGCTTGGG - Intronic
1167913920 19:52725234-52725256 ACTTGGGGAGCAGCAGGGCCCGG + Intronic
1167921430 19:52786236-52786258 ACTTGGGGAGCAGCAGGGCCCGG + Intronic
925200272 2:1961720-1961742 ACTTGAGTACAGGCAGGCCTCGG + Intronic
925847266 2:8045153-8045175 AGTTGAGGAAAAGGAGGGTATGG - Intergenic
926818178 2:16822224-16822246 ACTTGAGGAAAAACAGGTTATGG - Intergenic
927666087 2:25033852-25033874 ACTTGAGCAAAAGCAGGTGTTGG - Intergenic
929314406 2:40460260-40460282 GCTCAAGGAAAAGCAGAGCTTGG + Intronic
929574339 2:43042533-43042555 ATTTGAGAATAAGCAGGGCTAGG + Intergenic
929595589 2:43173637-43173659 GCTTGAGGAACTGAAGGGCTAGG + Intergenic
930178993 2:48332866-48332888 GCTTAGTGAAAAGCAGGGCTGGG + Intronic
933325478 2:80831457-80831479 AATAGAGGAAGAGGAGGGCTAGG - Intergenic
933392027 2:81682411-81682433 ACTGGAGGAAAGGCCGGGCGCGG - Intergenic
933786855 2:85849994-85850016 CCTTGAGGAAAAGCATAGTTGGG - Intronic
933941348 2:87247610-87247632 GCTTCAGGAAAAGAAGGGCAAGG - Intergenic
935618928 2:105112174-105112196 ACTTGAAGAACATGAGGGCTGGG - Intergenic
936338874 2:111613978-111614000 GCTTCAGGAAAAGAAGGGCAAGG + Intergenic
937621754 2:123996334-123996356 ACTTGAGAAAAAGCAGGAAGGGG - Intergenic
937814665 2:126237977-126237999 ACGTGAGGAAAAGCAGTTCTGGG - Intergenic
938265746 2:129926966-129926988 AGTGGAGGAAAAGCAGAGTTTGG + Intergenic
938772604 2:134513215-134513237 ACTGTAGGAGAAGCAGGTCTGGG + Intronic
939710735 2:145516307-145516329 ATTTAAGGAAATGCAAGGCTGGG + Intergenic
939722131 2:145667070-145667092 AGTTGAGGAAGAGCAGGGAGAGG + Intergenic
940058059 2:149534350-149534372 ACTTGGGTATAAGCATGGCTTGG + Intergenic
940750767 2:157625217-157625239 ACTGCAGGAAAAGCTGGTCTGGG - Intronic
941053652 2:160762905-160762927 ACGTGAGCCAAAGCAGGGCGAGG - Intergenic
942597979 2:177610239-177610261 ACTTGAGAAATAGCAGGTATAGG + Intergenic
945411321 2:209511917-209511939 ACTGGATCAAAATCAGGGCTTGG - Intronic
945912894 2:215669623-215669645 ACTTGGGTAAGAGCAGGGCAGGG - Intergenic
948352208 2:237350268-237350290 CCTAGAGCAAAAGCATGGCTTGG - Intronic
948366639 2:237459433-237459455 ACTTGACGACAAGGAAGGCTTGG + Intergenic
1169007985 20:2224795-2224817 ACATGATGAAATGCAGGGTTTGG - Intergenic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169278862 20:4250427-4250449 TCTTGAGCAATAGCAGGACTGGG + Intergenic
1169720855 20:8674724-8674746 ACTTGAGGACAAGGAAGCCTCGG + Intronic
1170058251 20:12230963-12230985 ACTGGAGCAAAAACAGGACTGGG - Intergenic
1172153571 20:32807979-32808001 AGCTGAGGAAGAGCAGGGCCTGG - Exonic
1172221319 20:33276931-33276953 AATGGAGCACAAGCAGGGCTGGG - Intronic
1173656100 20:44701282-44701304 ACTTGCAGAAAGGCGGGGCTGGG - Intergenic
1174766357 20:53257559-53257581 TGTTGAGGATAAGCAAGGCTGGG + Intronic
1176426391 21:6551112-6551134 CCTCGAGGAGAAGCAGGGCGAGG + Intergenic
1177776712 21:25575978-25576000 ACTTAAAGAAAAGCTGTGCTGGG + Intergenic
1178606812 21:34044749-34044771 ACTGGAGGAAGAGCAAGTCTGGG - Intergenic
1178970262 21:37168988-37169010 CCATGAGGTCAAGCAGGGCTAGG - Intronic
1178972694 21:37195045-37195067 ACTAGGGGAAGAGCAGGACTGGG + Intronic
1179300908 21:40109596-40109618 GCATGAGGCAAAGCAGGGCGAGG + Intronic
1179701882 21:43159429-43159451 CCTCGAGGAGAAGCAGGGCGAGG + Exonic
1180733241 22:17997671-17997693 CCTTGACTGAAAGCAGGGCTGGG - Intronic
1180898672 22:19355649-19355671 CTCTCAGGAAAAGCAGGGCTAGG + Intronic
1181001979 22:19992058-19992080 CCAAGAGGAAAAGCAGCGCTGGG + Intronic
1181409661 22:22710178-22710200 ACTTCAGGGAAAGCAGTGCTGGG + Intergenic
1181417116 22:22768359-22768381 ACTTCAGGGAAAGCAGTGCTGGG + Intronic
1182021560 22:27085927-27085949 ACTTTGAGAAATGCAGGGCTAGG - Intergenic
1182077676 22:27506002-27506024 GCTTAAGGCAAGGCAGGGCTGGG + Intergenic
1182579828 22:31300178-31300200 ACCTGAGGAAAAGCAGGTTTGGG + Intergenic
1184552399 22:45211412-45211434 AGATGAGGAAACGGAGGGCTCGG - Intronic
1185170818 22:49292909-49292931 ACTTGATGAAAATCAGTCCTGGG + Intergenic
949103624 3:176958-176980 ACTTGAGGAGAATCAGGTCTCGG - Intergenic
951684443 3:25328702-25328724 ACATGAGCCAAAGCAGGGCGGGG + Intronic
953740806 3:45537651-45537673 ACATGAGGCATAGCAGGGATCGG + Intronic
956804851 3:72799219-72799241 ACCTGAGGGAAAGCACTGCTTGG + Intronic
957065097 3:75515332-75515354 TCTCGAGGAACAGCAGGCCTGGG + Intergenic
957496536 3:80998755-80998777 ACATGAGGAAAAACAGGGTGAGG - Intergenic
960739655 3:120819169-120819191 TGATGAGTAAAAGCAGGGCTTGG - Intergenic
961327746 3:126119362-126119384 CCTGGAGGAAGAGCAGGTCTAGG - Intronic
961718312 3:128874207-128874229 ACTTGTGGGAAAACAGGACTGGG + Intergenic
961898817 3:130191981-130192003 TCTCGAGGAACAGCAGGCCTGGG + Intergenic
962648328 3:137462770-137462792 ACTGAAGACAAAGCAGGGCTAGG - Intergenic
963136275 3:141908258-141908280 ACAGGAGGAAAAACTGGGCTAGG - Intronic
964217040 3:154297104-154297126 CCATGAGGAAAAGCAGGGAGTGG + Intronic
965586792 3:170325985-170326007 ACTTCAGAAATAGCAGGGCTGGG - Intergenic
965691380 3:171360636-171360658 ACCTGAGGTGAAGTAGGGCTGGG - Intronic
965796584 3:172447117-172447139 ACATTAAGAAAAGCAGGGTTTGG - Intronic
965824470 3:172716889-172716911 ACCAGAGGCAAAGCAGGTCTGGG + Intergenic
967313083 3:188124941-188124963 CCTTTAGAAAAAGAAGGGCTGGG + Intergenic
967621866 3:191643015-191643037 ACTTGAAGGACAGCAGAGCTGGG - Intergenic
967970567 3:194996080-194996102 ACTCGTGGGAAAGCTGGGCTGGG - Intergenic
968298371 3:197594418-197594440 ACTTGTGTAAAAGCAAGCCTGGG - Intergenic
969217695 4:5735253-5735275 ACCTGAGGGAATGCAGAGCTGGG + Intronic
969744553 4:9059828-9059850 TCTCGAGGAACAGCAGGCCTGGG - Intergenic
969803964 4:9591942-9591964 TCTCGAGGAACAGCAGGCCTGGG - Intergenic
969870419 4:10101150-10101172 ACCTCAGGAAAAGGAGGCCTGGG + Intronic
970802431 4:19989451-19989473 ACTTGAAGCAGAGAAGGGCTAGG - Intergenic
971191832 4:24435863-24435885 ATTGCAGAAAAAGCAGGGCTTGG - Intergenic
971264449 4:25085648-25085670 AATTGAGGAGAGGCAGGGGTGGG + Intergenic
971922217 4:32955765-32955787 TCTTAAGGAAAAGCAGAGTTAGG + Intergenic
972170618 4:36341324-36341346 ACTTGATGAAAAGCAGTGTGAGG + Intronic
972353677 4:38260516-38260538 GCTTGAGCAAAGGCAGGGGTGGG + Intergenic
972420157 4:38879272-38879294 ACTTCAGGATGAACAGGGCTGGG - Intronic
974359411 4:60857081-60857103 ACATTAGGAAAAGCAGGGTCTGG + Intergenic
975719471 4:77235974-77235996 ACTTGAAGAAAACCAGGAATAGG - Intronic
981422795 4:144570710-144570732 TCCTGAGTAAAAGCAGTGCTTGG + Intergenic
982547376 4:156751163-156751185 ATTTGAGGAAGAGAAGAGCTGGG + Intergenic
983893022 4:173050551-173050573 ACTTGAGAAAAAGCATGGTTTGG - Intergenic
985686910 5:1286369-1286391 AAAGGAGGAAAAGCAGGGCGGGG + Intronic
985962282 5:3311650-3311672 CCTTGAGCAAAAGCAATGCTGGG + Intergenic
987280702 5:16410981-16411003 AGTTTGGGAAGAGCAGGGCTGGG - Intergenic
989072147 5:37522659-37522681 ACGTGAGCCAAAGCAGGGCGAGG + Intronic
989383470 5:40831880-40831902 GTTTGAGAAAAAGTAGGGCTTGG - Exonic
990688112 5:58331038-58331060 ACTTGAGGAACAGTAGCTCTAGG - Intergenic
990852205 5:60219097-60219119 ACTTGACAAAAAGCATGTCTAGG + Intronic
991288048 5:65002443-65002465 AATACAGGAAAAGCAGTGCTAGG - Intronic
992659574 5:78945240-78945262 GCCTGAGGCAAAGCAGGGCGAGG - Intronic
992973608 5:82088496-82088518 TGATGAGGAAAAGCAGAGCTGGG + Intronic
993274387 5:85837834-85837856 ACTTGAGAAAAAACAGGCCCAGG - Intergenic
994116487 5:96066960-96066982 ACTTAAGAAATAACAGGGCTGGG - Intergenic
996021261 5:118593265-118593287 CCCTGAGGAAAACCTGGGCTTGG - Intergenic
997787939 5:136730496-136730518 ACTAGAAGCAAAGCAAGGCTGGG - Intergenic
998012894 5:138709442-138709464 GCCTGAGGAAAATCAGGCCTTGG - Intronic
998362064 5:141596846-141596868 ACATGAGAGAAAGCGGGGCTGGG + Intronic
999786662 5:154896662-154896684 GTTTGAGGAAAAGAAGGGCTGGG + Intronic
1000098280 5:157990146-157990168 AAATGAGGAAAGGAAGGGCTGGG + Intergenic
1000409404 5:160922292-160922314 ACATGAAGAAAACCAGTGCTTGG - Intergenic
1000897810 5:166877879-166877901 ACTTTTGGAAAAGCCGGGCACGG + Intergenic
1001492883 5:172168178-172168200 ACTGGAACCAAAGCAGGGCTTGG + Intronic
1001629740 5:173165807-173165829 GCTTCAGGAAAAGCTGGGCCAGG + Intergenic
1001746612 5:174097278-174097300 CCTTGAGGAGAATCAGGGTTTGG - Intronic
1002422309 5:179154991-179155013 CCTTGAGGAGAAGCAGCGCCTGG - Intronic
1003051260 6:2783017-2783039 ACTGGAGGAAAAGCAACGGTGGG - Intronic
1003416292 6:5911328-5911350 GCTGGAAGAAAAGCAGTGCTTGG + Intergenic
1003693753 6:8381233-8381255 AATTTAGAAAAAGCATGGCTGGG + Intergenic
1004364053 6:14997235-14997257 ACAAGAGGAAGAGGAGGGCTCGG - Intergenic
1004425990 6:15507467-15507489 ACTTGCTGAGAACCAGGGCTGGG + Intronic
1004595421 6:17094844-17094866 GCTTTAGGAAAATCAGGGCTGGG - Intergenic
1004800885 6:19145996-19146018 GCGTGAGGAAGACCAGGGCTTGG - Intergenic
1007110726 6:39312211-39312233 ACAGGTGGAGAAGCAGGGCTGGG + Intronic
1007201218 6:40110933-40110955 ACTGGTAGAAAAGCAGGTCTAGG - Intergenic
1007226207 6:40316625-40316647 TCTTGAGGAGAGGCTGGGCTTGG + Intergenic
1007749136 6:44061311-44061333 ACTTCAGGAAAAGCATCCCTGGG - Intergenic
1008610156 6:53178132-53178154 ACTTAAGAAAAAGTAGGGCCGGG - Intergenic
1010663509 6:78599045-78599067 ACCTGAGGAAAAGAATGCCTTGG - Intergenic
1010871145 6:81041978-81042000 ACTTGAGGATACGGAGGGCAGGG + Intergenic
1011949818 6:92952036-92952058 GCATGAGGCAAAGCAGGGCGAGG + Intergenic
1012032171 6:94085322-94085344 ACTTGAGGGAAAAAATGGCTAGG + Intergenic
1013182379 6:107729068-107729090 ATTTGGGGAAATGCTGGGCTGGG - Intronic
1013598207 6:111680055-111680077 AAATGAGGAAGACCAGGGCTTGG - Intronic
1016140474 6:140602837-140602859 ACTTGAGGAAAATGAGAGCATGG - Intergenic
1016931953 6:149420325-149420347 CCTAGAGGAAACGCAGGGTTAGG - Intergenic
1017770796 6:157643027-157643049 GCTTGAGAAATAGCAGAGCTAGG - Intronic
1018601787 6:165551962-165551984 AGGTGAGGAAAGGAAGGGCTTGG - Intronic
1020023268 7:4881951-4881973 ACTGTGGGAAAAGCAGGGGTGGG - Intronic
1021864898 7:24945964-24945986 AATTCAGGAAAGGCTGGGCTGGG + Intronic
1022924227 7:35043953-35043975 ACTGGAGGAAAAGCAGGCTTGGG - Intergenic
1023275878 7:38518070-38518092 ACTTGAGCCACAGCTGGGCTGGG - Intronic
1024251175 7:47506778-47506800 TCTTTAGGAAAGCCAGGGCTGGG - Intronic
1024359578 7:48454611-48454633 AACTGAGGAAAAGCAGGCCGTGG + Intronic
1025053749 7:55747827-55747849 ACTTGAGGAAGTTCAGGGCCTGG + Intergenic
1025131854 7:56378301-56378323 ACTTGAGGAAGTTCAGGGCCTGG + Intergenic
1025607180 7:63047763-63047785 GCCTGGGGCAAAGCAGGGCTGGG - Intergenic
1026230588 7:68479819-68479841 ACCTCAGTAAAAGCAGAGCTTGG + Intergenic
1026904772 7:74056722-74056744 ACTTGGGGACAGGCAGGGCAGGG - Intronic
1026913127 7:74104225-74104247 ACTTTAAGAAAAACAGGGCCAGG - Intronic
1029448858 7:100629475-100629497 ACTGGAGGGACTGCAGGGCTAGG - Intronic
1029609555 7:101619390-101619412 AGATGAGGAAACCCAGGGCTGGG - Intronic
1029822538 7:103159719-103159741 ACTGGAGGAAAAGCAGACTTGGG - Intergenic
1030162106 7:106519491-106519513 ACCTGAGGTAGACCAGGGCTGGG - Intergenic
1032863669 7:135904925-135904947 ACTGGAGGAGAAGGAGGGTTTGG + Intergenic
1032960579 7:137029049-137029071 ATTGGTGGAAAAGAAGGGCTGGG - Intergenic
1032973594 7:137194956-137194978 GATAGAGCAAAAGCAGGGCTTGG + Intergenic
1034564349 7:151901355-151901377 CCTTCAGGAAAGGGAGGGCTCGG + Intergenic
1035003905 7:155640990-155641012 ACTAGTGGTATAGCAGGGCTGGG - Intronic
1035105110 7:156435492-156435514 ACATGATGTAAAGGAGGGCTTGG - Intergenic
1035618991 8:1023707-1023729 ACTCTAAGGAAAGCAGGGCTGGG - Intergenic
1036125272 8:6056612-6056634 TCTGGAGGAGAAGCAGGGCAGGG - Intergenic
1036251079 8:7163170-7163192 TCTTGAGGAACAGCAGGCCTGGG + Intergenic
1036366409 8:8124290-8124312 TCTTGAGGAACAGCAGGCCTGGG - Intergenic
1036884481 8:12541362-12541384 CCTCGAGGAACAGCAGGCCTGGG + Intergenic
1038145328 8:24889472-24889494 AATTGAGGAGAAGCAGGATTGGG + Intergenic
1038488988 8:27955970-27955992 ACTGGAGGAGAAGCAGGTTTGGG + Intronic
1038940037 8:32294157-32294179 ACTTGGGGAAAATGTGGGCTTGG - Intronic
1039857420 8:41428094-41428116 ATAGGAGGAAAAGCAGGTCTGGG + Intergenic
1040835353 8:51724873-51724895 CCTGGAGGAAGAGCTGGGCTGGG - Intronic
1041853689 8:62423335-62423357 ACTTGAGAAACAGCACGGTTTGG - Intronic
1041893937 8:62902423-62902445 ACTGGAGTAAAAGTTGGGCTTGG - Intronic
1042654184 8:71077551-71077573 TTTTGAGGAAAGGCAGGGCTTGG - Intergenic
1043458719 8:80438184-80438206 AGTTGAGGAAGAGCCGGGCTGGG + Intergenic
1046654169 8:116874575-116874597 GCTGGAGGAAAAGAAGGGGTCGG + Intronic
1047579590 8:126199567-126199589 ACGTGAGCCAAAGCAGGGCGAGG + Intergenic
1048076035 8:131072601-131072623 AAGTGAGGAAAAGCAGGATTGGG + Intergenic
1048115007 8:131511273-131511295 GCTTGAAGAAAAGCATGGATAGG + Intergenic
1048646861 8:136430226-136430248 ACTTGAGGGGAAGCAGGGAGGGG + Intergenic
1048955175 8:139530099-139530121 ACTTGAGGACACACTGGGCTGGG - Intergenic
1049237570 8:141519726-141519748 TCTTCAGCAAAACCAGGGCTTGG - Intergenic
1050523659 9:6527243-6527265 ACTAGAGGAGAAGCAGGGAGAGG + Intergenic
1051424337 9:16918469-16918491 ACTTGAGGATGAGGAAGGCTTGG + Intergenic
1052149827 9:25102159-25102181 GCTTGAGCCAAAGCAGGGCGAGG + Intergenic
1052696868 9:31889112-31889134 GCTTGAGCCAAAGCAGGGCGAGG - Intergenic
1052744922 9:32431554-32431576 ACTGGAGGAAATACAGGGTTAGG - Intronic
1052911396 9:33885320-33885342 CGTTAAGGAAAAGCTGGGCTGGG - Intronic
1055275068 9:74606040-74606062 AACTGAGGCACAGCAGGGCTAGG - Intronic
1055594986 9:77857005-77857027 CCTTGAGGAAGAGGAGGGCATGG - Intronic
1055910484 9:81344903-81344925 ACTTCCTGAAAAGCAGGGATGGG + Intergenic
1056574201 9:87842824-87842846 CCTAAAGGAAAAGCAGGGTTAGG + Intergenic
1057029689 9:91766034-91766056 ACTTGAGAATATGCAGGGATAGG - Intronic
1058061593 9:100502655-100502677 AAATGAAGAAAAGCAGGGCTGGG - Intronic
1058367109 9:104221277-104221299 GCATGAGCCAAAGCAGGGCTAGG - Intergenic
1059670248 9:116484407-116484429 CCTTGGGGACACGCAGGGCTGGG - Intronic
1059822189 9:117985663-117985685 AGTAGAGGAAATGTAGGGCTTGG - Intergenic
1060045034 9:120333149-120333171 CTTTGAAGAAAGGCAGGGCTTGG + Intergenic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1060506301 9:124200764-124200786 ATTTAAGGAAGAGAAGGGCTGGG - Intergenic
1061724550 9:132574989-132575011 TCCTGGGGAAAAGCAGGCCTGGG - Intergenic
1062387878 9:136321511-136321533 TCCTGAGGAATGGCAGGGCTTGG - Intergenic
1186441130 X:9587379-9587401 ATTAGAGGCAAAGAAGGGCTTGG + Intronic
1186950297 X:14617100-14617122 ACTTGAGCAAAAGCCTAGCTTGG - Intronic
1187012480 X:15294146-15294168 ACATGAGAACCAGCAGGGCTGGG + Intronic
1187420475 X:19129678-19129700 CCATGAGGAAAACCAGGGCGAGG - Intergenic
1189203064 X:39214556-39214578 ACTGGAGCAAAGACAGGGCTTGG + Intergenic
1189930527 X:46004302-46004324 ACATGAGCCAAAGCAGGGCAAGG - Intergenic
1192329227 X:70161048-70161070 AATAGAGCAAAAGCAGGGGTGGG - Intronic
1193015323 X:76725874-76725896 GCGTGAGCAAAAGCAGGGCGAGG - Intergenic
1195504914 X:105645951-105645973 ACTTGAAGTAAAGAAGGGCAAGG - Intronic
1197240396 X:124117031-124117053 AATTGAGGAGAAGCTGGGCAAGG - Intronic
1197277603 X:124498084-124498106 ACAAGAGGAAGAGCAGGGTTTGG - Intronic
1197727888 X:129788353-129788375 ACTTGAGGCAAAAGAGGCCTTGG - Intronic
1198721873 X:139631087-139631109 ACTTGAAGAAATGAAGGGTTTGG - Intronic
1199848626 X:151709468-151709490 AGTTGAGGAAGAGCAGGTTTAGG + Intergenic
1199901464 X:152176623-152176645 ACTTGAAGAAGAGCAGGTTTAGG + Intronic
1200011322 X:153123078-153123100 TCCTGTGGAAAAGCAAGGCTGGG + Intergenic
1200028277 X:153276844-153276866 TCCTGTGGAAAAGCAAGGCTGGG - Intergenic
1200910929 Y:8530846-8530868 AATTAAGGAAATGCAGGGATGGG - Intergenic
1200956244 Y:8949007-8949029 GTGTGAGGCAAAGCAGGGCTAGG - Intergenic
1201431699 Y:13909427-13909449 ACATGAGCCAAAGCAGGGCGAGG + Intergenic
1201941571 Y:19466140-19466162 ACTTGAAAAAATTCAGGGCTTGG - Intergenic
1202336598 Y:23818251-23818273 CCTGGAGGAAAGGTAGGGCTGGG + Intergenic
1202534168 Y:25851820-25851842 CCTGGAGGAAAGGTAGGGCTGGG - Intergenic