ID: 1163008463

View in Genome Browser
Species Human (GRCh38)
Location 19:14410578-14410600
Sequence CCTCCCTGAAGCGTGGCTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163008463_1163008472 6 Left 1163008463 19:14410578-14410600 CCTCGAGCCACGCTTCAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1163008472 19:14410607-14410629 TGAGGCAGAGACAGCCGCTGGGG 0: 1
1: 0
2: 2
3: 49
4: 398
1163008463_1163008471 5 Left 1163008463 19:14410578-14410600 CCTCGAGCCACGCTTCAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1163008471 19:14410606-14410628 CTGAGGCAGAGACAGCCGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 271
1163008463_1163008474 30 Left 1163008463 19:14410578-14410600 CCTCGAGCCACGCTTCAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1163008474 19:14410631-14410653 GAGAGCTGCAGCTGCCTCCCAGG 0: 1
1: 1
2: 5
3: 55
4: 471
1163008463_1163008470 4 Left 1163008463 19:14410578-14410600 CCTCGAGCCACGCTTCAGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 112
Right 1163008470 19:14410605-14410627 CCTGAGGCAGAGACAGCCGCTGG 0: 1
1: 0
2: 3
3: 28
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163008463 Original CRISPR CCTCCCTGAAGCGTGGCTCG AGG (reversed) Intronic