ID: 1163009134

View in Genome Browser
Species Human (GRCh38)
Location 19:14413737-14413759
Sequence GAACCCACTGGGCTTTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 134}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163009117_1163009134 25 Left 1163009117 19:14413689-14413711 CCTCAGACTACTCAGCCCAGAGA 0: 1
1: 0
2: 2
3: 20
4: 239
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009120_1163009134 0 Left 1163009120 19:14413714-14413736 CCCCCTCCCTATCACTCCCCAAG 0: 1
1: 0
2: 3
3: 37
4: 645
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009121_1163009134 -1 Left 1163009121 19:14413715-14413737 CCCCTCCCTATCACTCCCCAAGG 0: 1
1: 0
2: 1
3: 36
4: 353
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009123_1163009134 -2 Left 1163009123 19:14413716-14413738 CCCTCCCTATCACTCCCCAAGGA 0: 1
1: 0
2: 0
3: 26
4: 263
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009126_1163009134 -7 Left 1163009126 19:14413721-14413743 CCTATCACTCCCCAAGGAACCCA 0: 1
1: 0
2: 1
3: 19
4: 220
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009124_1163009134 -3 Left 1163009124 19:14413717-14413739 CCTCCCTATCACTCCCCAAGGAA 0: 1
1: 0
2: 1
3: 27
4: 177
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009125_1163009134 -6 Left 1163009125 19:14413720-14413742 CCCTATCACTCCCCAAGGAACCC 0: 1
1: 0
2: 3
3: 15
4: 213
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009118_1163009134 10 Left 1163009118 19:14413704-14413726 CCCAGAGAAGCCCCCTCCCTATC 0: 1
1: 0
2: 0
3: 24
4: 210
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009116_1163009134 28 Left 1163009116 19:14413686-14413708 CCTCCTCAGACTACTCAGCCCAG 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134
1163009119_1163009134 9 Left 1163009119 19:14413705-14413727 CCAGAGAAGCCCCCTCCCTATCA 0: 1
1: 0
2: 0
3: 30
4: 184
Right 1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG 0: 1
1: 0
2: 1
3: 22
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163009134 Original CRISPR GAACCCACTGGGCTTTCATG GGG Intronic
900588363 1:3444953-3444975 GGACCCACTGGGCTTGCAGCTGG - Intergenic
902665325 1:17933620-17933642 GAACCCACTAGGCTTTTCCGAGG + Intergenic
907697730 1:56750736-56750758 GACCTCACAGGGCTTTTATGAGG - Intronic
915361867 1:155290662-155290684 GAAGCCACGGAGCTTTCCTGGGG + Exonic
917800260 1:178563322-178563344 GCACCCACAGGGCTTTCCTTTGG + Intergenic
919597007 1:199576767-199576789 GAAGACACTGGGGTTTCATAGGG + Intergenic
920545423 1:206812536-206812558 GAACCCAGTGGGATTTTCTGGGG + Intronic
921907610 1:220511864-220511886 AAAGAGACTGGGCTTTCATGAGG + Intergenic
924705756 1:246500636-246500658 GAAGCCACATGGCTATCATGAGG + Intronic
924752711 1:246910167-246910189 GAATTAACTGTGCTTTCATGTGG - Intronic
924809253 1:247386995-247387017 GACTCCAGGGGGCTTTCATGTGG - Intergenic
1065691172 10:28335331-28335353 GAAGCCACAGGTCTTTTATGAGG + Intergenic
1067020672 10:42794270-42794292 GAAGCCACTTGGCTTTCTTTTGG + Intronic
1068040736 10:51820741-51820763 GTACGCACTGGGTTTTCATGTGG + Intronic
1072057677 10:91776476-91776498 GAACCCTCTGGGATATCCTGTGG - Intergenic
1072667769 10:97406876-97406898 GAACCCACTGGGCTGCTGTGAGG + Intronic
1073638111 10:105220189-105220211 GGAACCCCTGGGCTTTGATGTGG - Intronic
1074919692 10:117994454-117994476 GAACCCAATGGGCTACAATGTGG + Intergenic
1075196205 10:120361386-120361408 GGGCCCACTGGCCTTTCAGGAGG - Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076090891 10:127684580-127684602 GAGCCCTGTGGGCTTTCCTGTGG - Intergenic
1076525267 10:131108724-131108746 GATCCCACTGGGCTGAGATGAGG + Intronic
1080441437 11:32298549-32298571 GAGCCTACTGGGTCTTCATGGGG + Intergenic
1088221780 11:107577454-107577476 GAACCCACTGGGCAGTTATACGG + Intergenic
1096280267 12:50246605-50246627 GAACGCAATTGGTTTTCATGTGG - Intronic
1100443921 12:94643373-94643395 GAACCCACAGGCCAGTCATGAGG + Intronic
1101729972 12:107418912-107418934 GAAGCCACTGGACTTTCATGGGG - Intronic
1102705422 12:114876235-114876257 CAACCCAATGGGCTGTCCTGAGG - Intergenic
1103521966 12:121542157-121542179 GAACCCACTGCCATATCATGAGG + Intronic
1103704654 12:122864855-122864877 GCACCCACTGGGCTTTGAAATGG + Intergenic
1105465677 13:20637476-20637498 GAACCCAGAGGGCCTTCATGGGG + Intronic
1107599050 13:41993818-41993840 GAACCCACTGGACTTATATTAGG - Intergenic
1107973882 13:45670879-45670901 GCAGCCAGTGGGCTTGCATGCGG - Intergenic
1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG + Intronic
1111097408 13:83534001-83534023 GAATTCCCTGGGCTTGCATGGGG + Intergenic
1111613238 13:90632309-90632331 AAACCCAGTGGGCATTCATGGGG - Intergenic
1112756928 13:102646283-102646305 GCACTCACTGGGCTGTAATGAGG - Exonic
1117736472 14:58773545-58773567 CAACACACTGGGCTCTCCTGAGG - Intergenic
1118328842 14:64800463-64800485 GAACCCTCCAGGCTTTTATGTGG - Intronic
1118620001 14:67606330-67606352 GAACACACCTGGCTTTTATGTGG + Intergenic
1118978964 14:70700965-70700987 GAAGCCACTGGCCTTTCAACAGG + Intergenic
1122232447 14:100313511-100313533 GAACCCACTTGGCCTTCAAGGGG + Intergenic
1123186860 14:106527288-106527310 GAAATCACTGAGTTTTCATGTGG - Intergenic
1123715246 15:23024017-23024039 GAACCTACCAGGCTTTCATGTGG - Exonic
1124620694 15:31272335-31272357 GAACCCACTGGGCTGTGCGGTGG + Intergenic
1126795099 15:52254053-52254075 GCACCCATTGAGCTTTCATGTGG - Intronic
1127383050 15:58445786-58445808 GACCCCACTGGGCTGTTTTGAGG + Intronic
1127497199 15:59524376-59524398 TATCCCACTAGGCTTTCAGGGGG + Intergenic
1129135381 15:73544903-73544925 AAACCCACTGGGTTTTTATGAGG + Intronic
1129198847 15:73986696-73986718 GTGCCCACTGGGCTGGCATGTGG + Intronic
1129724741 15:77896025-77896047 GAACCCACTATGCTTTTATAAGG + Intergenic
1130272823 15:82461226-82461248 GAACCCACTGTGCTTTTATAAGG + Intergenic
1130465173 15:84188579-84188601 GAACCCACTGTGCTTTTATAAGG + Intergenic
1130487515 15:84406223-84406245 GAACCCACTGTGCTTTTATAAGG - Intergenic
1130499092 15:84484957-84484979 GAACCCACTGTGCTTTTATAAGG - Intergenic
1130587464 15:85193192-85193214 GAACCCACTGTGCTTTTATAAGG + Intergenic
1132904888 16:2277558-2277580 GGCCCCACTGGGCACTCATGGGG - Intronic
1138595896 16:58028750-58028772 GAAGCCACAGGACTTTCACGAGG + Intronic
1139585505 16:67900456-67900478 GAACCCACAAAGCTTTCCTGAGG - Intronic
1141651335 16:85394663-85394685 GAATCCCCAGGGCTTTCAGGGGG - Intergenic
1141826766 16:86486157-86486179 GAACCCACTTCCCTCTCATGGGG + Intergenic
1142122834 16:88395609-88395631 CTACCCACAGGGCTTCCATGAGG - Intergenic
1142282542 16:89156207-89156229 GAATAAACTGGGCTTTAATGGGG - Intergenic
1143724513 17:8836119-8836141 GAAGCCAGAGGGCTTCCATGGGG - Intronic
1145375879 17:22347801-22347823 TAACTCAGTGGCCTTTCATGTGG - Intergenic
1145830948 17:27915708-27915730 GAAAGCACTGGGCTTTCCCGAGG - Intergenic
1146488739 17:33264684-33264706 CAACCCACAGAGCTTTCAGGTGG - Intronic
1149505629 17:57191420-57191442 CTAGCCACTTGGCTTTCATGTGG - Intergenic
1150493270 17:65588854-65588876 GGACCCAGTGGGCTGTCAAGGGG - Intronic
1151965668 17:77430011-77430033 GAAAGCACTGTGCTTGCATGGGG - Intronic
1152057813 17:78045086-78045108 TGACCCACTGGGCATTCATTTGG + Intronic
1156753374 18:40489484-40489506 GAAGCCACTGGGGTTTCTGGAGG - Intergenic
1157679953 18:49597329-49597351 GAAACCACTGGGCATACACGGGG - Exonic
1158580976 18:58682541-58682563 GAACCCTCTGGGTTTTGCTGGGG - Intronic
1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG + Intronic
1163389257 19:17020444-17020466 TAACCCAAAGGGGTTTCATGTGG + Intronic
1167707625 19:51090907-51090929 CACCCCACAGGGCTTTCACGAGG - Intergenic
925037284 2:698070-698092 GAAACCAGTGTGCATTCATGTGG - Intergenic
926623635 2:15070991-15071013 TAACCCACTGTGCATTCTTGGGG - Intergenic
927098046 2:19763201-19763223 GAACTCACTTGGCATTAATGAGG - Intergenic
928315665 2:30243430-30243452 GAACCAACTTGGCTTTCCTGGGG + Intronic
928391152 2:30911993-30912015 GAAATCAATAGGCTTTCATGGGG + Intronic
929833010 2:45364866-45364888 CACACCACTGGGCTTCCATGTGG + Intergenic
934770292 2:96903462-96903484 GTATCCACTGGGCTTTCCTTTGG + Intronic
934910950 2:98253908-98253930 CATCCCACTTGGCTTTCCTGCGG + Intronic
935488764 2:103691673-103691695 GAACCCAGTGGAGTTTCAGGAGG - Intergenic
937363364 2:121244200-121244222 GCACGCACTGGGCCTTGATGAGG + Intronic
937701406 2:124866653-124866675 GAGCCCACTGAGATCTCATGGGG - Intronic
939688165 2:145224890-145224912 CAACTCACTGAGCTTTTATGAGG + Intergenic
941536880 2:166734369-166734391 AAACCCACTGGTCTTTGATTTGG + Intergenic
944415656 2:199477167-199477189 GAACCCCCTGGATTTTCATTTGG - Intergenic
946599307 2:221342066-221342088 AAACACACTGGGCCTACATGAGG + Intergenic
947587073 2:231362939-231362961 GACCCCACTGTGTTGTCATGTGG + Intronic
1171169744 20:23005200-23005222 GGGTCCACTGGGCTTCCATGTGG + Intergenic
1173645555 20:44631206-44631228 GTACCCTCTGGGCACTCATGGGG - Intronic
1174105189 20:48156913-48156935 TAACCCAGTGGTCTTTCATTAGG + Intergenic
1174399297 20:50267415-50267437 GACCTCACAGGGCTGTCATGAGG - Intergenic
1175247577 20:57591058-57591080 GTCCCCACCGGGCCTTCATGGGG - Intergenic
1176090180 20:63315143-63315165 GGGCCCACTGGGCTGTCTTGGGG + Intronic
1176942796 21:14944251-14944273 CAACCCACTTGGCCTTCATGTGG + Intergenic
1178895756 21:36555537-36555559 GAGCCCACGGGGCTTTGCTGGGG + Intronic
1179054005 21:37915085-37915107 GGATCCACTGGGCTTTTATTGGG + Intronic
1179080162 21:38163361-38163383 GAAAACACTGGGCTATCATGTGG + Intronic
1180136060 21:45862766-45862788 GAAGCCACTGGGCTGTGAAGAGG - Intronic
1181163897 22:20973506-20973528 GAACCCACTGGCCATTCTCGAGG - Exonic
1181308323 22:21929517-21929539 GCCCCCACTGGGCTTTAATGGGG + Intronic
1183210840 22:36450133-36450155 GAACCAACTGGGCAGCCATGGGG + Intergenic
1183975629 22:41510465-41510487 GAACCCAGTGGGCCTTCAGAGGG + Intronic
950445463 3:13034977-13034999 GGGACCACTGGGCTTCCATGGGG - Intronic
956573281 3:70721193-70721215 AAATTCACTGGGCTTTAATGAGG - Intergenic
957704796 3:83766816-83766838 GAAGCCACTGGGTTGTGATGTGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
972640281 4:40919036-40919058 GAACAGACTGGGCTTTCACCAGG + Intronic
974763739 4:66312337-66312359 GCAACCACTGTGGTTTCATGGGG + Intergenic
975831557 4:78374178-78374200 GGACACACTGGGCTTCCAAGAGG - Exonic
979226103 4:118286782-118286804 GAACCCCATGGATTTTCATGGGG - Intronic
985546207 5:510431-510453 GACCTCACTGGGCTTTACTGTGG + Intronic
987867467 5:23563960-23563982 GAACTTACTAGGTTTTCATGAGG + Intergenic
991597188 5:68317670-68317692 GAAGGCACTAGGCTTTCAGGTGG - Intergenic
992426942 5:76667587-76667609 GAACCCTGTGGGCTCTGATGAGG - Intronic
992560161 5:77944095-77944117 GAACCCACAGGCTGTTCATGAGG + Intergenic
1000861091 5:166456864-166456886 GAACCCCCTGCCCTGTCATGGGG - Intergenic
1001482338 5:172096840-172096862 GAACCCACAGGGAGGTCATGCGG + Intronic
1002988348 6:2213719-2213741 GACCCCACTGTGCTTTCTTCTGG - Intronic
1017594807 6:156016957-156016979 GAAGGCACTGGGCTTGCATGTGG + Intergenic
1019612919 7:1945977-1945999 GAACCCACTGGCCCTTCCTCTGG - Intronic
1020467359 7:8495971-8495993 GAACCCTCTGTGCCTTCAGGAGG - Intronic
1024505108 7:50156121-50156143 AAACTCACTGTGCTTTCATAAGG + Intronic
1024510412 7:50199612-50199634 GAAGCCACTGGGCATGGATGGGG + Intergenic
1024589557 7:50869299-50869321 CATCCCAATGGGCTTGCATGAGG + Intergenic
1025087069 7:56032017-56032039 GAATCCACAGGTCTTTCTTGAGG - Exonic
1026664043 7:72326699-72326721 AAACCCTCTCGGTTTTCATGAGG + Intronic
1028063506 7:86351235-86351257 GAACCCACTGGCCTTTCAGAAGG + Intergenic
1031893341 7:127320617-127320639 GGACCCACTGGGCCATCAAGAGG - Intergenic
1032402013 7:131630192-131630214 CCACCCACTCGGCTTTCCTGGGG - Intergenic
1033999014 7:147388547-147388569 GAACCCAGTGGGTTTGCATTAGG - Intronic
1036074610 8:5481920-5481942 GAACCAACTGGAATTTCATCAGG - Intergenic
1042176933 8:66046330-66046352 GATCCCACTGCGCCTTCCTGTGG + Intronic
1042195394 8:66227737-66227759 GGACCCACTGCCCTTACATGGGG + Intergenic
1042484933 8:69338422-69338444 GACCCCACTGGGCAGGCATGGGG - Intergenic
1046711283 8:117514675-117514697 GAACCCACTGTGCTGACTTGTGG + Intergenic
1050583449 9:7085200-7085222 GAGCACACTGGGCTTTGAAGGGG + Intergenic
1051374197 9:16387714-16387736 GAATACATGGGGCTTTCATGGGG + Intergenic
1055601183 9:77920567-77920589 GAAACCACTGAGATTTCTTGGGG + Intronic
1057818846 9:98315856-98315878 GCACCCACTGGCCTTACATGAGG + Intronic
1058775387 9:108278396-108278418 TTACCCACTGTGCTTTCATGTGG - Intergenic
1059382183 9:113935104-113935126 GAAGCCCCTGGGCTGGCATGGGG + Intronic
1061796885 9:133090826-133090848 GCACTCACTGGCCATTCATGAGG + Intergenic
1189358292 X:40328071-40328093 AAACCACCTGGGCTTTCCTGGGG - Intergenic
1191631388 X:63325674-63325696 GAACCCACTGAGCAATGATGGGG - Intergenic
1193590537 X:83384100-83384122 GGACTCCCTGGGCTTTCTTGGGG - Intergenic
1196043845 X:111235017-111235039 GAACTCACAGGGCTTTTAGGTGG - Intergenic
1197785091 X:130190852-130190874 CAACCCACTGGGCTTCCTGGAGG - Intergenic
1201648343 Y:16260001-16260023 GAGCCCAGTGGTGTTTCATGAGG - Intergenic
1201654467 Y:16325300-16325322 GAGCCCAGTGGTGTTTCATGAGG + Intergenic
1201920261 Y:19226349-19226371 GCTCCCACTGTGTTTTCATGTGG + Intergenic
1202370064 Y:24190124-24190146 GAACCCACTGTGCTTTTATAAGG - Intergenic
1202500720 Y:25479993-25480015 GAACCCACTGTGCTTTTATAAGG + Intergenic