ID: 1163009157

View in Genome Browser
Species Human (GRCh38)
Location 19:14413846-14413868
Sequence CCAGCTTCTCCCACTCTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163009157 Original CRISPR CCAGCTTCTCCCACTCTCTG TGG Intronic
900205914 1:1431870-1431892 CCAGCTGCTCACACCGTCTGAGG - Intergenic
900512450 1:3067079-3067101 CCAGCACCTCCCACCCACTGGGG + Intergenic
900829739 1:4957332-4957354 CCAGCTGCTCTCATGCTCTGAGG - Intergenic
900988090 1:6085012-6085034 ACAGCTGCTCCCACTCCCTCGGG + Intronic
901134697 1:6985295-6985317 CCAGCTCCTCCCATTCACAGTGG - Intronic
901465846 1:9420557-9420579 TCTGCTTCTCCCACTCCCAGGGG + Intergenic
901476331 1:9492432-9492454 CCAGTTTCCCCAGCTCTCTGAGG + Intergenic
902382413 1:16058759-16058781 CCAGCTCCTCGCCCTCTCTGGGG + Intronic
902616670 1:17627386-17627408 CCAGCGTCTCCAGCTCTGTGAGG - Exonic
902770180 1:18641294-18641316 ACGGCTTCCCCCGCTCTCTGGGG - Intronic
903043726 1:20551335-20551357 CCCACTGCTCCCACTCTCGGAGG + Intergenic
903447847 1:23433625-23433647 CCAGCTCCTCACACTCCTTGTGG + Exonic
903539640 1:24089767-24089789 CCAACTACTGCCCCTCTCTGGGG - Intronic
903547614 1:24136574-24136596 CTTGCTGCTCCCACTCTCTGGGG - Intronic
904286996 1:29459300-29459322 GCCTCTTCTCCCACTCTCAGCGG - Intergenic
904430510 1:30461209-30461231 CCAGCTTGTCCTGGTCTCTGAGG - Intergenic
904556342 1:31367286-31367308 CCAGCTTCTACAGCTCTCAGGGG + Intronic
905064871 1:35171986-35172008 CTAGCTACTCCCAAACTCTGGGG + Intergenic
905734371 1:40315693-40315715 CCAGCTTCCTGCACTGTCTGAGG - Intronic
905867488 1:41383869-41383891 GCATCCTCTCCCAATCTCTGAGG - Intergenic
906647080 1:47483005-47483027 TCTGTTCCTCCCACTCTCTGGGG - Intergenic
906654512 1:47537838-47537860 CCACCTTCTCACAGTCACTGAGG + Intergenic
907333111 1:53684211-53684233 CCAGCTCCTCCTACCCTCTCTGG + Intronic
907392521 1:54167581-54167603 CCAGCTTCTCCATCCCTCGGTGG + Intronic
908655128 1:66380486-66380508 CCTGCTCCTCCCACTCACTACGG - Intergenic
910479671 1:87644821-87644843 GAAGCTTTTCCCAGTCTCTGCGG - Intergenic
911440505 1:97920771-97920793 CCCGCGTCTCTCACTCTCCGGGG + Intronic
912529104 1:110307285-110307307 CAAGCTTCTTCCTCTCGCTGTGG + Intergenic
913692695 1:121294249-121294271 GCAGCATCTCTCATTCTCTGGGG - Intronic
914144861 1:144985841-144985863 GCAGCATCTCTCATTCTCTGGGG + Intronic
915153598 1:153855795-153855817 CCAGCTACTCCCAGTCCCAGAGG - Intronic
916868702 1:168888443-168888465 CCAGGTACTCCCACTCTTAGGGG + Intergenic
917688784 1:177446141-177446163 CCAGCTTCTGCCTCTCTCAAAGG + Intergenic
919167695 1:193916749-193916771 CCCCTTTCTCCCAGTCTCTGTGG + Intergenic
919420560 1:197365285-197365307 TGAGCTTCTCCCTGTCTCTGGGG + Intronic
919791944 1:201297357-201297379 CCAGCTGCTTCCTCTCCCTGAGG - Intronic
920032964 1:203048416-203048438 CAGCCTCCTCCCACTCTCTGTGG - Intronic
920480015 1:206312610-206312632 GCAGCATCTCTCATTCTCTGGGG - Intronic
920582794 1:207127872-207127894 CCATCTTCTCCAGCTCCCTGGGG + Intronic
921179337 1:212619351-212619373 CCAGCTTCTCCGACTCCTGGGGG - Exonic
921724257 1:218506933-218506955 ACAGCAGCACCCACTCTCTGTGG - Intergenic
922143228 1:222911360-222911382 CCAACTTCTCCCAGTCTCTTTGG - Intronic
922739007 1:228005346-228005368 CCCGCTTCTCCCAGGCACTGCGG - Intergenic
922972313 1:229753065-229753087 CCAGTTTTGCCCACTCTTTGTGG + Intergenic
923012574 1:230100041-230100063 CCAGCTTCTCACACAGTCTGTGG + Intronic
924026974 1:239843717-239843739 CCTGCTTCTTCCTCTTTCTGGGG - Intronic
1063174624 10:3540189-3540211 GCAGGTTCTCACACTCCCTGGGG + Intergenic
1063746403 10:8888461-8888483 CCACCTTCTCCCTCTCCATGCGG - Intergenic
1063952532 10:11237353-11237375 CCAGCTTCTCAAGTTCTCTGTGG + Intronic
1067220504 10:44340752-44340774 CCAGGCTCACCCACTCACTGTGG - Intergenic
1067511104 10:46895725-46895747 CCATTCACTCCCACTCTCTGGGG - Intergenic
1067651149 10:48156137-48156159 CCATTCACTCCCACTCTCTGGGG + Intergenic
1069141358 10:64830060-64830082 CCAGCCTCTCTCTCTCTCTCAGG + Intergenic
1069389363 10:67916474-67916496 CCAGCTCCTCCAGCTCTCTCTGG - Exonic
1069698301 10:70404107-70404129 CCAGCTTCCCCAACTCCCTCTGG + Intergenic
1069886386 10:71626556-71626578 GCAGCTGCACCCACTCTCTGGGG - Intronic
1069908233 10:71744666-71744688 CCAGCTTCTCCTGCTCTCACCGG - Intronic
1070350499 10:75587717-75587739 CCAGCTTCTCACAGTATCTTTGG - Intronic
1070378600 10:75858545-75858567 CCAGCCTCTCCCACTCTCAATGG - Intronic
1070607108 10:77906540-77906562 CCACCTTCTCCCACTGGCTGAGG + Intronic
1070747929 10:78946050-78946072 CCTGCTTCTCTCACTGTCTCTGG + Intergenic
1071440586 10:85688886-85688908 CCTGCTTAGCCCATTCTCTGTGG - Intronic
1072207091 10:93214395-93214417 CCAGCTTCTCCCAATCTTTGGGG + Intergenic
1072740839 10:97908165-97908187 CTTGCTTCTGCCACTCACTGTGG - Intronic
1073340858 10:102743684-102743706 GCTGCTTCCGCCACTCTCTGCGG + Intergenic
1074209853 10:111320589-111320611 CCAGCTTGCCTAACTCTCTGAGG + Intergenic
1074418070 10:113284707-113284729 CCAGCTTCTTCACCCCTCTGAGG - Intergenic
1074695271 10:116044917-116044939 TCAGCTTCTCTCTCTCTCTTTGG + Intergenic
1075612970 10:123868188-123868210 CCAGCAGCTCCCACTCCCTTAGG + Intronic
1075682488 10:124342611-124342633 CCAGAGTCACCCACTCTCTAGGG + Intergenic
1075718457 10:124570655-124570677 CCAGCCTCTTTCAATCTCTGTGG + Intronic
1075797032 10:125128034-125128056 CCAGCTCTTCCAAGTCTCTGGGG - Intronic
1076289621 10:129334977-129334999 CCATCTTCTCCCAGTAACTGTGG + Intergenic
1076370678 10:129951138-129951160 CCAGCTTCTCCTGCTTTCTTCGG + Intronic
1077080153 11:721472-721494 CCAGCTCCTCCCATCATCTGTGG + Intronic
1078553851 11:12301801-12301823 CCACTGTCTCCCAGTCTCTGTGG - Intronic
1079106237 11:17574155-17574177 CCAGAGTCTCCTACACTCTGTGG - Intronic
1080389939 11:31835703-31835725 CCCCCTTCTCCCCCTCTCTCTGG + Intronic
1080495636 11:32815758-32815780 CCATCTTCTCCCATTTTCTAAGG + Intergenic
1081640891 11:44753475-44753497 CCAGCTTGACTCACCCTCTGTGG + Intronic
1082108520 11:48245837-48245859 CCTGCGTCTTCAACTCTCTGAGG + Exonic
1082251736 11:49989923-49989945 CAAGATTCTCCCACTCTGTTTGG + Intergenic
1083560748 11:63671304-63671326 GCAGCTGCTGCCACTCGCTGAGG + Exonic
1083952895 11:65966587-65966609 CAAGATTCTCCCTCCCTCTGGGG + Intronic
1084188683 11:67489038-67489060 CCAGCTTCTGCCACATTCTCTGG - Intronic
1084477510 11:69397219-69397241 CCTGCAGCTCCCACTCTCGGGGG + Intergenic
1085000597 11:73029955-73029977 TCAGATTCTCCCTCTTTCTGAGG - Intronic
1085213853 11:74809791-74809813 CCAGCTTCTCTGGCTTTCTGTGG + Intronic
1085325188 11:75601195-75601217 TCACCTTCTCGCACTCTCTTAGG + Intronic
1085400042 11:76230460-76230482 CCAGCCTCCCCTGCTCTCTGGGG + Intergenic
1086406721 11:86505044-86505066 CCAACTTCTCCCAGTGACTGTGG + Intronic
1086612775 11:88777547-88777569 CCAGTTTCTCCCCATCTTTGTGG + Intronic
1087221010 11:95546264-95546286 CAAGTTTATCCCATTCTCTGGGG + Intergenic
1088259375 11:107929217-107929239 CCAGCGGCTCCCACGCTGTGTGG + Intronic
1088442718 11:109889296-109889318 CCAAATTCTCCCATACTCTGAGG - Intergenic
1088882945 11:113986085-113986107 CCAGCAACTCCCACTCTCCCTGG - Exonic
1089439806 11:118505808-118505830 GCAGTTCCTCCCACACTCTGTGG - Exonic
1090404622 11:126469334-126469356 CCAGCTTCTCTTCCTCTCTGCGG + Intronic
1091296978 11:134480777-134480799 CCAGTGTCTCCCACTCCCTGAGG - Intergenic
1091320153 11:134643591-134643613 CCCTCTTCTCCAACCCTCTGTGG - Intergenic
1092059997 12:5540979-5541001 ATATTTTCTCCCACTCTCTGGGG + Intronic
1092658533 12:10714095-10714117 CCAGCACCTGCCACTCTGTGAGG - Intronic
1092997432 12:13963351-13963373 CCAGCTTCTGCAATTCTCCGCGG + Intronic
1093504585 12:19850335-19850357 TCAGCTTCTCCCTCACTCTGTGG - Intergenic
1094664433 12:32504581-32504603 CCAACTTTTCCAACTGTCTGAGG + Intronic
1096478343 12:51922332-51922354 CCAGCCCCTCGCCCTCTCTGTGG + Intronic
1096561337 12:52437921-52437943 CAGACTTCTCCTACTCTCTGTGG + Intergenic
1097478072 12:60083910-60083932 TCAGCTTCTCCCTCTCTGAGGGG + Intergenic
1098008971 12:66030272-66030294 CAAGCTTCTCAAACTATCTGTGG - Intergenic
1098640519 12:72833419-72833441 CCAACATCTCCCAGTGTCTGTGG + Intergenic
1099249099 12:80230310-80230332 GCAGCTTCTCCCCTTGTCTGAGG + Intronic
1099428917 12:82557307-82557329 CCACCTTCTCTCATTCTCAGTGG - Intergenic
1099883427 12:88497742-88497764 CCAGCTTCTCCACCTGTCTTAGG - Intronic
1100351717 12:93790036-93790058 CAAGCCTCTCCTACCCTCTGGGG + Intronic
1102139648 12:110604230-110604252 CAGTCTTCTCCCACTCTTTGTGG - Intergenic
1102819583 12:115896259-115896281 CCAGCCTGGCCCACTCCCTGGGG + Intergenic
1102930620 12:116859393-116859415 CCAGCTCCCCCCATTTTCTGGGG - Exonic
1104025814 12:125025325-125025347 CCAGCTTCTCCTCCACGCTGGGG - Exonic
1104899788 12:132182611-132182633 TCTCCTTCTCTCACTCTCTGTGG + Intergenic
1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG + Exonic
1105389105 13:19958877-19958899 CCAGCCACCCCCACTCTCGGCGG - Intronic
1106154837 13:27144761-27144783 CCAGCTCCTCCCGATTTCTGGGG - Intronic
1107743101 13:43474930-43474952 CCTCCTTCTCCCTTTCTCTGTGG - Intronic
1108594176 13:51935990-51936012 CCCGCTCCTCCCACTCCTTGTGG - Intronic
1109438740 13:62341764-62341786 CCACCTTCTGCCAGTGTCTGTGG + Intergenic
1111424336 13:88059325-88059347 CCCCCTTCTCACACTATCTGAGG + Intergenic
1111916736 13:94368719-94368741 ACAGCTTCTCTCACTCCCTCGGG - Intronic
1111996310 13:95169097-95169119 CTCGCCTCTCCCACTTTCTGGGG - Intronic
1112235710 13:97634473-97634495 CCAGCTTCCCACACCCACTGTGG - Intergenic
1112457600 13:99576395-99576417 CCAGCAGCTCCCAGTCTATGAGG - Intergenic
1113563513 13:111303035-111303057 CCAGCTTCTCCAGGTCTTTGCGG - Intronic
1116855192 14:49945938-49945960 CAACCTTCTCCCAGTCACTGTGG + Intergenic
1117783688 14:59260146-59260168 CCAGCTTTTCAAACTATCTGTGG - Intronic
1118741400 14:68742052-68742074 CACCCTTCACCCACTCTCTGTGG - Intergenic
1119377042 14:74203354-74203376 CCACCCTTTGCCACTCTCTGGGG - Intergenic
1119529047 14:75346634-75346656 CCATCTAATCTCACTCTCTGAGG - Intergenic
1121310328 14:92932294-92932316 CCAGTCTCTGCCACTCCCTGGGG - Intronic
1121904034 14:97723444-97723466 CTAGCTTCTAACCCTCTCTGTGG - Intergenic
1122049694 14:99047666-99047688 CTAGCTTCTCTCGCACTCTGAGG - Intergenic
1122519431 14:102333048-102333070 CCACCTTCTCCCACTTCCTGTGG + Intronic
1122690003 14:103527796-103527818 CCATGGCCTCCCACTCTCTGTGG - Intergenic
1202870006 14_GL000225v1_random:153942-153964 CCTGCCTCTCATACTCTCTGTGG - Intergenic
1202881859 14_KI270722v1_random:67825-67847 CCAGCACCTGCCACTGTCTGCGG - Intergenic
1123442254 15:20301163-20301185 TCTGCTTCTCCTACTCCCTGAGG + Intergenic
1124048858 15:26176738-26176760 CCATCTTCTCCCGATTTCTGGGG + Intergenic
1125603552 15:40928090-40928112 CCGGCTTCTCCCAGTCTCAGGGG - Intergenic
1125957318 15:43799436-43799458 CCAGCTGCTGCCACTCTAGGTGG - Exonic
1128422414 15:67506227-67506249 CCCCCGTCTCCCAGTCTCTGTGG - Intergenic
1128808994 15:70556248-70556270 CCCGCTGCTCCCACTCTCTCAGG + Intergenic
1129206447 15:74039846-74039868 CCAGCCTCTCCCCTCCTCTGCGG - Intronic
1129241934 15:74257056-74257078 CCAGCAGCTCCCAGTCCCTGAGG - Intronic
1129296119 15:74601059-74601081 GCAGCAGCTCCCACTCCCTGAGG + Intronic
1130550770 15:84888806-84888828 CCAGCTGCTCCTGATCTCTGCGG - Exonic
1131511680 15:93052555-93052577 CCAGCTTCTGCTACCATCTGTGG + Intronic
1132387097 15:101408414-101408436 CTAGCCTCACCCATTCTCTGCGG + Intronic
1132882715 16:2169583-2169605 CCAGAGTCTCCCACCCTCTTGGG - Intronic
1133235126 16:4384151-4384173 CCAGCTTGTCCTGCTCACTGGGG - Intronic
1133641029 16:7717575-7717597 CCATCTTCACACACTCTTTGGGG - Intergenic
1135937040 16:26789988-26790010 GTACCTTCTCTCACTCTCTGTGG + Intergenic
1136139935 16:28281971-28281993 TCAGCTTCTTCCACCCTCAGAGG - Intergenic
1136946213 16:34654416-34654438 CCAGCTTCTGCAACTGTCAGCGG + Intergenic
1137481237 16:48853371-48853393 CCAGCTTATCCCTCTGTGTGGGG - Intergenic
1138186203 16:54979488-54979510 CCCGCTCCTCCCCCTCCCTGTGG - Intergenic
1138232176 16:55346316-55346338 CCAGTCTTACCCACTCTCTGAGG - Intergenic
1138582243 16:57949198-57949220 CCAGCTTCTCGCAGCCTCTTTGG + Intronic
1139348897 16:66323005-66323027 CCACCTTCTCTCTCCCTCTGGGG + Intergenic
1139517028 16:67458242-67458264 CCAGCTTCCTGCTCTCTCTGAGG + Intronic
1139922528 16:70469032-70469054 CCAGCCACTTCCCCTCTCTGGGG + Intronic
1141747601 16:85936250-85936272 TCTGCTTCTCCCCCTCTGTGAGG + Intergenic
1141802792 16:86322579-86322601 GCAGCTTCTACCAGTCTCAGCGG + Intergenic
1141921979 16:87141854-87141876 CAAGCTTTTCCCCTTCTCTGAGG - Intronic
1141986953 16:87586229-87586251 TCAGCCTCTCTCGCTCTCTGTGG - Intergenic
1142055047 16:87988760-87988782 GCAGCTTCTCGCACTCTCTCCGG - Intronic
1142106278 16:88304596-88304618 CCAGCTGCTTCTGCTCTCTGTGG + Intergenic
1142780939 17:2180661-2180683 ACAGCATCTTCCCCTCTCTGAGG - Intronic
1142864449 17:2782172-2782194 CCTGTTTCTCCCTCTGTCTGAGG + Intronic
1143631133 17:8140941-8140963 CCAGCTTCTCCCACCATAGGGGG - Exonic
1143720809 17:8807781-8807803 CCATCTTCTCCCATTCTCCAGGG - Intronic
1143804392 17:9414290-9414312 ACTGCTTCTCAAACTCTCTGTGG + Intronic
1143915451 17:10289119-10289141 ACAGCTTCTCAAACTCTCTGTGG + Intergenic
1145763106 17:27438846-27438868 GCAGCTCCTCTCAGTCTCTGAGG + Intergenic
1147760674 17:42795699-42795721 CCAACATCCCCCACTCTCTCTGG + Exonic
1148147912 17:45377579-45377601 CCAGCCACTCCCCCTCACTGGGG + Intergenic
1148383651 17:47219346-47219368 CCAGCTTATCCTGCACTCTGAGG + Intronic
1148757392 17:49980772-49980794 CCTGATGCTCCCACTCTCTTTGG + Intergenic
1148787961 17:50154950-50154972 ACAGCTTCTCCAAATCTTTGGGG + Intergenic
1148867822 17:50638224-50638246 CCAGGTGCTCCCAACCTCTGTGG - Intronic
1150346442 17:64408034-64408056 CCAGCTTATCTGACTCTTTGAGG + Intronic
1150467119 17:65403162-65403184 CCCCCTTCTCCCCCTCCCTGGGG - Intergenic
1151500458 17:74484906-74484928 CCACCTTCTCCCACTCAGTGAGG - Intergenic
1151518730 17:74613783-74613805 CCTGATTCTCATACTCTCTGAGG - Intronic
1151985214 17:77538384-77538406 CCAGCTGCTCTGAATCTCTGTGG - Intergenic
1152213753 17:79020150-79020172 GCAGCTTCTCCGAAGCTCTGTGG + Intergenic
1154325932 18:13390405-13390427 CCAGATTGTCCCACGCTGTGTGG + Intronic
1154428722 18:14291996-14292018 CCAACAGCTCACACTCTCTGTGG - Intergenic
1154433674 18:14327652-14327674 CCAGCAGCTCACACCCTCTGTGG - Intergenic
1155475796 18:26235073-26235095 AGAGCTATTCCCACTCTCTGTGG + Intronic
1157457163 18:47842728-47842750 CCAGCTTTTAACACTCTCTGTGG - Intronic
1157476056 18:48024312-48024334 CCAACTTCACCCATTCTCAGAGG + Intergenic
1159306557 18:66650722-66650744 CCATCTTCTCCCAGTTTCTGTGG - Intergenic
1159317984 18:66804688-66804710 CCAGCTTCTACCACTTTGTATGG + Intergenic
1159353805 18:67309849-67309871 CAATGTTCTCCCTCTCTCTGTGG + Intergenic
1160588691 18:79927670-79927692 TCAGCCTGTCCCACTCACTGGGG - Intronic
1160690704 19:459730-459752 CCAGCTCCTCCCGGCCTCTGCGG - Intronic
1161403015 19:4077249-4077271 CCAGTCTCTACCTCTCTCTGTGG + Intergenic
1162523701 19:11195921-11195943 CCTGCTTCTCCATCTCTCTTTGG - Intronic
1163009157 19:14413846-14413868 CCAGCTTCTCCCACTCTCTGTGG + Intronic
1163270901 19:16252741-16252763 TCAGCCTCTTCCACTCTCTCTGG - Intergenic
1163364761 19:16869735-16869757 CCGGCTTCTTCCGCTCACTGGGG - Exonic
1163755562 19:19104492-19104514 CCTGCCTCTCCCACCCCCTGTGG - Intronic
1163831746 19:19550423-19550445 GCAGCACCTCCCACTCTCTCGGG + Intergenic
1163938604 19:20473208-20473230 CCAGCCCCTCCCCCTCTCTCGGG - Intergenic
1163948839 19:20565594-20565616 CCAGCCTATCCCCCTCTCTCGGG + Intronic
1164042461 19:21505797-21505819 CCAGCCCCTCCCCCTCTCTGGGG - Intronic
1164199217 19:23002983-23003005 CCAGCGGCTGCCACTCTCTCGGG + Intronic
1164226440 19:23250195-23250217 CCAGCCCCTCCCTCTCTCTCCGG + Intronic
1164605411 19:29594408-29594430 CCAGCTGGACCCACTGTCTGTGG + Intergenic
1165345628 19:35247700-35247722 TCACCTCCTCCCACTCTCTCTGG - Intergenic
1165422382 19:35728661-35728683 CCCGCTACTCCCTCTCTATGTGG - Intronic
1165559740 19:36668504-36668526 CCAGCTTCTTCCCTTCTCAGGGG - Intergenic
1165862665 19:38917450-38917472 CCTGCTGCTCCCCCTCTCTCTGG - Intronic
1166655686 19:44609945-44609967 CCTCCATCTCCCAGTCTCTGCGG - Intergenic
1166915259 19:46191038-46191060 CCTGCTTCTCCCCCACTTTGAGG - Intergenic
1168519289 19:57035736-57035758 CCAGCTTCCCCCACATCCTGGGG - Intergenic
1202657467 1_KI270708v1_random:36924-36946 CCAGCACCTGCCACTGTCTGCGG - Intergenic
925345928 2:3171782-3171804 CAAGCTCCTCCTGCTCTCTGAGG + Intergenic
925642509 2:5999440-5999462 TCAACTTCTCCCCCTCTATGTGG - Intergenic
925695111 2:6568306-6568328 GCCGCGTCTCCCAGTCTCTGTGG + Intergenic
926901255 2:17753906-17753928 CCAGCTTCCCCCACCCGCTAAGG - Exonic
927719268 2:25372626-25372648 CCAGCTCTTCCCACTCCCGGAGG - Intergenic
929031175 2:37651226-37651248 CCATCTACTTCCCCTCTCTGTGG - Intronic
929155054 2:38781613-38781635 TCAGCTTCTCCCTCACTCTATGG - Exonic
929160529 2:38827787-38827809 CCACCTTCCCCCACTATCTGGGG + Intronic
929458911 2:42086767-42086789 CCATCTTCTCCCACTGCCTCGGG + Intergenic
930334720 2:50030381-50030403 CCCCCATCTCCCAGTCTCTGTGG + Intronic
931528460 2:63185846-63185868 CCAGCTTCACACACTCTCTCAGG - Intronic
932574113 2:72953480-72953502 CCTGCTTCTCCCACTCTTCCAGG - Intronic
933212439 2:79586189-79586211 CCGGCTTCTCCTCTTCTCTGTGG + Intronic
934544081 2:95200070-95200092 CCTGCCTCTCACACTATCTGAGG + Intergenic
934566781 2:95345941-95345963 CGGGCGTCTCCCCCTCTCTGCGG + Intronic
935089869 2:99884876-99884898 CCAGCCTCTCCCTCTACCTGGGG + Intronic
936155823 2:110046963-110046985 CCTTCTCCTCCAACTCTCTGTGG + Intergenic
936188865 2:110324465-110324487 CCTTCTCCTCCAACTCTCTGTGG - Intergenic
937309220 2:120891860-120891882 CCAGCTTCTCACAATCTCCCAGG - Intronic
937911706 2:127078761-127078783 CCAGCTCAGCCCACTTTCTGGGG - Intronic
938232747 2:129675619-129675641 CCAGCCTCTCTCTCTCCCTGAGG + Intergenic
938422423 2:131155525-131155547 CCCGCTACTTCCGCTCTCTGCGG + Intronic
938615803 2:132997036-132997058 CCAGCTTCTCCCTCTTACTAAGG + Intronic
940117690 2:150227258-150227280 CCAGCTGCGACCACTCCCTGTGG + Intergenic
942131542 2:172885165-172885187 CCAGCTTCTGCATCCCTCTGTGG + Intronic
942401990 2:175612667-175612689 CCAGCTGCTCCCTCTATCTGTGG - Intergenic
942547496 2:177080034-177080056 CCTGCTTCACCCCCTCTGTGGGG - Intergenic
944840630 2:203620598-203620620 CCAGATTCCCCCACCCCCTGGGG + Intergenic
945101468 2:206266337-206266359 CCTCCGTCTCCAACTCTCTGTGG - Intergenic
945169173 2:206978204-206978226 CCAGCCTCTTCCCCACTCTGAGG - Intergenic
945818854 2:214638500-214638522 CCAACTCCCCCCACTCCCTGGGG + Intergenic
946678391 2:222187098-222187120 CCAGTTTCTGCCATTCTCTCTGG + Intergenic
947377477 2:229511211-229511233 CCAGCTTCTGCCACTGGGTGGGG - Intronic
947632151 2:231661051-231661073 CCAGTTTCTCACGGTCTCTGGGG - Intergenic
948268758 2:236657737-236657759 CAAGCTTCTTCCACTCTCTGTGG + Intergenic
948341386 2:237255352-237255374 CCAGCTTCCCCCACTCCATCTGG - Intergenic
948384084 2:237570953-237570975 CCAGCTTCTCCCAGGATCTGGGG + Intergenic
948602136 2:239113305-239113327 GCAGCTCCTCCCACTGTCTCAGG - Intronic
948632913 2:239313387-239313409 CCAGATCCTCACACTCTTTGGGG - Intronic
948769045 2:240238588-240238610 CCATCTTCTCCCACTCACTTGGG + Intergenic
948964103 2:241362968-241362990 CTTGCCTCTCCCACTGTCTGTGG + Intronic
1168805167 20:668449-668471 CCAGCTCATCCCTATCTCTGTGG - Intronic
1168847745 20:956991-957013 CCAGCCTCTCCCACATTCTCTGG - Intergenic
1169549505 20:6687774-6687796 CCAGCCTCTCTGCCTCTCTGCGG - Intergenic
1169555645 20:6746441-6746463 CCAGCTTGTCTCACCCTCTGAGG - Intergenic
1169705289 20:8496472-8496494 CCTGCATCTCCCTCTCTCTCTGG - Intronic
1170004501 20:11651181-11651203 CCAGGTGCACCCAGTCTCTGAGG - Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1171324100 20:24275695-24275717 GCAGCATCTGCCCCTCTCTGTGG - Intergenic
1173150399 20:40562147-40562169 CTCGCTTCCCTCACTCTCTGGGG + Intergenic
1173919293 20:46731755-46731777 CGAGTTTCTCTCTCTCTCTGTGG - Intronic
1174107441 20:48172570-48172592 CCAGCTCCTCCCTCCCTCTCTGG - Intergenic
1174713965 20:52737025-52737047 CCAGCTTCTCCCTTTCTTGGCGG - Intergenic
1175755757 20:61528663-61528685 TCCTCTTCTCCCCCTCTCTGGGG - Intronic
1176065840 20:63194148-63194170 CCACCACCTCCCACTCTGTGGGG + Intergenic
1177415746 21:20791448-20791470 CCACCTTCTCCCAGCTTCTGTGG + Intergenic
1178056721 21:28807459-28807481 TCAGCTTCTCCCTCTGTCTGTGG - Intergenic
1178099917 21:29256612-29256634 CCATCTGCTCCCATTGTCTGTGG + Intronic
1178181696 21:30169094-30169116 ACACCTTCTCCCTCTCTCTGAGG + Intergenic
1178953757 21:37006171-37006193 CCGGCTTCTCCGTCCCTCTGTGG - Intronic
1179537701 21:42062998-42063020 CCTGCCTCTCCCAGGCTCTGGGG + Intronic
1180070685 21:45434623-45434645 TCAGCCTCTGCCACCCTCTGAGG - Intronic
1180672794 22:17566251-17566273 CCTGCTTCTAACACTCTCAGTGG + Intronic
1180710394 22:17835649-17835671 ACAACTTCTCCCTCCCTCTGGGG + Intronic
1181456957 22:23065221-23065243 CCTTCTTCCCCCACTCCCTGAGG + Intronic
1181556596 22:23674999-23675021 CCCCCTGCTCCCACTGTCTGGGG - Intergenic
1182465171 22:30511153-30511175 CCAACTTTTCCCAGTTTCTGAGG + Intergenic
1183864416 22:40692908-40692930 CCAGCTCTTCCCAATGTCTGTGG - Intergenic
1183947666 22:41335905-41335927 CCAGCATCTCACACCCACTGTGG - Intronic
1183971818 22:41483089-41483111 CCACTTTCCCCCACTTTCTGGGG - Intronic
1184113390 22:42408542-42408564 CCAGGTTCTCCCAGGCTCAGGGG - Intronic
1184417687 22:44361757-44361779 CCACCTTCTCCCAGTGTCTTTGG - Intergenic
1184830629 22:46984026-46984048 TCAGCCCCTCCCTCTCTCTGGGG + Intronic
1184984378 22:48119430-48119452 CCACCTTCCTCCACTGTCTGGGG + Intergenic
1185177023 22:49333732-49333754 TCAGCCTCTCCCATTCCCTGGGG + Intergenic
1185276103 22:49950786-49950808 GCAGCTTCTCCCAGGCCCTGTGG + Intergenic
949312573 3:2716523-2716545 ACATTTTCTCCCATTCTCTGTGG + Intronic
949655259 3:6210479-6210501 GCTGCTTCCCCCAATCTCTGTGG + Intergenic
950402535 3:12780912-12780934 CCTCTGTCTCCCACTCTCTGAGG - Intergenic
951439301 3:22704815-22704837 CTTTCTTCTCCTACTCTCTGCGG + Intergenic
954088533 3:48266354-48266376 CCAACTGCTCCAACTCTCTCAGG + Intronic
954116600 3:48470057-48470079 CCCGCTTGTCCCACCCTCAGAGG + Intronic
954137093 3:48586932-48586954 CCAGATTCTACCTCTCCCTGAGG - Intronic
954436730 3:50500257-50500279 CCAGCGTCTCCCTTCCTCTGAGG - Intronic
954671907 3:52295605-52295627 CTATCCTCTGCCACTCTCTGGGG + Intergenic
954836405 3:53473050-53473072 CCAGTTTCTCCCCATCTTTGTGG + Intergenic
955732157 3:61998293-61998315 CCAGATTCTCCCTATGTCTGGGG - Intronic
955873165 3:63461332-63461354 CCAGCTCCTCCTACTCCCTCTGG + Intronic
956710210 3:72032555-72032577 CCACCTTCACCCAATCTCTCTGG + Intergenic
956733528 3:72218091-72218113 TCAGCTTCTCCCATTCTCTGTGG - Intergenic
956741078 3:72276652-72276674 CCAGTTTCTCCCCATCTTTGTGG - Intergenic
959573965 3:107913786-107913808 TCAAATCCTCCCACTCTCTGTGG - Intergenic
959905856 3:111710599-111710621 ACAGCTTCTCATGCTCTCTGAGG + Intronic
960457899 3:117896045-117896067 CCAGGTTATCCCACTATCTGAGG + Intergenic
961066714 3:123882761-123882783 CCTTTTTCTCCCACTCTCAGTGG - Intronic
962201054 3:133401506-133401528 CCTGCTTTTCCCACTCTCCAGGG + Intronic
962321608 3:134395276-134395298 CCAGTTTCTTCACCTCTCTGAGG - Intergenic
964809758 3:160651209-160651231 CCATCATCTCCCACTCTCTCAGG + Intergenic
965200902 3:165656177-165656199 CCAGTTTCTCCCCATCTTTGTGG - Intergenic
966336916 3:178878703-178878725 AAATTTTCTCCCACTCTCTGAGG + Intergenic
968441108 4:625031-625053 CCACCTTCCCCCACACTCTGAGG - Intergenic
968725942 4:2247852-2247874 GCAGCCTCTCCCACTCTGCGAGG + Exonic
968807691 4:2786453-2786475 CCAGCTTCACCCCCTGTCAGAGG + Intergenic
969409436 4:7018438-7018460 CCAGCTCCACCCACTCTCTGAGG + Intronic
972896984 4:43634523-43634545 ATAGTTTCTCCAACTCTCTGGGG + Intergenic
975443212 4:74436222-74436244 TCAGCCTCTCCCACATTCTGAGG - Intergenic
977665859 4:99646603-99646625 CCTGGTTCTCTCATTCTCTGGGG + Intronic
977799315 4:101206950-101206972 CCAGCTTCCCCCACACCATGTGG - Intronic
978807690 4:112817991-112818013 CCAGCCTCTTCCACACTCTTGGG - Intergenic
979933357 4:126660830-126660852 CCAGTTTTTCCCACTCACTCAGG - Intergenic
981250881 4:142599016-142599038 TCAGGCTCTCTCACTCTCTGTGG - Intronic
981649854 4:147044653-147044675 TCAGCTTCTCTCAGTCTCTGTGG + Intergenic
981729721 4:147884792-147884814 GCCTCTTCTCCCACTCTCTCTGG - Intronic
982177241 4:152717574-152717596 ACAGCTTCCCCCACCCTCAGTGG + Intronic
982924794 4:161321800-161321822 CCTGCTGCTCCCACTCTGTGAGG + Intergenic
983452115 4:167923816-167923838 CCACCTTCTCCACCTTTCTGGGG + Intergenic
985632840 5:1022730-1022752 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632886 5:1022896-1022918 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632907 5:1022978-1023000 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632919 5:1023019-1023041 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632931 5:1023060-1023082 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632941 5:1023101-1023123 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632963 5:1023183-1023205 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985632997 5:1023306-1023328 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633031 5:1023429-1023451 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633071 5:1023593-1023615 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633081 5:1023634-1023656 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633091 5:1023675-1023697 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633102 5:1023716-1023738 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633112 5:1023757-1023779 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633146 5:1023880-1023902 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633156 5:1023921-1023943 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633190 5:1024044-1024066 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633212 5:1024126-1024148 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633222 5:1024167-1024189 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633232 5:1024208-1024230 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633242 5:1024249-1024271 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633264 5:1024331-1024353 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633286 5:1024413-1024435 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633308 5:1024495-1024517 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633330 5:1024577-1024599 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633364 5:1024700-1024722 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633374 5:1024741-1024763 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633396 5:1024823-1024845 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633416 5:1024905-1024927 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633424 5:1024946-1024968 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633444 5:1025028-1025050 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633478 5:1025151-1025173 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633486 5:1025192-1025214 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633566 5:1025520-1025542 CCTGCTCTTCCCACTCTCTGTGG + Intronic
985633576 5:1025561-1025583 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633586 5:1025602-1025624 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633598 5:1025643-1025665 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633608 5:1025684-1025706 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633630 5:1025766-1025788 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633665 5:1025890-1025912 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633697 5:1026014-1026036 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633719 5:1026096-1026118 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633744 5:1026178-1026200 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633785 5:1026343-1026365 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633808 5:1026425-1026447 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985633838 5:1026548-1026570 CCTGCTCTTCCCACCCTCTGTGG + Intronic
985669941 5:1201977-1201999 CCAGCTCCCCCCACACCCTGCGG - Intronic
986137112 5:4990661-4990683 CCAGCTGCTCCCACACACAGTGG - Intergenic
988787679 5:34579568-34579590 CCACCATCTCCTACTCTCTCTGG + Intergenic
990980928 5:61602077-61602099 CCAGCTCCTGCAACTCTTTGAGG + Intergenic
993322166 5:86485150-86485172 TCAGCTTCTCTCACACTCAGAGG - Intergenic
994439451 5:99783988-99784010 CCTGCTTCTTCCAGTTTCTGGGG - Intergenic
995297825 5:110540575-110540597 CCAACTTCTCCCAGATTCTGAGG + Intronic
995695860 5:114877254-114877276 CTGGCTTCTCCCCATCTCTGTGG - Intergenic
996726684 5:126678773-126678795 CCAGCTTCTCACACACTATTGGG + Intergenic
996819391 5:127609285-127609307 CCATCTCCTCCCTATCTCTGTGG - Intergenic
998393653 5:141804276-141804298 GCAGCTTCTCCCTCTCTCTCAGG + Intergenic
998934308 5:147217372-147217394 CTGGCTTCTCCCCATCTCTGTGG - Intergenic
999674188 5:153982516-153982538 TCTGCTTCTCCCACCCTTTGCGG - Intergenic
1000168492 5:158678520-158678542 CTCTCTTCTCCCAGTCTCTGAGG + Intergenic
1000999662 5:167993939-167993961 TCAGCATCTGCCACTTTCTGTGG - Intronic
1001932014 5:175679916-175679938 CCAGGTTCTGCCACTTTCTAGGG + Intronic
1002643465 5:180641399-180641421 CCTACTTCTCCCTCTCCCTGGGG + Intronic
1003000614 6:2328934-2328956 GCTGCTTCTCCCACTCTTTGTGG + Intergenic
1003442719 6:6158663-6158685 CCAGCCTCCTGCACTCTCTGTGG - Intronic
1003534769 6:6967148-6967170 CCAGCTTCTCCCCATCTTAGAGG + Intergenic
1006031173 6:31177717-31177739 CCAGCTTCTCCCAAGCTCTTGGG + Intronic
1006681095 6:35797246-35797268 CCTGCTTGTCGCCCTCTCTGTGG - Exonic
1007548588 6:42711809-42711831 CCAGCTTCTCCCTCAGACTGGGG + Intronic
1007774296 6:44216274-44216296 CCAGTTACTCCCACTTACTGAGG + Intergenic
1008730524 6:54476575-54476597 CCAGACTCTCCCATACTCTGAGG - Intergenic
1010747348 6:79578678-79578700 CTGGCTTCTCCCCATCTCTGTGG - Intergenic
1011789004 6:90877910-90877932 CAAGCATTTCCCTCTCTCTGTGG + Intergenic
1013906055 6:115221300-115221322 CCCCTTTCTCCCTCTCTCTGTGG - Intergenic
1014212651 6:118722551-118722573 TCAGATTCTCTCTCTCTCTGTGG + Intergenic
1016699839 6:147041756-147041778 ACAGCATCCCCCACTCTCTTGGG + Intergenic
1017629591 6:156383461-156383483 CCAGCCCCACCCACTTTCTGTGG - Intergenic
1018053448 6:160031508-160031530 CCACCTTCTTCCTGTCTCTGTGG + Intronic
1018843175 6:167533221-167533243 CAAGCTTATCCCACTTTCCGTGG + Intergenic
1019463281 7:1172680-1172702 CCAGCCCCTCCCACTCACTCAGG + Intergenic
1020057433 7:5127683-5127705 CCAGCTGCTGCCACTCTTTCCGG + Intergenic
1020170317 7:5839987-5840009 CCAGCTGCTGCCACTCTTTCCGG - Intergenic
1021280145 7:18707117-18707139 CCAGTTCCTCCCTCTCTTTGTGG - Intronic
1022096767 7:27146029-27146051 CCAGCCTCTCCCACTATGTCTGG + Intronic
1022114565 7:27250743-27250765 TCAGCTCCTCCCAAGCTCTGCGG + Intergenic
1022334060 7:29406244-29406266 CCAGCTTCTCCTCCTCTCCCTGG - Intronic
1022491630 7:30824964-30824986 CCAGCTCATGCCTCTCTCTGGGG + Intronic
1022501895 7:30887130-30887152 TCAGCTACCCCCACTCCCTGCGG + Intronic
1022807484 7:33837362-33837384 CCATCCTCACCCACTGTCTGAGG - Intergenic
1023920924 7:44629322-44629344 CCAGCTCCTTCCACTCCCTCAGG - Intronic
1024854183 7:53757836-53757858 CCAGATTTTCCCACTCCATGTGG - Intergenic
1025776204 7:64562882-64562904 CCAGCCCCTCCCCCTCTCTCGGG + Intronic
1025777859 7:64574871-64574893 CCAGCCCCTCCCCCTCTCTCGGG - Intergenic
1025788509 7:64666308-64666330 CCAGCCCCTCCCCCTCTCTCGGG - Intronic
1026338003 7:69411300-69411322 CCAGCATTTCCCACACTTTGTGG + Intergenic
1027197288 7:76039420-76039442 CCAGCTTGACACATTCTCTGTGG + Intronic
1029804860 7:102985497-102985519 CCATCTACTCCCCCTTTCTGGGG - Intronic
1034061109 7:148091055-148091077 CCACCACCTCCCAGTCTCTGTGG - Intronic
1035261356 7:157663534-157663556 GCTGCCTCTCCCACTCACTGTGG + Intronic
1035744185 8:1949978-1950000 CCAGCTTCTCCCAGCCTCCAGGG + Intronic
1036122340 8:6032126-6032148 CCTGCCTCTCCCACTGTCTCTGG - Intergenic
1036503024 8:9330738-9330760 CCAGCAGCTCCCCGTCTCTGCGG + Intergenic
1036730162 8:11255918-11255940 CCCGCTTCCCTCACTCTCTAAGG - Intergenic
1037508924 8:19562004-19562026 CCACCTTCTCCTACTCCCTCTGG + Intronic
1037608791 8:20459174-20459196 CCCCCTTCTCCCACCATCTGCGG - Intergenic
1037914769 8:22766303-22766325 CCAGCTTCTTCCACTTTGTTTGG - Intronic
1039279759 8:35971543-35971565 CTATCTTCTCCCAGTCTGTGGGG + Intergenic
1039341410 8:36654179-36654201 CCAGCCTCTTCTACTTTCTGTGG + Intergenic
1039396206 8:37227425-37227447 CCCACCTCTCCCTCTCTCTGTGG + Intergenic
1039498085 8:37996492-37996514 CCAGCACTTCCCACGCTCTGGGG + Intergenic
1041615153 8:59898320-59898342 CCAGCTTCTAGTACTCTCTCTGG + Intergenic
1041775797 8:61521633-61521655 CCAGCATCTGCAACTCACTGTGG + Intronic
1043014748 8:74923848-74923870 ACAGCTTCACCCAATCACTGTGG - Intergenic
1043928964 8:86069175-86069197 CCACTGTCTCCCAGTCTCTGTGG - Intronic
1044625677 8:94233677-94233699 CCTGCTTCCACCCCTCTCTGCGG + Intergenic
1046382964 8:113474417-113474439 CCAGCTTCTCCCATGTTCTGAGG - Intergenic
1046682480 8:117185524-117185546 GCAGCCTCTCCCACTCTGAGTGG - Intergenic
1047466908 8:125125627-125125649 ACACCCTCTCCCACTCTCTAGGG - Intronic
1048913985 8:139164790-139164812 CCAGTTTCTCCCCATCTTTGTGG + Intergenic
1051117776 9:13716787-13716809 CCGGCTTCTCCCACTTTGTCTGG + Intergenic
1052140910 9:24981915-24981937 CCACCTTTTCCCACTTCCTGGGG + Intergenic
1052914974 9:33918035-33918057 CCCGCTTGCCCCACTCCCTGGGG - Exonic
1053312214 9:37027100-37027122 TCTGCTTCTCCGAGTCTCTGGGG + Intronic
1053410802 9:37914958-37914980 CCAGCATCTCCCCATCTTTGGGG + Intronic
1056840889 9:89997299-89997321 CCAGCTGCTCCCCCCCTCTCTGG + Intergenic
1058525093 9:105849789-105849811 GCAGCTTGACCCACTCGCTGGGG - Intergenic
1058651488 9:107179230-107179252 CCTGCTTGTCTCCCTCTCTGGGG - Intergenic
1060148069 9:121268674-121268696 CCAGCTGCTTCCTCTTTCTGGGG + Intronic
1060157429 9:121329347-121329369 CTAGTTTCTCCCACTCCCTCTGG - Intronic
1060839251 9:126781339-126781361 CCTGGTCCTCCCACTCCCTGAGG - Intergenic
1061362658 9:130153633-130153655 CCAGCTTCTCCCGCTCCTCGTGG - Intergenic
1061912367 9:133732000-133732022 CCAGCTTCTCCCTGTCCCAGTGG - Intronic
1062076393 9:134592297-134592319 CCAGCCTCGGCCTCTCTCTGCGG + Intergenic
1062245884 9:135565839-135565861 TCAGCCTCGCCCACTGTCTGCGG + Intronic
1062474211 9:136719442-136719464 CCAGCCTCTGCGCCTCTCTGAGG - Intronic
1062503444 9:136861106-136861128 CCAGCTGGGCCCACTGTCTGTGG + Intronic
1203734449 Un_GL000216v2:122601-122623 CCTGCCTCTCATACTCTCTGTGG + Intergenic
1186871505 X:13778386-13778408 TCTGCTTGTCCCACCCTCTGGGG - Intronic
1186982647 X:14974107-14974129 CTAGTTTCTCCCCATCTCTGTGG + Intergenic
1187100118 X:16183491-16183513 CCCGCTTCTCCGCCTTTCTGGGG - Intergenic
1187946633 X:24432473-24432495 CCTTCTTCTCCCATTCCCTGAGG - Intergenic
1189074082 X:37897645-37897667 CCAACATCTCCCAGTCTCTGGGG - Intronic
1189629256 X:42934260-42934282 ACAGCTTCACCCACCCTCTCTGG - Intergenic
1190760936 X:53437724-53437746 CCAGCCCCTCCCACTTTCTTGGG + Intergenic
1192242832 X:69348397-69348419 CTAGCTTCTACCACTCTTTGTGG - Intergenic
1192494476 X:71605923-71605945 CCTTCTTTCCCCACTCTCTGAGG + Intronic
1193049071 X:77082256-77082278 CCAGTTTGTCCCACTCTGGGAGG - Intergenic
1193324060 X:80158506-80158528 CAAACTGCTCCCACTTTCTGAGG - Intergenic
1193333976 X:80265700-80265722 CCAGCCTCTTTCACTCTCTAGGG + Intergenic
1194738149 X:97539193-97539215 CCAGTCCATCCCACTCTCTGTGG + Intronic
1195967850 X:110445235-110445257 CCAGCTTCGCTCCCTCTCAGCGG + Exonic
1196820155 X:119694728-119694750 GGAGCTTCTCACACTCTCTCGGG + Intergenic
1198529087 X:137532022-137532044 AAAGCTTCTCCCTCTCTGTGTGG + Intergenic
1200169931 X:154065151-154065173 CTACCTTTTCCCAGTCTCTGAGG + Intronic
1201252105 Y:12069538-12069560 CCTGCCTCTCCCAGTTTCTGGGG - Intergenic
1201944787 Y:19500020-19500042 CCACCTTCACCCCTTCTCTGAGG - Intergenic
1202048043 Y:20753770-20753792 CTGGTTTCTTCCACTCTCTGCGG - Intergenic
1202626584 Y:56865998-56866020 CCTGCCTCTCGTACTCTCTGTGG - Intergenic