ID: 1163012188

View in Genome Browser
Species Human (GRCh38)
Location 19:14433291-14433313
Sequence GGTCACGTGACCCCGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163012188_1163012206 16 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012206 19:14433330-14433352 GGGGCCGGAGGGCGCGGCGCGGG 0: 1
1: 0
2: 13
3: 138
4: 969
1163012188_1163012196 -3 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012196 19:14433311-14433333 ACCAGGCCCGGCGGCCGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 234
1163012188_1163012202 5 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012202 19:14433319-14433341 CGGCGGCCGCTGGGGCCGGAGGG 0: 1
1: 0
2: 4
3: 41
4: 359
1163012188_1163012198 1 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012198 19:14433315-14433337 GGCCCGGCGGCCGCTGGGGCCGG 0: 1
1: 1
2: 4
3: 74
4: 619
1163012188_1163012209 23 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012209 19:14433337-14433359 GAGGGCGCGGCGCGGGGACGCGG 0: 1
1: 0
2: 12
3: 106
4: 688
1163012188_1163012195 -4 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012195 19:14433310-14433332 GACCAGGCCCGGCGGCCGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 131
1163012188_1163012203 10 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012203 19:14433324-14433346 GCCGCTGGGGCCGGAGGGCGCGG 0: 1
1: 1
2: 1
3: 54
4: 561
1163012188_1163012210 26 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012210 19:14433340-14433362 GGCGCGGCGCGGGGACGCGGCGG 0: 1
1: 2
2: 13
3: 111
4: 836
1163012188_1163012194 -5 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012194 19:14433309-14433331 TGACCAGGCCCGGCGGCCGCTGG 0: 1
1: 0
2: 1
3: 10
4: 164
1163012188_1163012201 4 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012201 19:14433318-14433340 CCGGCGGCCGCTGGGGCCGGAGG 0: 1
1: 0
2: 4
3: 46
4: 482
1163012188_1163012205 15 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012205 19:14433329-14433351 TGGGGCCGGAGGGCGCGGCGCGG 0: 1
1: 0
2: 7
3: 76
4: 638
1163012188_1163012207 17 Left 1163012188 19:14433291-14433313 CCGACCTCCGGGGTCACGTGACC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163012207 19:14433331-14433353 GGGCCGGAGGGCGCGGCGCGGGG 0: 1
1: 0
2: 8
3: 130
4: 866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163012188 Original CRISPR GGTCACGTGACCCCGGAGGT CGG (reversed) Intronic
900358023 1:2274051-2274073 TGTCACCTGACCCCGGGGCTGGG - Intronic
901747485 1:11383979-11384001 GGTCACATGACTCCAGACGTGGG - Intergenic
903692297 1:25183213-25183235 GGTCACGTGAGGCCAGAGATGGG - Intergenic
903731126 1:25496232-25496254 GGTCACGTGAGCCCAGAAGGCGG - Intronic
907014766 1:51001636-51001658 GATCCCGTGAGCCCGGAAGTTGG - Intergenic
908127816 1:61048626-61048648 GGTCACTTGAGCCCAGAGGCTGG - Intronic
911160566 1:94678983-94679005 GGGCAGGTGACCCTGGAGTTTGG - Intergenic
915378651 1:155421013-155421035 GATCACTTGAGCCCAGAGGTTGG + Intronic
919705446 1:200670516-200670538 GGACACGTGGCTCCAGAGGTTGG - Intergenic
921209439 1:212880468-212880490 GGTCAAGTGACACCCAAGGTAGG - Intronic
921710819 1:218371212-218371234 GGTCACTTGATCCCGGGAGTTGG + Intronic
922306255 1:224347635-224347657 GATCACTTGAGCCCAGAGGTTGG - Intergenic
923164581 1:231347583-231347605 GGTCACTTGAGCCCAGGGGTTGG - Intronic
924223711 1:241903559-241903581 GGTCACTTGAGCCCGGAAGGTGG + Intergenic
1065025107 10:21534123-21534145 GGGGACGGGGCCCCGGAGGTAGG + Intergenic
1065739258 10:28782213-28782235 GATCACTTGAGCCCGGAAGTTGG - Intergenic
1066370635 10:34815521-34815543 GGTCCCGCGCCCCCGGAGGGAGG - Intergenic
1070113575 10:73507902-73507924 GGTCACGTGAACCTGGAAGGTGG + Intronic
1072267482 10:93744505-93744527 TGTCAGGTGACCACGGTGGTGGG - Intergenic
1073033173 10:100544353-100544375 GGTCACTTGAGCCCAGAAGTTGG + Intronic
1077707383 11:4499953-4499975 GATCACTTGAGCCCGGGGGTTGG - Intergenic
1083913656 11:65726049-65726071 GGTAACGTGACGCCGTGGGTGGG + Intergenic
1084107080 11:66987285-66987307 GGTCATGTGAGCACAGAGGTTGG + Intergenic
1086668942 11:89523108-89523130 AATCACTTGAACCCGGAGGTGGG - Intergenic
1091833296 12:3565950-3565972 GGTCATGAGGCCCCGGAGGCAGG + Intronic
1096690929 12:53321337-53321359 GGCCACCTGGCCCCGGAAGTCGG + Exonic
1097280892 12:57845206-57845228 GGCCACCTGGCCCCGGAGGCTGG - Intronic
1100402837 12:94247131-94247153 GGTTACGTGAGCCCGGGAGTTGG - Intronic
1104950089 12:132436027-132436049 GGACACGTGACCTCGCTGGTGGG + Intergenic
1105389466 13:19960281-19960303 GCTCACGTTACCCGGGAGGAGGG + Intronic
1106089672 13:26579084-26579106 GCTCACCTGAGCCCGGAGTTTGG - Intronic
1116891414 14:50272401-50272423 GGTCATGTGACCCAGGTGGCAGG - Intronic
1121472239 14:94164897-94164919 GGTCCCGTGGCCCTGGATGTGGG - Intronic
1122463811 14:101917104-101917126 GGTAAGGTCACCCCGGAGGGTGG - Intronic
1125492717 15:40160206-40160228 GATCACTTGACCCCGGGAGTTGG + Intergenic
1126414352 15:48402567-48402589 GTTCACTTGAGCCTGGAGGTTGG + Intergenic
1128617027 15:69118184-69118206 GGGCACGTCACCCAGGAGGGGGG + Intergenic
1129854438 15:78813290-78813312 GGTCACTTGAGCCCCGAGTTTGG + Intronic
1130296055 15:82647700-82647722 GGTCACGTGCCCGCGGGCGTGGG - Intronic
1132729104 16:1351905-1351927 GGTCACGTGACCACGGGGACCGG - Exonic
1138598115 16:58040212-58040234 GGGCAGGTGGCCCCGGAGCTGGG + Intronic
1140096819 16:71883322-71883344 GTTCACCTGACCCCTGGGGTTGG + Intronic
1145056806 17:19708285-19708307 GGTCAGGTGAGCCCGGGGGCTGG - Exonic
1145867718 17:28251394-28251416 GGTCACGTGACCCCACGGCTGGG + Intergenic
1148397770 17:47323927-47323949 GGTCAGGTGACCGCGGGGGCGGG + Intronic
1149855425 17:60078691-60078713 AGTGGCGTGGCCCCGGAGGTAGG - Exonic
1151275426 17:73030501-73030523 GGTCATGTACCCCGGGAGGTAGG - Intronic
1152317851 17:79591191-79591213 AGTCACGTGGTCCCGGGGGTCGG + Intergenic
1160539392 18:79612175-79612197 AGTCACGTGCCTCTGGAGGTTGG - Intergenic
1161852257 19:6743721-6743743 GGCCATGTGACTCCGAAGGTGGG - Exonic
1163012188 19:14433291-14433313 GGTCACGTGACCCCGGAGGTCGG - Intronic
1163106485 19:15125706-15125728 TGTCACGTGACCCGGGAGCGTGG + Exonic
1163669133 19:18617399-18617421 GGCCACGGAACCCGGGAGGTGGG - Intronic
1166191349 19:41178947-41178969 GGTCACATGACCCGGGAAGGTGG + Intergenic
1168218926 19:54946574-54946596 GATCACCTGAGCCAGGAGGTGGG - Intronic
932213211 2:69948710-69948732 GGTCCGGTGGCCCCGGAGGCAGG - Intergenic
933996572 2:87674450-87674472 GGGCACGTGAGCCGGGAGGTGGG - Intergenic
936041496 2:109153557-109153579 GGTCACCTGCCCCAGGAGGTGGG + Intronic
936297280 2:111276460-111276482 GGGCACGTGAGCTGGGAGGTGGG + Intergenic
941987300 2:171522323-171522345 GGCCGCGTGATCCCGGGGGTGGG + Intronic
1172364444 20:34338181-34338203 GATCACGTGACCCCGGGAGGTGG + Intergenic
1174483828 20:50849109-50849131 GGGCACGTGAGCCAGGAGGAGGG - Intronic
1175117635 20:56694340-56694362 GGTCACATGACCCTTGGGGTGGG + Intergenic
1178914427 21:36698843-36698865 GGTCGCCGGACCCCGGAGCTAGG - Intergenic
1179401507 21:41088495-41088517 AGTCACTTGAACCCGGAGGGCGG + Intergenic
1180884978 22:19236044-19236066 GATCACCTGAGCCCAGAGGTCGG - Intronic
1182061930 22:27404635-27404657 GCTCACGTGACCCCCAGGGTAGG + Intergenic
1182183711 22:28378559-28378581 GATCACCTGACCCCAGAGGTTGG + Intronic
960604039 3:119486689-119486711 GGTGACGTGACAGCGGAGGAGGG - Intronic
967045871 3:185736213-185736235 GGTCACGGGGACTCGGAGGTGGG + Intronic
968673192 4:1863395-1863417 GGCCACGTGACCACGGAGCCAGG + Intergenic
970272419 4:14361257-14361279 TGTCACGTGACCAGGGAAGTTGG - Intergenic
982291661 4:153788632-153788654 GGTCTCGTGGCCCAGCAGGTTGG + Exonic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
983567891 4:169174147-169174169 GATCACTTCAGCCCGGAGGTCGG - Intronic
988518148 5:31922763-31922785 AGTCACTTGAGCCCGGAGGGGGG - Intronic
988877408 5:35462253-35462275 GATCACTTGATCCAGGAGGTTGG + Intergenic
992998137 5:82352537-82352559 GTTCACTTGACCCCAGAGTTGGG - Intronic
995088188 5:108140265-108140287 GGTCACTTGACCCCAGGAGTTGG - Intronic
1005480909 6:26254363-26254385 AATGACGTGACCCCGGAGTTGGG + Intergenic
1011044395 6:83065914-83065936 AGGCGCGTGACCCCGGAGGCCGG + Intergenic
1011252874 6:85391799-85391821 GGTCACTTGATCCCAGGGGTTGG - Intergenic
1020114752 7:5470290-5470312 GGTCACGGGGCCCCTGAGGGTGG - Intronic
1020389202 7:7640749-7640771 GGTGACTTGACCCCGGAAGTGGG + Exonic
1024063590 7:45715982-45716004 GGCCACATGACCCCACAGGTAGG + Exonic
1025118005 7:56274987-56275009 GATCACTTGACCCCAGGGGTTGG + Intergenic
1029224791 7:99017737-99017759 GATCACTTGACCCCAGAAGTTGG + Intergenic
1034646874 7:152655620-152655642 GATCACCTGAGCCCGGGGGTTGG + Intronic
1035544116 8:466309-466331 GCTCAGGAGACCCCGGAGGCAGG - Intronic
1036770359 8:11574850-11574872 GATGACGTGACCCCTGGGGTTGG + Intergenic
1040650357 8:49442489-49442511 GGTCACGTGAACCTGTTGGTAGG - Intergenic
1041233362 8:55775026-55775048 GATCACTTGAGCCCGGAAGTTGG + Intronic
1043034193 8:75176874-75176896 GATCACTTGAGCCCGGAGGTTGG + Intergenic
1045483047 8:102608389-102608411 GATCACTTGAGCCCAGAGGTTGG + Intergenic
1049994110 9:1018360-1018382 GGGCACGTGACCCCGGCCGTGGG + Intergenic
1050162893 9:2736324-2736346 GATCACTTGAGCCCGGAAGTTGG - Intronic
1056592517 9:87974772-87974794 AGTCACGTGACGCCGGGGGCGGG - Intergenic
1061156495 9:128865137-128865159 GATCACTTGAGCCTGGAGGTTGG + Intronic
1061986444 9:134132847-134132869 GGGCACTTGGCCCAGGAGGTTGG - Intergenic
1062041750 9:134407604-134407626 GGTCACGTGACCCAGGAGAGGGG - Intronic
1062290457 9:135792055-135792077 GGCCACGTGAGCCAGGGGGTCGG - Exonic
1186973362 X:14873385-14873407 GGTCGCGTGACACCGGAAGGCGG - Intergenic
1189592182 X:42525151-42525173 GATCACTTGAGCCAGGAGGTGGG + Intergenic
1196385773 X:115147963-115147985 GATCACGTGAGCCCAGAGGATGG + Intronic
1198089211 X:133311349-133311371 AGTCACGAGACCCCGGCAGTGGG + Exonic