ID: 1163012574

View in Genome Browser
Species Human (GRCh38)
Location 19:14434633-14434655
Sequence CTGGTGTTGCCGATCACACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 75}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163012571_1163012574 0 Left 1163012571 19:14434610-14434632 CCTTGCCGAGGAGCTGGGCGTAT 0: 1
1: 0
2: 0
3: 11
4: 198
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012563_1163012574 24 Left 1163012563 19:14434586-14434608 CCAGTCCTGCTGATGGCCTGCCG 0: 1
1: 0
2: 3
3: 17
4: 133
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012567_1163012574 8 Left 1163012567 19:14434602-14434624 CCTGCCGGCCTTGCCGAGGAGCT 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012570_1163012574 4 Left 1163012570 19:14434606-14434628 CCGGCCTTGCCGAGGAGCTGGGC 0: 1
1: 0
2: 1
3: 25
4: 261
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012573_1163012574 -5 Left 1163012573 19:14434615-14434637 CCGAGGAGCTGGGCGTATCTGGT 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012562_1163012574 25 Left 1163012562 19:14434585-14434607 CCCAGTCCTGCTGATGGCCTGCC 0: 1
1: 0
2: 2
3: 15
4: 238
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012565_1163012574 19 Left 1163012565 19:14434591-14434613 CCTGCTGATGGCCTGCCGGCCTT 0: 1
1: 0
2: 7
3: 20
4: 157
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75
1163012561_1163012574 29 Left 1163012561 19:14434581-14434603 CCTTCCCAGTCCTGCTGATGGCC 0: 1
1: 0
2: 2
3: 25
4: 298
Right 1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG 0: 1
1: 0
2: 1
3: 9
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163012574 Original CRISPR CTGGTGTTGCCGATCACACA AGG Intronic
901325265 1:8361535-8361557 CTGGTGGTGCAGAGCAGACAGGG - Intronic
903605241 1:24570746-24570768 CTGGTGATGCAGACCACACATGG + Intronic
904391787 1:30190841-30190863 CTGGGTTTGATGATCACACATGG - Intergenic
908693593 1:66811054-66811076 CTGCTGTTGCACATCACTCATGG + Intergenic
910809126 1:91218307-91218329 CTGTTGTTTCCCATCACCCATGG + Intergenic
915163417 1:153934842-153934864 CTGCTGTTGCCGTTCTCTCAAGG + Exonic
919780748 1:201219176-201219198 CTAGTGTTGCCCATCAGGCAGGG + Intronic
921776912 1:219111984-219112006 GTGGTCTTGCCCATCAGACAGGG + Intergenic
922009508 1:221567785-221567807 CTAGTGATGGCGATCACAAATGG - Intergenic
1063940561 10:11124151-11124173 CTGGTGCTGCCCTTGACACATGG + Intronic
1064798288 10:19039086-19039108 CTGCTGTTGATGAGCACACAGGG - Intergenic
1068110279 10:52672183-52672205 CTGATGTTGCCTATAATACAAGG + Intergenic
1070548569 10:77473065-77473087 CTGGTGCTGCCCTTCACACGAGG + Intronic
1071191682 10:83108755-83108777 GTGGTCTTGCCTATCAGACAGGG + Intergenic
1071816906 10:89241381-89241403 CTGGTGGTGCCGAACAGACATGG - Intronic
1072214368 10:93275658-93275680 CTGTTGATGCCAATCACATAGGG + Intergenic
1074720292 10:116258025-116258047 ATGGTGTTGCCGGTCAGAGAAGG - Intronic
1081652682 11:44834937-44834959 CTGCTCTTGCTGATCCCACAGGG + Intronic
1087177683 11:95110203-95110225 CTGGTGTTGGCAATTACTCAGGG - Intronic
1088806594 11:113358538-113358560 GTGGTCTTGCCCATCAAACAGGG - Intronic
1089393934 11:118122553-118122575 CTGGAGTTGGCAATCACACCAGG + Intergenic
1092061359 12:5553548-5553570 CTGGTGGTGTGGATCACACTAGG + Intronic
1111118733 13:83817391-83817413 CTGGGTTTGCTGATCAGACAAGG + Intergenic
1113354128 13:109561889-109561911 CTGGTGTTGCCAGTTACACTGGG - Intergenic
1118438380 14:65791452-65791474 CTGCTGCTGCCGAGCCCACATGG - Intergenic
1118538207 14:66792094-66792116 CTGGCGCTGCCCATGACACATGG + Intronic
1127903753 15:63360777-63360799 CTGGTGTTGTGGAACACAGAGGG - Intronic
1130983044 15:88826026-88826048 CCTGTGTTGCTGATCACAGAGGG - Intronic
1135166431 16:20143093-20143115 CTTGTGGAGCCTATCACACATGG + Intergenic
1146485398 17:33238609-33238631 CTGTTGTTGCTGAACACACCGGG + Intronic
1152401806 17:80070965-80070987 CTGGTCTTGAGGGTCACACACGG - Intronic
1156896943 18:42256845-42256867 GTGGTCTTGCCCATCAGACAGGG - Intergenic
1163012574 19:14434633-14434655 CTGGTGTTGCCGATCACACAAGG + Intronic
931757528 2:65387319-65387341 CTAGTGATGCCCACCACACAAGG + Intronic
936679695 2:114756309-114756331 CTGATGTTGCAGATCCCCCAGGG - Intronic
939568060 2:143808129-143808151 CTGCTGTTGCCGGTGACATAGGG - Intergenic
945043063 2:205758614-205758636 CTGTTGTTGCCAATGATACAGGG - Intronic
1170544747 20:17426130-17426152 CTGGTCTTGCCCTTGACACATGG - Intronic
1170561244 20:17560405-17560427 CTGGTGCAGCAGATCACACCAGG - Intronic
1176235075 20:64050149-64050171 CTGGTGCTGACGGTTACACATGG - Intronic
1176363267 21:6016505-6016527 CTGGTGATGCCGACCTCACGGGG - Intergenic
1179760251 21:43522040-43522062 CTGGTGATGCCGACCTCACGGGG + Intergenic
1180244694 21:46539187-46539209 CAGGTGATGCTGGTCACACAGGG + Intronic
949954884 3:9259436-9259458 CTGGTGTTTCAGGTCACACCTGG - Intronic
953258660 3:41315665-41315687 CTGGTGTAGCCAAGAACACAGGG + Intronic
953678712 3:45023700-45023722 CTGGTCTTTCCCATGACACATGG + Intronic
960088752 3:113617465-113617487 CTAGTATTGCCTGTCACACAGGG + Intronic
972270158 4:37502930-37502952 GTGGTCTTGCCCATCAGACAGGG - Intronic
980282817 4:130742464-130742486 CTGGTCTTGCCCTTGACACATGG - Intergenic
984865661 4:184278116-184278138 CTGGTGCTGCCCTTGACACATGG - Intergenic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
996948072 5:129094366-129094388 CCGGTGCTGCAGCTCACACAAGG - Intergenic
998497676 5:142604896-142604918 CTTGTGTTCAAGATCACACATGG + Intronic
1001283558 5:170405908-170405930 TTGGTGTTGCCAATCACACAAGG - Intronic
1001611153 5:173003154-173003176 CTGCTGCTGTCAATCACACAAGG - Intronic
1004218647 6:13725697-13725719 CTGGTATTTCAGATCACCCACGG - Intergenic
1025107614 7:56185196-56185218 CTGGTGTTGCCCTTGACCCATGG - Intergenic
1026310642 7:69180959-69180981 CTGGTCTTGCCCTTGACACATGG + Intergenic
1027475741 7:78629230-78629252 CTGATGTTGCCTGTCACAGAAGG - Intronic
1033226374 7:139566359-139566381 CTAATATTGCCGATCTCACAGGG + Exonic
1035200777 7:157264002-157264024 CTGGTGTGGGAGATCACTCAAGG - Intronic
1036178901 8:6566616-6566638 ATGGCCTTGCCGATCACACATGG - Intronic
1036178908 8:6566662-6566684 ATGGCCTTGCCAATCACACAGGG - Intronic
1036178916 8:6566708-6566730 ATGGCCTTGCCGATCACACACGG - Intronic
1036178921 8:6566754-6566776 ATGGTCATGCCAATCACACATGG - Intronic
1036178926 8:6566800-6566822 ATGGCCTTGCGGATCACACACGG - Intronic
1036178933 8:6566850-6566872 ATGGCCTTGCTGATCACACATGG - Intronic
1036178940 8:6566896-6566918 ATGGCCTTGCCGATCACACATGG - Intronic
1036178947 8:6566942-6566964 ATGGCCTTGCCGATCACACACGG - Intronic
1036178960 8:6567034-6567056 ATGGCCTTGCCGATCACACATGG - Intronic
1036178967 8:6567080-6567102 ATGGCCTTGCCGATCACACACGG - Intronic
1036178974 8:6567126-6567148 ATGGCCTTGCCGATCACACACGG - Intronic
1036178989 8:6567218-6567240 ATGGCCTTACCGATCACACACGG - Intronic
1036179005 8:6567355-6567377 ATGGCCTTGCCGATCAAACATGG - Intronic
1039381328 8:37088190-37088212 CTGGTCTTGCCTTTGACACATGG + Intergenic
1044835504 8:96291843-96291865 CTGGTGCTGCGTATCACACTAGG + Intronic
1048834740 8:138508425-138508447 TTGGTGTGGCCGATTACTCAGGG - Intergenic
1051508249 9:17848538-17848560 CTGGTCTTGCCCTTCACTCATGG + Intergenic
1051521941 9:17999297-17999319 CTGGTGAAGCCTATCACAGAAGG + Intergenic
1052666319 9:31499625-31499647 CCGGTGTAGCCGCTCACTCAGGG + Intergenic
1052765049 9:32632649-32632671 CTGGGGTGGCAGATCCCACAGGG - Exonic
1060022729 9:120146255-120146277 CTGGTGATGCTGAGCACTCATGG + Intergenic
1191137603 X:57082742-57082764 GTGGTCTTGCCCATCAAACAAGG + Intergenic
1195548331 X:106138537-106138559 GTGGTCTTGCCCATCAAACAAGG + Intergenic
1197378823 X:125713685-125713707 GTGGTCTTGCCCATCAGACAGGG + Intergenic