ID: 1163014036

View in Genome Browser
Species Human (GRCh38)
Location 19:14442923-14442945
Sequence CATCCGGATGTGCCAACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163014034_1163014036 0 Left 1163014034 19:14442900-14442922 CCAGAGACTCATGCAGACACATG 0: 1
1: 0
2: 2
3: 14
4: 217
Right 1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1163014029_1163014036 30 Left 1163014029 19:14442870-14442892 CCAGGGTCCCCTCAAGCATCACA 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1163014033_1163014036 7 Left 1163014033 19:14442893-14442915 CCACTCTCCAGAGACTCATGCAG 0: 1
1: 0
2: 0
3: 20
4: 207
Right 1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1163014031_1163014036 22 Left 1163014031 19:14442878-14442900 CCCTCAAGCATCACACCACTCTC 0: 1
1: 0
2: 0
3: 16
4: 384
Right 1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1163014030_1163014036 23 Left 1163014030 19:14442877-14442899 CCCCTCAAGCATCACACCACTCT 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG 0: 1
1: 0
2: 0
3: 3
4: 55
1163014032_1163014036 21 Left 1163014032 19:14442879-14442901 CCTCAAGCATCACACCACTCTCC 0: 1
1: 0
2: 0
3: 19
4: 298
Right 1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163014036 Original CRISPR CATCCGGATGTGCCAACACC CGG Intronic
901140227 1:7024308-7024330 CACCCTGATGTGCCCACACATGG - Intronic
902821725 1:18947562-18947584 CATCCTGCAGTGCCACCACCGGG + Intronic
904771118 1:32881984-32882006 CTTCCTGATCTCCCAACACCAGG + Intergenic
906573215 1:46862497-46862519 CACCCGCATGTGCCAACTGCAGG + Intergenic
920388255 1:205582803-205582825 CATAGGGAGGTGCCAACACAGGG + Intronic
1067223788 10:44362668-44362690 CTTCCAGATGTGCCAGCACAGGG - Intergenic
1067691056 10:48502606-48502628 CACCAGCATGTGCAAACACCTGG - Intronic
1084480965 11:69419908-69419930 CATCCGGCTGTGACAACCTCAGG + Intergenic
1095985006 12:47993652-47993674 CATCCTGATGGGCCAACAGCAGG - Intronic
1126678734 15:51184142-51184164 CAGCTGGATGTGCCAACGTCGGG - Intergenic
1127299274 15:57636916-57636938 AATCCAGCTCTGCCAACACCTGG - Intronic
1130050458 15:80479804-80479826 CATCAGGATCAGCCAACAGCAGG - Intronic
1132203871 15:99973311-99973333 CAGCCTGATGTGCCAGGACCAGG - Exonic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1135339549 16:21634313-21634335 CAACCGGATGATCCAACAACAGG - Intronic
1136578963 16:31140636-31140658 CATCCGGCTGCCCCAGCACCTGG - Exonic
1137273923 16:46920936-46920958 CATCCAGATCTGAGAACACCGGG - Intronic
1139937527 16:70582262-70582284 CATCCAGATGTGACAACAGAGGG - Intronic
1144573833 17:16416730-16416752 GATCCGGCTCTGCCAACAACTGG + Intronic
1148087180 17:45001245-45001267 CAGCTGGGAGTGCCAACACCTGG + Intergenic
1151178017 17:72305129-72305151 CACCAGGAGGTGCCCACACCAGG + Intergenic
1151219612 17:72602865-72602887 CACCCAGAAGTGCCAGCACCAGG + Intergenic
1160113417 18:76055258-76055280 AATCCGCATGTGCCCACACTTGG - Intergenic
1161202774 19:3025156-3025178 CCTTCGGCTTTGCCAACACCTGG - Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1163014036 19:14442923-14442945 CATCCGGATGTGCCAACACCCGG + Intronic
933992056 2:87640855-87640877 CATCCTGAAATGCCACCACCTGG - Intergenic
935758810 2:106299662-106299684 CATCCGGATGTGACAAGGTCTGG + Intergenic
936301787 2:111309963-111309985 CATCCTGAAATGCCACCACCTGG + Intergenic
936936811 2:117846821-117846843 CATCATAATGTGCCAACAGCCGG + Intergenic
941003357 2:160223229-160223251 CAGCCTGATGTGCAACCACCTGG - Intronic
942208108 2:173643298-173643320 AGTCTGGATGTGCCAACAGCAGG + Intergenic
1168840289 20:905722-905744 CATTCAGATGTGCCGAGACCTGG + Intronic
1169512445 20:6278686-6278708 CATCAGAATATGCCAACACAGGG - Intergenic
1172178172 20:32985098-32985120 CATCCAGATGTTCCCACTCCAGG - Exonic
1175368747 20:58472402-58472424 CACCCGGATGTGGCAAAGCCAGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1181471866 22:23145596-23145618 CCTCGGGATGTGCCAGCACGGGG - Intronic
1181980615 22:26763405-26763427 CTGCCCGAGGTGCCAACACCTGG - Intergenic
960439859 3:117673669-117673691 CTTCCCCATGTGCCAACAGCAGG + Intergenic
962954100 3:140248289-140248311 CATGAGGAAGTGCCACCACCAGG + Intronic
973657299 4:53061953-53061975 CATCTGGATGTGATAACATCAGG - Intronic
974081206 4:57215166-57215188 CACCCGTATATGGCAACACCAGG + Intergenic
987545149 5:19304172-19304194 CAACCGGATGATCCAACAACAGG - Intergenic
990256019 5:53970294-53970316 CTTCCGGTTGTGCCAACTCCAGG + Intronic
1002518289 5:179775104-179775126 TATCCTGCTGTCCCAACACCAGG - Exonic
1005892666 6:30153092-30153114 CACCCAGAAGTGGCAACACCAGG + Exonic
1007597648 6:43061344-43061366 CATCCCGCTGCCCCAACACCAGG - Exonic
1010593770 6:77740246-77740268 CATCCTCATGTGCCACCACATGG - Intronic
1023576185 7:41629869-41629891 CATCTGCTTGTGCCAACACATGG + Intergenic
1035263386 7:157675410-157675432 CGCCCGGGTGAGCCAACACCCGG - Intronic
1038430702 8:27497227-27497249 CAACCGGATGATCCAACAACAGG - Intronic
1038819199 8:30936786-30936808 CATGGGGATGTGGCAACTCCAGG + Intergenic
1048960729 8:139574629-139574651 CATAGGGAGGTGCCATCACCAGG - Intergenic
1052657416 9:31380509-31380531 CATGCAGACCTGCCAACACCTGG + Intergenic
1055314870 9:75024086-75024108 CATCAGGGTGAGCCCACACCAGG + Intronic
1060228214 9:121808992-121809014 CATCTGGTTGTGCCCACACCAGG + Intergenic
1194048395 X:89036866-89036888 CTTCTGCAAGTGCCAACACCTGG - Intergenic
1198146694 X:133864454-133864476 CATCATGATATGCCAACAGCTGG - Intronic