ID: 1163015146

View in Genome Browser
Species Human (GRCh38)
Location 19:14450370-14450392
Sequence CTTCCGAGTGGAGCACGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163015140_1163015146 24 Left 1163015140 19:14450323-14450345 CCTGACCTGGGGGCTGTGGAGCT 0: 1
1: 0
2: 3
3: 41
4: 315
Right 1163015146 19:14450370-14450392 CTTCCGAGTGGAGCACGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 37
1163015141_1163015146 19 Left 1163015141 19:14450328-14450350 CCTGGGGGCTGTGGAGCTGCGCA 0: 1
1: 0
2: 3
3: 29
4: 216
Right 1163015146 19:14450370-14450392 CTTCCGAGTGGAGCACGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163015146 Original CRISPR CTTCCGAGTGGAGCACGCGG TGG Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
907442589 1:54488351-54488373 CGCCCGAGCGGAGCGCGCGGTGG + Intergenic
915362486 1:155294606-155294628 CTTCGGGGTGGAGCATGGGGTGG - Exonic
921362264 1:214341054-214341076 CTTCCCACTGGAGGACACGGTGG + Intergenic
922526733 1:226309524-226309546 GTTCCGAGTGGAGAACGGGAGGG + Exonic
1066697821 10:38094468-38094490 CGTCCGGGTAGAGGACGCGGAGG + Exonic
1074756544 10:116627910-116627932 CTTCCGAGGTGCGCACCCGGGGG - Intronic
1076426362 10:130370152-130370174 CTTCCGAATGGAGCACAAGGTGG - Intergenic
1081870866 11:46381960-46381982 CTGGAAAGTGGAGCACGCGGAGG + Intronic
1085049027 11:73370427-73370449 CCTCCGAGTGGAGGAGGCGGAGG - Intergenic
1088007867 11:104963926-104963948 CTTCAGAGTGGAGCCCTTGGAGG - Intronic
1097962439 12:65545820-65545842 CTTCTGAGTGGGGCAGGTGGCGG - Intergenic
1113739648 13:112702418-112702440 CTTCCCACTGGAACACGCGGGGG - Intronic
1121175833 14:91890038-91890060 CTTCCCACTGGAGCAGGAGGGGG - Intronic
1132616196 16:842198-842220 CAACCGAGAGGAGCACGTGGAGG - Intergenic
1132830104 16:1923789-1923811 CCTGCGAGGGGAGCAAGCGGAGG + Intergenic
1149863977 17:60140118-60140140 CTTCCGGGTGAAACCCGCGGTGG - Intergenic
1161924934 19:7293517-7293539 CTCCAGAGAGGAGCCCGCGGCGG + Intronic
1163015146 19:14450370-14450392 CTTCCGAGTGGAGCACGCGGTGG + Exonic
1165153113 19:33772355-33772377 CCTCGCAGTAGAGCACGCGGTGG - Exonic
926954761 2:18282296-18282318 CTTCTGAGTGGAGCACCTGAGGG + Intronic
927810238 2:26176336-26176358 CTTCCCAGGGGAGTACGCCGAGG + Exonic
928090934 2:28374742-28374764 CTTCCTGGTGCAGCACGAGGCGG + Intergenic
943758869 2:191587086-191587108 CTTCAGAGTGGAGCCCTTGGAGG - Intergenic
1168803810 20:661558-661580 CTTCTGATTGGAGCAAGGGGTGG - Intronic
1175859596 20:62143234-62143256 CTTCCAAGTGGAGTACGCGCAGG - Exonic
1176108243 20:63399447-63399469 CTTCAGACTGGAGCATTCGGGGG + Intergenic
1176157035 20:63627093-63627115 CTTCCTAGTGACGCAGGCGGCGG + Intergenic
1183020807 22:35024457-35024479 CTTCAGAGTGGGGCAGGAGGAGG + Intergenic
968285753 3:197507784-197507806 CTTGCGAGTGGCGCATTCGGAGG - Intergenic
980656208 4:135790119-135790141 CTTGTGAGTGGAGCACGCAAGGG - Intergenic
998194517 5:140056102-140056124 CTTTCCAGTGGTGCACGTGGAGG - Intergenic
1000530732 5:162416604-162416626 CTTCCGGGTGGATCACGAGATGG + Intergenic
1001927280 5:175647568-175647590 CTTCAGAGGGGAGCATGTGGAGG + Intergenic
1002953627 6:1840674-1840696 CTTCCAAGTGGAGCACTGAGTGG + Intronic
1021884447 7:25125089-25125111 CATTCGAGTGGAGCCCGCGCTGG - Intronic
1022618114 7:31953311-31953333 CTTCAGAGTGGAGCATGAGTAGG - Intronic
1035169729 7:157010704-157010726 CTTCCGATTGGCGCGCGCAGCGG + Intergenic
1036124972 8:6054017-6054039 CTTCCTAGTGGAGAAGGCTGAGG - Intergenic
1053364783 9:37515041-37515063 CTCCAGAGTGGAGCAGGGGGTGG + Intronic
1059686751 9:116645173-116645195 CTTCCAAGTGGAGGAGGCAGAGG - Intronic
1061175943 9:128997154-128997176 CTTCCAGGTGGAGCCCGTGGAGG + Intronic