ID: 1163018997

View in Genome Browser
Species Human (GRCh38)
Location 19:14472850-14472872
Sequence TATAGAGCAGGCGCGGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163018989_1163018997 10 Left 1163018989 19:14472817-14472839 CCACCAACACCTGCGGGGGAAGC 0: 1
1: 0
2: 2
3: 10
4: 119
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163018990_1163018997 7 Left 1163018990 19:14472820-14472842 CCAACACCTGCGGGGGAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163018983_1163018997 23 Left 1163018983 19:14472804-14472826 CCGACGGCCAGCGCCACCAACAC 0: 1
1: 0
2: 2
3: 10
4: 149
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163018985_1163018997 16 Left 1163018985 19:14472811-14472833 CCAGCGCCACCAACACCTGCGGG 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163018992_1163018997 1 Left 1163018992 19:14472826-14472848 CCTGCGGGGGAAGCCGGTGTGAG 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163018982_1163018997 26 Left 1163018982 19:14472801-14472823 CCGCCGACGGCCAGCGCCACCAA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65
1163018981_1163018997 30 Left 1163018981 19:14472797-14472819 CCAGCCGCCGACGGCCAGCGCCA 0: 1
1: 0
2: 0
3: 12
4: 114
Right 1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163018997 Original CRISPR TATAGAGCAGGCGCGGGCGC AGG Intronic
901049412 1:6418943-6418965 TCTGGGGCAGACGCGGGCGCTGG + Exonic
902378241 1:16040249-16040271 TATAGAGCAGGCTTGGGTGTGGG + Intergenic
902383350 1:16062757-16062779 TATAGAGCAGGCTTGGGTGTGGG + Intronic
902841555 1:19077400-19077422 TCTGGAGCAGGCTCGGGAGCAGG + Intronic
908354957 1:63319849-63319871 TATTAGGCCGGCGCGGGCGCGGG + Intergenic
915420984 1:155781427-155781449 TATAGATCAGGCGTGGTGGCTGG - Intronic
919463394 1:197904381-197904403 TGTAGAGCAGGGGCATGCGCAGG + Intronic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1067484558 10:46635565-46635587 TACAGAGCAGGGGCGGCGGCGGG + Intergenic
1067610201 10:47706082-47706104 TACAGAGCAGGGGCGGCGGCGGG - Intergenic
1091991726 12:4961059-4961081 TAGAGAGGAGGCTCGGGGGCTGG + Intergenic
1093434633 12:19122435-19122457 TATAATGCAGGAGCGGGGGCAGG - Intergenic
1104773359 12:131378592-131378614 TATAGAGGAGGGGCGGGGTCTGG + Intergenic
1106190006 13:27443445-27443467 TATAGAGCAGGCTTGTGAGCAGG - Intronic
1111842998 13:93473319-93473341 TATGGAGCAGGCCAGGGTGCAGG + Intronic
1129039062 15:72670291-72670313 TGTAGAGCAGGTGAGGGCACGGG + Intergenic
1129210770 15:74066626-74066648 TGTAGAGCAGGTGAGGGCACAGG - Intergenic
1129399574 15:75274141-75274163 TGTAGAGCAGGTGAGGGCACGGG + Intronic
1129403241 15:75298703-75298725 TGTAGAGCAGGCGAGGGCACAGG + Intergenic
1129476721 15:75790829-75790851 TGTAGAGCAGGCAAGGGCTCAGG + Intergenic
1129839910 15:78737618-78737640 TGTAGAGCAGGTGAGGGCTCGGG + Intergenic
1132177870 15:99729535-99729557 GACAGAGCAGGCGCGGGCACCGG - Exonic
1132419244 15:101651756-101651778 TTTAGAGCAATCGCAGGCGCTGG - Exonic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1138514542 16:57528919-57528941 GCTGGAGGAGGCGCGGGCGCGGG - Exonic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1142699095 17:1648882-1648904 TAAAGAGCGAGCGCGGGGGCAGG - Exonic
1148205791 17:45779033-45779055 TATAGGGCAGGGGAGGGGGCTGG - Intergenic
1149659283 17:58325968-58325990 TATAGAGCTGGAGTGGGGGCAGG - Intronic
1150643390 17:66964402-66964424 GAGAGAGCGCGCGCGGGCGCGGG + Intergenic
1152306609 17:79524638-79524660 TGTGGAGCAGGCACGGGCACTGG + Intergenic
1152606698 17:81295066-81295088 GCCTGAGCAGGCGCGGGCGCGGG + Exonic
1152916432 17:83039213-83039235 TCTAGAACAGGGGCGGGCGGCGG - Intronic
1152916442 17:83039251-83039273 TCTAGAACAGGGGCGGGCGGCGG - Intronic
1152916472 17:83039363-83039385 TCTAGAACAGGGGCGGGCGGCGG - Intronic
1152916502 17:83039477-83039499 TCTAGAACAGGGGCGGGCGGCGG - Intronic
1152916512 17:83039515-83039537 TCTAGAACAGGGGCGGGCGGCGG - Intronic
1152916530 17:83039591-83039613 TCTAGAACAGGGGCGGGCGGTGG - Intronic
1155027866 18:21958544-21958566 TATAGAGCAGACAGGGGCCCAGG + Intergenic
1161307685 19:3576998-3577020 TCTGGAGCAGGAGCTGGCGCTGG + Exonic
1162491481 19:10995127-10995149 AAAAGAGCAGGCGCGGGCTTGGG + Intronic
1162728074 19:12701712-12701734 CTGAGGGCAGGCGCGGGCGCTGG - Intronic
1163018997 19:14472850-14472872 TATAGAGCAGGCGCGGGCGCAGG + Intronic
1165331130 19:35141595-35141617 TCCAGAGCAGGAGCGGGCGAAGG - Intronic
1167369659 19:49072845-49072867 CGCAGAGCAGGCGCGGGCGGCGG - Exonic
937224507 2:120360435-120360457 CATAGAGCAGGCCCAGGAGCAGG - Intergenic
940650539 2:156436281-156436303 GAGGGAGCAGGCGCGGGAGCGGG + Intronic
947498998 2:230658804-230658826 TCTAGAGCAGGAGCAGGAGCAGG + Intergenic
1168804654 20:665413-665435 TCTAGAGCAGGCTTGGGAGCAGG - Intronic
1172450406 20:35018712-35018734 TATAGAGCAGGCTACGGGGCTGG - Intronic
1172843584 20:37916300-37916322 GATAGGGCAGGGGCGGGGGCAGG - Intronic
1175783519 20:61698194-61698216 TAGAGAGCAGGCGTGAGGGCGGG - Intronic
1183949545 22:41345109-41345131 CATAAAGCTGGCGGGGGCGCTGG - Intronic
1185159448 22:49214262-49214284 TTTAGAGCAGGAGCGGGCGGTGG - Intergenic
952543114 3:34388811-34388833 TATAGAGAAGGGGAGGGCTCTGG + Intergenic
954277870 3:49554357-49554379 GACAGCGCATGCGCGGGCGCCGG + Intergenic
969714008 4:8859867-8859889 TCCAGAGCAGGCGCGGGCAGTGG + Intronic
983466807 4:168103963-168103985 TCTAGAGCAGACTGGGGCGCTGG + Intronic
985822589 5:2170226-2170248 CATAGAGCAGGGGCGTGTGCGGG + Intergenic
1004627910 6:17393898-17393920 AATAAAGGCGGCGCGGGCGCGGG + Intronic
1006450552 6:34103477-34103499 GAGAGAGCAGGCGGGGGCGGCGG + Intronic
1007585718 6:42988027-42988049 TATACAGCAGGAGCGTGCTCAGG + Intronic
1017888854 6:158622909-158622931 TAAAGAGCAAGCGTGGGAGCGGG - Intronic
1025004708 7:55344810-55344832 TATAGGGGAGGCCCAGGCGCTGG - Intergenic
1034275668 7:149822806-149822828 TTGAGGGCAGGCACGGGCGCAGG - Intergenic
1034509041 7:151519610-151519632 TACAGAGCAGGGGCGGCGGCGGG + Exonic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1043714130 8:83460352-83460374 TAAGGAGCAGGCAAGGGCGCTGG - Intergenic
1061062201 9:128256098-128256120 TGTAGACCAGGCGAGGGCACGGG - Exonic
1062659036 9:137618900-137618922 CAACGCGCAGGCGCGGGCGCAGG + Intronic