ID: 1163020283

View in Genome Browser
Species Human (GRCh38)
Location 19:14477877-14477899
Sequence GAGGTGGGGAGGAGGTTGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1005
Summary {0: 1, 1: 0, 2: 5, 3: 95, 4: 904}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163020257_1163020283 28 Left 1163020257 19:14477826-14477848 CCCTCCCTCCCTCCTGCTCTGGG 0: 1
1: 0
2: 22
3: 240
4: 1711
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020264_1163020283 20 Left 1163020264 19:14477834-14477856 CCCTCCTGCTCTGGGCCAGGGAT 0: 1
1: 0
2: 3
3: 46
4: 364
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020260_1163020283 24 Left 1163020260 19:14477830-14477852 CCCTCCCTCCTGCTCTGGGCCAG 0: 1
1: 1
2: 8
3: 77
4: 673
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020268_1163020283 16 Left 1163020268 19:14477838-14477860 CCTGCTCTGGGCCAGGGATGGGC 0: 1
1: 1
2: 7
3: 99
4: 549
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020259_1163020283 27 Left 1163020259 19:14477827-14477849 CCTCCCTCCCTCCTGCTCTGGGC 0: 1
1: 0
2: 14
3: 233
4: 1921
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020271_1163020283 5 Left 1163020271 19:14477849-14477871 CCAGGGATGGGCCTGGAAGGAGA 0: 1
1: 0
2: 6
3: 56
4: 427
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020261_1163020283 23 Left 1163020261 19:14477831-14477853 CCTCCCTCCTGCTCTGGGCCAGG 0: 1
1: 0
2: 7
3: 89
4: 701
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020265_1163020283 19 Left 1163020265 19:14477835-14477857 CCTCCTGCTCTGGGCCAGGGATG 0: 1
1: 1
2: 2
3: 48
4: 460
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904
1163020275_1163020283 -6 Left 1163020275 19:14477860-14477882 CCTGGAAGGAGAGATGGGAGGTG 0: 1
1: 0
2: 3
3: 66
4: 507
Right 1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG 0: 1
1: 0
2: 5
3: 95
4: 904

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163020283 Original CRISPR GAGGTGGGGAGGAGGTTGCG GGG Exonic
900166216 1:1245208-1245230 GAGGAGGGGAGAAGAGTGCGGGG - Intronic
900178568 1:1301670-1301692 GAGGTGGGGAGGGGCTGGGGAGG - Intronic
900507085 1:3035074-3035096 GAGGTGGGCATGGGGTTGGGAGG + Intergenic
900513195 1:3069840-3069862 GAGGGGCGGAGGAGGGGGCGCGG + Intronic
900567243 1:3339557-3339579 GAGGTGGGAAGGAGCGTGGGAGG + Intronic
900595602 1:3478861-3478883 GAGGTGGGGGGTGGGGTGCGGGG + Intronic
900636118 1:3666601-3666623 GAGGTGGGCAGGAGGTGGTGGGG - Intronic
900642372 1:3693873-3693895 GAGGAGGGGCGGAGGCTGCATGG - Intronic
900642514 1:3694332-3694354 GAGGAGGGGCGGAGGCTGCATGG - Intronic
900685449 1:3945127-3945149 CAGGTGAGTAGGAGGCTGCGAGG + Intergenic
901464616 1:9413320-9413342 GGGGTGGGGCGGAGGCTGGGAGG + Intergenic
901636392 1:10672213-10672235 GCGGAGGGGAGGGGGTGGCGGGG - Intronic
901638265 1:10680287-10680309 GTGGAGGGGAGGGGGGTGCGAGG + Intronic
901825368 1:11857990-11858012 GAGGTGGGGAGAAGGTATTGTGG + Intronic
901853777 1:12031502-12031524 GAGGTGGGGAGGATGGAGCCTGG + Intronic
902231101 1:15028188-15028210 GAGGTGGGAGGGAGGGTGTGTGG - Intronic
902385335 1:16072868-16072890 GGGGTGGGGAGGAGGATTAGGGG + Intronic
902611495 1:17600234-17600256 AGGGAGGGGAGGAGGCTGCGAGG - Intronic
902709805 1:18230919-18230941 GAGGAGGGGGGCAGGCTGCGGGG - Intronic
902717338 1:18281779-18281801 GAGGCAGGGAGGAGGCAGCGAGG + Intronic
902768336 1:18631379-18631401 GAGGTGGGGTGGAGGTTGGGGGG - Exonic
903033427 1:20479440-20479462 GAGGTGGGGAGTGGTTTGGGGGG - Intergenic
903357430 1:22756567-22756589 GAGGTGTGGGGGAAGTGGCGGGG + Intronic
903653577 1:24935378-24935400 GAGGTGGAGAGGAGGTGGGTGGG - Intronic
903815494 1:26061375-26061397 GAGCTGGGGAGGGGGATGCAGGG - Intronic
904490680 1:30857154-30857176 GAGGTGGGGGTGAGGGTGGGAGG - Intergenic
904491685 1:30864396-30864418 GGGGTGGGGAGGAGGTGAAGGGG + Intergenic
904587468 1:31588200-31588222 GAGCTGGTGACGAGGTTGGGCGG - Intergenic
904610183 1:31721528-31721550 GAGGTGGGAATGGGGTTGGGGGG - Intergenic
905868893 1:41391746-41391768 GAGGTGGGGCTGAGGTAGGGTGG + Intergenic
906480743 1:46197642-46197664 TAGGTGGGGAGGAAGCTGGGAGG + Intronic
906562737 1:46771128-46771150 GAGATGGGGAGGAGATGGTGAGG - Intronic
909431066 1:75588275-75588297 GAGGTGGGGAGGAAGGTGACAGG + Intronic
910338090 1:86155977-86155999 GAGAAGGGGAGGAGGGCGCGAGG + Intronic
910374588 1:86554134-86554156 GAGTGGGGGTGGAGGTTGGGAGG - Intronic
911123954 1:94322979-94323001 GAGGTGGGGAGGAGACTGCAGGG - Intergenic
911161424 1:94686061-94686083 GGGGCAGGGAGGAGGTTGGGTGG + Intergenic
911234426 1:95395897-95395919 GAGGTGGGAAGGAGATAGTGAGG + Intergenic
911707661 1:101032750-101032772 GAGGTGGGGCGGAGGCGGGGGGG - Intergenic
911964763 1:104352389-104352411 GAGATGGGGAGCAGGTTCCTAGG + Intergenic
913560049 1:120008947-120008969 GAGCTGGGGATGAGGGTGTGGGG + Intronic
914280635 1:146168366-146168388 GAGCTGGGGATGAGGGTGTGGGG + Intronic
914390959 1:147222847-147222869 GAGGATGGGAGGAGGTTGGGAGG - Intronic
914492628 1:148161703-148161725 GAGGTTGGGAGGGGGGTGAGCGG - Intergenic
914541678 1:148619306-148619328 GAGCTGGGGATGAGGGTGTGGGG + Intronic
914624960 1:149451941-149451963 GAGCTGGGGATGAGGGTGTGGGG - Intergenic
915163047 1:153933105-153933127 GAGATGGGGAGGAGGTGGGAGGG - Intronic
915340524 1:155174553-155174575 GAGGGGGGGAGGAAGTGGTGGGG - Intronic
915436560 1:155911182-155911204 GGGGTGGGGAGGGGGTTCGGAGG - Intronic
915465109 1:156092790-156092812 GAGGTGGGCAGGAGCTGGCCAGG - Intronic
915594568 1:156888725-156888747 GGAGTGGGAAGGAGGTTGTGAGG - Intergenic
915892865 1:159787762-159787784 CAGGTGGGGAGGAGGCTTCCAGG + Intergenic
916168302 1:161982401-161982423 GGGGTCGGGAGGAGGCTGAGGGG + Intergenic
916453232 1:164941827-164941849 GAGGTTGGGAGAAGGGTGGGAGG - Intergenic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
917344209 1:174012102-174012124 CAGGTGGGGATGAGGTGGCAGGG + Intronic
918079172 1:181192484-181192506 GTTGTGGGGAGGAGCTAGCGCGG - Intergenic
918540931 1:185632307-185632329 GAAGTGGGGAGGGGGTTTCTAGG - Intergenic
918658099 1:187054068-187054090 CAGGTGGGGAGGGGACTGCGGGG - Intergenic
919041039 1:192388526-192388548 GAGGTGTGGAGGAGGTGGATGGG + Intergenic
919544918 1:198903527-198903549 AAGGGGGTGAGGAGGGTGCGGGG + Intergenic
919857905 1:201718267-201718289 CAGGTGGGGAGGAGGTGACAGGG + Intronic
919860088 1:201734085-201734107 GAGGTGGGGAGAAGGTTTTGAGG + Intronic
920028517 1:203020001-203020023 GGGGTGGGGTGGGGGGTGCGGGG + Intronic
920680793 1:208071016-208071038 GAGGAGGGGAGGTGGTTGGTGGG + Intronic
920868950 1:209777291-209777313 GTGTTGGGGTGGAGGTTGGGGGG - Intronic
922076230 1:222247607-222247629 GAGGTTGGGAGGAGGGTGTTGGG - Intergenic
922209868 1:223478889-223478911 GTGGAGGTGAGGAGGTAGCGGGG + Intergenic
922209981 1:223479189-223479211 GAGGGGGTTAGGAGGTTGGGGGG + Intergenic
922486354 1:225976084-225976106 AAGGTGGGGAGGAGGTGGCGCGG - Intergenic
922574917 1:226655065-226655087 GAGGTGGGGAGGAGGGGAGGAGG + Intronic
922874241 1:228927431-228927453 GAGGTGGGGTGGGGGTGGGGTGG - Intergenic
922892641 1:229073398-229073420 AAGGAGGGGAGGAGGGTGAGGGG + Intergenic
923008816 1:230072353-230072375 GTGGTGGGGCGGGGGTGGCGGGG + Intronic
923291832 1:232553159-232553181 GAGCTGGAGAGGAGGTAGAGTGG + Intronic
923850073 1:237784743-237784765 GAGATGGGGAGGAGGGAGAGAGG + Exonic
1062812541 10:477467-477489 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1062812555 10:477501-477523 GAGGTGGGGAGGAAGGTGGATGG + Intronic
1063349198 10:5338532-5338554 ATGGTGGTGAGGAGGTTGCAGGG - Intergenic
1063517599 10:6712191-6712213 GGGGAGGGGAGGAGGGTGCGGGG + Intergenic
1063517628 10:6712267-6712289 GGGGAGGGGAGGAGGGTGCTAGG + Intergenic
1063592338 10:7407229-7407251 GGGGTGGGGAGGGAGTTGAGCGG - Intronic
1063593198 10:7411286-7411308 GCGGTGGGGAGGAGGCCGCGTGG - Intronic
1065204556 10:23344351-23344373 GAGAGGGGGAGGAGGAGGCGGGG + Intronic
1065589661 10:27251961-27251983 GGGGAGGGGAGGGGGTTCCGGGG - Intergenic
1065643095 10:27805154-27805176 GAGAAGGGAAGGAGGTTGCTTGG + Intergenic
1065787442 10:29229637-29229659 CATGTGGGGAGGAGGCTGTGGGG + Intergenic
1065810912 10:29442794-29442816 GAGGTGGGGGTGAGGTGGGGTGG + Intergenic
1066065741 10:31759818-31759840 GATTTGGGGAGCAGGTGGCGCGG + Intergenic
1066105058 10:32149003-32149025 GGGGTGGGGAGGTGGGTGGGTGG - Intergenic
1066648690 10:37635676-37635698 GAGGTGGGAGGCAGGTTGAGAGG + Intergenic
1067031574 10:42881366-42881388 GAGGTGGGAGGCAGGTTGAGAGG + Intergenic
1067356590 10:45534180-45534202 TTGGTGGGGGGGAGGTTGGGGGG - Intronic
1067879184 10:50029055-50029077 GTTGTGGGGAGGAGGTTTCTGGG + Intergenic
1068571648 10:58636435-58636457 GTGTTGGGGAGGAGGTGGGGAGG - Intronic
1068584408 10:58780613-58780635 GAAGTGGGAAGGAGGTTTAGGGG + Intronic
1069090852 10:64197143-64197165 GAGGTGGGGAGGGAGAGGCGCGG - Intergenic
1069580059 10:69559684-69559706 GAGGGGGAGAGGAGGGTGCCTGG + Intergenic
1069779541 10:70946040-70946062 GTGGAGGGGATGGGGTTGCGGGG + Intergenic
1069856632 10:71444641-71444663 GAGGTGGGGAGGAGGAAAAGAGG + Intronic
1070000057 10:72369560-72369582 GAGATGGTGAGGGGGTTTCGTGG + Intronic
1070502533 10:77085022-77085044 GAGGTGGGGAGGAGACTGAAAGG - Intronic
1070601415 10:77868924-77868946 GAGGTGGGGAGGTGAGTGCTGGG - Intronic
1070646021 10:78203136-78203158 GAGGTGATGGGGAGGGTGCGGGG - Intergenic
1070786544 10:79165428-79165450 GAGGGAGGGAGGAGGGTGTGTGG + Intronic
1070950595 10:80428054-80428076 GAAGTGGCAAGGAGGTTGCGGGG + Intronic
1070961344 10:80502234-80502256 GAGGTGGGAAGGAGATGCCGTGG + Intronic
1073105609 10:101030769-101030791 GGGGTGGGGCGGGGGCTGCGTGG + Intronic
1073465435 10:103692383-103692405 GGGGCGGGGAGGGGGTTGGGGGG + Intronic
1073815692 10:107204193-107204215 GAGGAGGGTAGGGGGTGGCGGGG + Intergenic
1074099019 10:110338978-110339000 GAGGTGGGAAGGAGGCTGTCAGG + Intergenic
1074377519 10:112951696-112951718 GAGGCGGGGAGGGGGAGGCGGGG - Intronic
1074383389 10:112998067-112998089 GAGGTGGGGAGGAGGGGCCCAGG + Intronic
1074491479 10:113943228-113943250 GAGGTGGGGAAGAGGGTTGGTGG - Intergenic
1074756519 10:116627832-116627854 GAGGCGGGCAGGAGGCTGGGGGG + Exonic
1074917827 10:117974432-117974454 GAGATAGGGAGGAGGTTTGGGGG + Intergenic
1075004668 10:118821180-118821202 GAGCTGGGGAGGAGGGAGCGCGG + Intergenic
1075419750 10:122291881-122291903 GGTGTGGGGAGGAGGTGGTGGGG + Intronic
1075649643 10:124119237-124119259 GAGGTGGGGAGGAGGAGGTAAGG + Intergenic
1075979066 10:126721711-126721733 GAGGTGTGGAAAAGGCTGCGGGG + Intergenic
1076034890 10:127191256-127191278 GAGGAGGGGAGGAGGTGGCAAGG - Intronic
1076035643 10:127196607-127196629 GAGGTGGGGCGGGGGCGGCGCGG + Intronic
1076101636 10:127784953-127784975 GAGGGTGGGAGGAGGTTGGGAGG + Intergenic
1076318970 10:129564480-129564502 GAGGAGGGGAGGAGGAAGGGAGG - Intronic
1076812982 10:132898807-132898829 GAGGAGGGGAGGGGGTTAAGGGG - Intronic
1076934540 10:133558682-133558704 GAGGTGGGAATGAGGTTGGAGGG + Intronic
1076989940 11:267547-267569 GAGGAGGGGAGGAGGGGGAGGGG + Intergenic
1077096623 11:801761-801783 GGGGTGGGGTGGAAGTTGCCAGG + Intronic
1077390936 11:2300340-2300362 GGGGTGGGCAGGAGGGTGTGGGG + Intronic
1077482833 11:2824596-2824618 GGGGTGTGGATGAGGTTGCCTGG + Intronic
1077528148 11:3081099-3081121 GAGGTGGTGAGGAGGTGGCTGGG + Intergenic
1078140943 11:8692603-8692625 GAGATGGGGAGGAGGAAGAGGGG + Intronic
1078390573 11:10932167-10932189 GTGGGGGGGAGGAGGTGGTGGGG + Intergenic
1078390582 11:10932184-10932206 GTGGGGGGGAGGAGGTGGTGGGG + Intergenic
1078794199 11:14575404-14575426 GAGGTGGGGTGGGGGTAGGGGGG - Intronic
1079035197 11:17014426-17014448 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1079756195 11:24267204-24267226 GAGCAGGGGAGTAGGTTGCTAGG - Intergenic
1080691148 11:34559080-34559102 GAGATGGGGAGGAGGCTGATTGG + Intergenic
1081906640 11:46674549-46674571 GGGGTGGGGAAGGGGTTACGAGG - Intronic
1081938400 11:46920176-46920198 GAGGTGGGAAGGAGGATGCTGGG - Intergenic
1082107777 11:48239418-48239440 GAGGAGGGGAGGAGATTGCCTGG - Intergenic
1083044867 11:59725139-59725161 GGGGTGGGGTGGAGGTTGGGAGG + Intronic
1083306185 11:61762984-61763006 GAGGTGGGCAGGAGGATTAGGGG + Intronic
1083579094 11:63813551-63813573 GCGGCGGGGAGGGGGCTGCGCGG + Exonic
1083797931 11:65028754-65028776 GGGGTGGGGAGGATGTGGCAAGG + Intronic
1083806185 11:65075548-65075570 GGGGTGGGGGGGATGTTGAGGGG + Intronic
1083909465 11:65697592-65697614 GAGTTTGGGAGGAGGTGGGGAGG - Intergenic
1084271675 11:68032556-68032578 GTGATGGGGAGGGGGTTGCCAGG + Intronic
1084675466 11:70631410-70631432 CAGGTGGGAGGGAGGTTGTGTGG - Intronic
1084739936 11:71133163-71133185 GAGGTGGGTAGGAGGATGAGTGG + Intronic
1084966336 11:72746664-72746686 GAGAGGGGGAGGGGGTTGGGGGG - Intronic
1085125645 11:74000443-74000465 GGGGTGGGGAAGAGGCTGCATGG + Exonic
1085156608 11:74301086-74301108 GGGGTGGCGAGGAGGATGAGTGG + Intronic
1088238745 11:107752378-107752400 GAGGGGGGGCGGGGGGTGCGGGG - Intergenic
1088429182 11:109739368-109739390 TAGGTAGGGAGGAGGCTGGGGGG + Intergenic
1088446585 11:109936760-109936782 TAGGTGGGGTGGAGGATGTGTGG - Intergenic
1088840935 11:113627243-113627265 GAGGTGGGGAGGAGGGAGGGAGG + Intergenic
1089153145 11:116379940-116379962 AATGTGGGGAGGAAGATGCGTGG - Intergenic
1089182057 11:116590007-116590029 CAGGTGGGGAGGAAGTAGAGGGG - Intergenic
1089202092 11:116730698-116730720 AGGGTGGGGAGGAGGTTGGCAGG + Intergenic
1089273057 11:117315125-117315147 GAGGAGGGGACAAGGTTGGGTGG + Intronic
1089338243 11:117740413-117740435 GAGGTGGAGAGGAGGTTCTTAGG + Intronic
1089396734 11:118141054-118141076 GAGATGGGGAGGGGGTGGCAGGG + Intronic
1090076113 11:123581027-123581049 GGGGTGTGGAGGAGGTAGGGGGG - Intronic
1090248730 11:125236377-125236399 GAGGTGGGGCGGGGGGTGGGTGG + Intronic
1090314160 11:125770199-125770221 GAGGTGGAAAGGATGTTGCTGGG - Intergenic
1090622452 11:128573008-128573030 GAGGAGGGGAGAAGATTGTGTGG + Intronic
1090648363 11:128784700-128784722 GAGGTGGGGAGGAGGCAGGGAGG - Intronic
1090817910 11:130314802-130314824 GAGGGGAGGGGGAGGTTGGGAGG + Intergenic
1091070515 11:132558415-132558437 GAGGAGGGGAGGAGGAGGAGGGG - Intronic
1091070539 11:132558479-132558501 GAGGAGGGGAGGAGGAGGAGTGG - Intronic
1091240769 11:134050729-134050751 GGGGTGGGCAGGAGGCGGCGCGG + Intergenic
1091353517 11:134916176-134916198 AGGGTGGGGAGGAGGTTTCATGG - Intergenic
1091594370 12:1865747-1865769 GGCGCGGGGAGGCGGTTGCGGGG + Intronic
1091687350 12:2572811-2572833 GAGGAGGGGAGGAGGAGGAGAGG - Intronic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1092810228 12:12266249-12266271 GGGGTGGGGAGTGGGTGGCGGGG + Intronic
1092915184 12:13183009-13183031 GAGGTGGGGAGGAGGCAGGTGGG + Intergenic
1092937238 12:13375479-13375501 AAGGTGGGGCGGAGGTGGGGTGG - Intronic
1094476502 12:30844639-30844661 GTGGTGGGGAGGTGGTGGTGTGG - Intergenic
1095676204 12:44921743-44921765 TAGGTGGGGTGGAGGGTGGGAGG - Intronic
1095812286 12:46383621-46383643 GAGGCGGGGAGGAGGCGGGGAGG + Intergenic
1095922481 12:47544696-47544718 GGGGTGGGGTGGAGGATGGGGGG - Intergenic
1095960690 12:47832773-47832795 GAGGTTGGGGGGTGGTTGTGGGG - Intronic
1095960694 12:47832784-47832806 CAAGTGGGGAGGAGGTTGGGGGG - Intronic
1096085989 12:48865424-48865446 GAGGTGAGGAGGAGCCAGCGGGG + Intronic
1096229266 12:49888331-49888353 GAGGTGGGGAGGGGGATGTGAGG + Intronic
1096517581 12:52165629-52165651 GAGGAGGGGAGGAGGCTGCTGGG - Intergenic
1096673131 12:53211742-53211764 GGGGTGGGGACCAGGCTGCGAGG + Exonic
1096693142 12:53333313-53333335 GTGGTGGGGTGGAGGTCGGGAGG - Intronic
1096830112 12:54307282-54307304 GAGGTGGGGCGGAGGTTCTGGGG - Intronic
1096847765 12:54417478-54417500 GGGGTGGGGTGGGGGTTGGGTGG + Intronic
1096874102 12:54613994-54614016 GCGGTGGGGCGGGGGTTGGGGGG - Intergenic
1097964429 12:65563622-65563644 GAGGAGGGGAGGAGGAGGAGGGG + Intergenic
1099994630 12:89764800-89764822 GTGGTGGGGAGCAGGTGGTGAGG + Intergenic
1100289831 12:93202917-93202939 GAGGAAGGGAGGAGGGTGGGTGG + Intergenic
1100827830 12:98491334-98491356 AAGGTGGGGAGGAGGTGAGGAGG - Intronic
1101252872 12:102952413-102952435 GAGGTGGGGAGGAGGAGGGAAGG + Intronic
1101416288 12:104511240-104511262 GAGGTGAGGAGAAGGCTGGGAGG - Intronic
1102381507 12:112470638-112470660 GAGGTGGGGGGGCGGTGGCAGGG - Intronic
1102471389 12:113161781-113161803 GGGGCGGGGAGGAGGGGGCGGGG - Intronic
1102473856 12:113175990-113176012 GAAGTGGGGAGGGGGATGTGGGG - Intronic
1102473867 12:113176013-113176035 GAGTTGGGGAGGGGGTTGTGGGG - Intronic
1103617190 12:122161817-122161839 GAGGCGGGCAGGAGGGTGGGGGG - Intergenic
1103623190 12:122201027-122201049 GGGATGGGGAGGAGGTGGTGGGG + Intronic
1103698382 12:122835131-122835153 GAGGTGGGGAGGAGCTGGGGGGG + Intronic
1103856427 12:123973432-123973454 GGGGTGGGAAGGAGGTGGAGTGG + Exonic
1104110244 12:125697889-125697911 GAGGAGGGGAGGATGTGGTGAGG + Intergenic
1104240781 12:126986927-126986949 GAGGTTGGGAGGAGGGAGAGGGG + Intergenic
1104749939 12:131231915-131231937 GAGGTGAGGAGGAGGAGGAGGGG - Intergenic
1104753394 12:131254117-131254139 ATGGTGGGGAGCAGGTTGGGAGG - Intergenic
1104759236 12:131287143-131287165 GAGGTGGGGCGGCGGCTGAGGGG - Intergenic
1104764605 12:131318908-131318930 GAAGTGGGGAGGAGGCTTCCAGG + Intergenic
1104821375 12:131679353-131679375 GAGGTGGGGTGGCGGCTGAGGGG + Intergenic
1105519901 13:21122712-21122734 GGGGAGGGGCGGAGGTTGTGGGG - Intergenic
1105811798 13:24001936-24001958 GAGGTGAGGAGGAGACTGCATGG + Intronic
1106138435 13:26991598-26991620 GGAGTGGGGAGGAGGCTGCTGGG - Intergenic
1106212840 13:27666867-27666889 GAACTGGGGAGGAGGGTGCTTGG - Intronic
1106304145 13:28495222-28495244 TAGGTGGGGAGGCGGATGAGGGG - Intergenic
1106350917 13:28929947-28929969 GAGGTGGGGCTGAGGCTGCAAGG + Intronic
1107022533 13:35766219-35766241 ATGGTGGGGAGGGCGTTGCGGGG + Intergenic
1107029934 13:35840209-35840231 GGGTTGGGGAGGAGGTTGAAGGG - Intronic
1107149080 13:37091161-37091183 GAGGTGGGAAGGCGGTGGGGAGG + Intergenic
1107574015 13:41697511-41697533 GAGGTGGGGTGGGGGCTGTGTGG + Intronic
1107892972 13:44930456-44930478 GAGATGGGGAGGAGGTGGTGAGG - Intergenic
1108705251 13:52979654-52979676 GAGGTGGGAAGAAGGATGAGAGG + Intergenic
1108711311 13:53035139-53035161 GAGGGAGGGAGGAGGATGAGAGG - Intronic
1109061640 13:57629563-57629585 GAGGTGCGGAGGAGTGTACGTGG - Intergenic
1109370835 13:61417096-61417118 GGGGTGGGGAGGAGGTGGAGTGG - Intronic
1109630121 13:65034436-65034458 GAGGGTGAGAGGAGGTGGCGGGG - Intergenic
1111458338 13:88512483-88512505 GAGGAAGGGAAGAGGTTGTGTGG + Intergenic
1111926157 13:94465008-94465030 GAGGTGTAGAGGAGGGTGAGGGG - Intronic
1112062587 13:95755904-95755926 GAGGTGGGGAAGAGGGAGAGAGG - Intronic
1112429353 13:99336920-99336942 GAGGTGGGAAGGAGGAAGAGAGG - Intronic
1113552755 13:111205879-111205901 GAAGTGGAGAGGAGGTTTTGGGG + Intronic
1113750560 13:112773876-112773898 GAGGTGGGGTGGAGGGTGGAGGG - Intronic
1114044435 14:18710292-18710314 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1114048720 14:18900743-18900765 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1114113794 14:19500903-19500925 GATGTGGGCAGGAGTTTGGGGGG - Intergenic
1114115494 14:19618654-19618676 GATGTGGGCAGGAGTTTGGGGGG - Intergenic
1114504555 14:23199293-23199315 GAAGTGGGGAGGAGGCTTCCAGG + Intronic
1114537511 14:23432355-23432377 GAGATGGGCACGAGGTTGGGGGG + Intronic
1114559740 14:23581014-23581036 GAGGGGGGGAGGAGGGAGTGGGG - Intergenic
1114668935 14:24398830-24398852 GCGGGGGGGAGGAGGGGGCGGGG - Exonic
1114978645 14:28133800-28133822 GGGGTGGGGTGGGGGTTGGGAGG + Intergenic
1115618889 14:35121828-35121850 GAGGTAGGGGGGAGGTGGGGAGG - Intronic
1115740389 14:36381569-36381591 GAGGTTGCGAGGGGGTTGTGGGG + Intergenic
1117076153 14:52106747-52106769 GTGGTGGGCAGGAGGTAGTGGGG + Intergenic
1117428760 14:55630251-55630273 TAGGTGGGGATGAGGTAGGGAGG + Intronic
1117690248 14:58298798-58298820 GAGGTGGGGAGAGGGATGCTAGG + Intronic
1118147613 14:63157455-63157477 GAGGTTGGGAGGAGGAAGAGAGG - Intergenic
1118715064 14:68553702-68553724 GAGGTGGGGTGGAGGTGGGTGGG + Intronic
1118854644 14:69611654-69611676 GAGGGAGGGAGGAGGTGGGGCGG - Exonic
1119071739 14:71592628-71592650 CAGGTGGGGAGGGGGTGGAGGGG + Intronic
1119188833 14:72664606-72664628 GAGGTGGTGAGGTGGTGGTGAGG - Intronic
1119777941 14:77259778-77259800 GAGGTGGAGGAGAGGTTGGGTGG + Intergenic
1119888220 14:78162285-78162307 GTGGTGGTGAGGAGGCAGCGTGG + Intergenic
1120024384 14:79566359-79566381 GAGGTGAGGAGGGAGTTGGGAGG - Intronic
1121284784 14:92726709-92726731 TAGATGGGGAGGAGGAAGCGAGG - Intronic
1121447436 14:93987936-93987958 GAGGTGGGAAGGAGGGAGTGGGG + Intergenic
1121719356 14:96098372-96098394 GAGGTGGGGAGGTCTTTGGGGGG + Intergenic
1121738313 14:96234282-96234304 GAGGGGGGAAGGAGGTAGGGAGG - Intronic
1121887924 14:97561737-97561759 GGGGTGGGGAGGAGCTGGCTGGG - Intergenic
1121964157 14:98288892-98288914 GAGGTGGGGAGGGGGCAGGGAGG + Intergenic
1122242442 14:100377774-100377796 AAGGTGTGGAAGAGGTTGGGTGG + Intronic
1122412150 14:101531099-101531121 AAAGTGGGGAGGAGGTTTTGAGG - Intergenic
1122626012 14:103085684-103085706 GAGGTGAGCAGGAGGTAGCTAGG - Intergenic
1123004263 14:105314133-105314155 GAGGTGGCAAGGAGGTGGCCGGG - Exonic
1123010213 14:105346476-105346498 GCGGTGGGGGGGATGTTGTGTGG - Intronic
1123010230 14:105346522-105346544 GGGGTGGGGGGGAAGTTGTGCGG - Intronic
1123010303 14:105346707-105346729 GGGGTGGGGGGGAAGTTGTGCGG - Intronic
1123504817 15:20930633-20930655 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1123562065 15:21504328-21504350 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1123598310 15:21941615-21941637 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1123991915 15:25689698-25689720 CTGCTGGGGAGGAGGTTGCTGGG - Intronic
1123996167 15:25719420-25719442 GAGCTGGGGAGGCATTTGCGGGG - Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1125250838 15:37701322-37701344 GGGCTGGGGTGGAGGTTGCGTGG - Intergenic
1125542071 15:40475353-40475375 GGTGTGGGGAGGAGGGTGTGAGG + Intergenic
1125883284 15:43210992-43211014 GAGATGGGTAGGAGCTTGCCAGG + Intronic
1127912941 15:63433363-63433385 GAGGGGAGGAGCAGGTTTCGGGG - Intergenic
1128019802 15:64380780-64380802 GAGGTGGGGGGGAGGTCTCATGG - Intronic
1128254894 15:66189290-66189312 GGGGTGGGGTGGAGGCTGAGGGG + Intronic
1128357324 15:66937295-66937317 GGGGTGGGGAGGAGGTAGTAGGG - Intergenic
1128544754 15:68559507-68559529 GGGGTGGTGAGGGGGTAGCGGGG + Intergenic
1128758419 15:70198546-70198568 AGGGTGGGGAGGAGGTGGGGTGG + Intergenic
1128940869 15:71786748-71786770 GAGGAGGGGAGGAGGAGGGGGGG + Intergenic
1129082266 15:73052014-73052036 GAGGCGAGGAGGAGGAGGCGGGG + Intronic
1129321516 15:74777608-74777630 GGGGAGGGGAGGAGGCTGGGTGG + Intergenic
1129411157 15:75351021-75351043 GAGGTGGGGTGGGGGCTGCTAGG + Intronic
1129710954 15:77819994-77820016 GCGGTGGGGAGGAAGGGGCGCGG - Intronic
1129747620 15:78035592-78035614 GGGGCAGGGAGGAGGTTGTGTGG + Intronic
1130290861 15:82599550-82599572 GAGGTGGGGAGAGGGTTTCCTGG - Intronic
1130613355 15:85380905-85380927 GAGGAGGGGCGGGGGCTGCGGGG + Intronic
1130990933 15:88875224-88875246 GGGGAGGGGAGAAGGTTGGGCGG - Exonic
1131709722 15:95039529-95039551 AAGGTGTGGAGGAGGTTTGGAGG + Intergenic
1131864051 15:96687906-96687928 GAGGTGGCGATGTGGTTGCTGGG + Intergenic
1132414980 15:101613310-101613332 TAGGTGGGGAGGAGGTGGGCTGG - Intergenic
1202970410 15_KI270727v1_random:231467-231489 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1133520285 16:6549536-6549558 GAGGGGAGGAGGAGGATGGGAGG + Intronic
1133534416 16:6687290-6687312 GAGGTTGGGAGGAGAATGTGGGG + Intronic
1133552488 16:6870731-6870753 GGGGTGGGGAGGAGTTTTGGTGG - Intronic
1134110914 16:11514989-11515011 GAGGCGGGGAGGAGGGCGTGGGG + Intronic
1134805490 16:17120517-17120539 GAGGTGGCCTGGAGGATGCGGGG - Intronic
1134880428 16:17741199-17741221 GATGTGGGGTGGAGGTTGGTGGG - Intergenic
1135400638 16:22164060-22164082 GAGGTCGGGAGGGGGGTGGGGGG + Intergenic
1135459294 16:22627586-22627608 GGGGTGGGGAGGGGGTTGCGGGG + Intergenic
1135547290 16:23374814-23374836 GAGGTAGGGAGGAGCTGGCCAGG + Intronic
1135724053 16:24840936-24840958 GAGGAGGGGAGGAGGGGGAGGGG + Intergenic
1136238808 16:28931999-28932021 GAGGAGGCGAGGAGGTGGCATGG - Exonic
1136370939 16:29835649-29835671 TAGGTGGGGAGCAGGCTGGGGGG + Intronic
1136549936 16:30977622-30977644 GTGGTGGGGAGGAAGGTGAGAGG + Intronic
1138144243 16:54594938-54594960 GGGGAGGGGGGGAGGTGGCGGGG - Intergenic
1138528965 16:57624787-57624809 GAGGTAGAGAGGAGGCTGCCGGG - Intronic
1139361407 16:66402381-66402403 GAGGTGGGGATGAGTATGCGGGG + Intronic
1139443135 16:66979136-66979158 GAACTGGGGTGGAGGCTGCGGGG - Intergenic
1139638706 16:68275263-68275285 GAGATTGGGAGGATGTTGGGGGG + Intronic
1139750893 16:69108193-69108215 CAGGTGGGGAGGGGGATGTGAGG - Intronic
1140002635 16:71040481-71040503 GTGGGGGGGAGGGGGGTGCGGGG - Intronic
1140015300 16:71176584-71176606 GAGGTGGGGTGGAGTTTGGCTGG - Intronic
1140222381 16:73053347-73053369 GCGGTGGTGGGGAGGCTGCGGGG + Intronic
1140732726 16:77871229-77871251 GTGGTGGGGTGGAGGGTGGGAGG - Intronic
1141028292 16:80568302-80568324 GAGGTGGGGATGTGGTTGACTGG - Intergenic
1141028311 16:80568370-80568392 GAGGTGGGGGTGTGGTTGAGTGG - Intergenic
1141028322 16:80568404-80568426 GAGGTGGGGATGTGGTTGAGTGG - Intergenic
1141028378 16:80568574-80568596 GAGGTGGGGGTGCGGTTGAGTGG - Intergenic
1141028402 16:80568642-80568664 GAGGTGGGGGTGTGGTTGAGTGG - Intergenic
1141028415 16:80568676-80568698 GAGGTGGGGGTGTGGTTGAGTGG - Intergenic
1141028762 16:80570619-80570641 GTGGTGGGGGTGAGGTTGAGCGG - Intergenic
1141028784 16:80570686-80570708 GAGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141054517 16:80803697-80803719 GGTGTGGGGCGGGGGTTGCGCGG - Intronic
1141135193 16:81460260-81460282 GAGGATGGGAGGAGGGTGAGTGG + Intronic
1141173408 16:81704634-81704656 GAGTTAGGGAGGAGGGTGAGGGG - Intronic
1141181223 16:81754362-81754384 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181234 16:81754383-81754405 GGGGAGGGGAGGAGGTGGGGAGG - Intronic
1141181245 16:81754404-81754426 GGGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181256 16:81754425-81754447 GAGGTGGGGAGGAGGTGGGGAGG - Intronic
1141181261 16:81754436-81754458 GTGGTGGGGAGGAGGTGGGGAGG - Intronic
1141517847 16:84558386-84558408 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1141571585 16:84937278-84937300 GAGGGCGGGAGGAGGTGGGGAGG - Intergenic
1141745906 16:85926133-85926155 GAGGTGGGGACGAGAAGGCGAGG - Intergenic
1141946007 16:87310698-87310720 GAGGTGGGAAGGAGGGTGCCCGG - Intronic
1142008294 16:87700731-87700753 GCGGAGGGGAGGAGGATGCAGGG + Intronic
1142008315 16:87700795-87700817 GCAGAGGGGAGGAGGTTGCAGGG + Intronic
1142225921 16:88877655-88877677 GAGGTGGGGAGGGGGACGGGTGG - Intronic
1142290678 16:89192521-89192543 GAGCTGGGGAGGAAGCGGCGTGG - Intronic
1142290697 16:89192578-89192600 GAGCTGGGGAGGAAGCGGCGTGG - Intronic
1142290715 16:89192635-89192657 GAGCTGGGGAGGAAGCGGCGTGG - Intronic
1142290734 16:89192692-89192714 GAGCTGGGGAGGAAGCGGCGTGG - Intronic
1142290753 16:89192749-89192771 GAGCTGGGGAGGAAGCGGCGAGG - Intronic
1142290772 16:89192806-89192828 GAGCTGGGGAGGAAGCGGCGAGG - Intronic
1142290790 16:89192862-89192884 GAGCTGGGGAGGAAGCGGCGTGG - Intronic
1142290843 16:89193034-89193056 GAGCTGGGGAGGAAGGGGCGTGG - Intronic
1142652020 17:1359925-1359947 GAGGGGGGGAGGAGGGGGAGGGG + Intronic
1142668258 17:1474792-1474814 GAGGTGAGGAGGACGTGGGGAGG - Exonic
1143022846 17:3925627-3925649 GAGGCGTGGGGGACGTTGCGGGG - Intronic
1143091804 17:4453225-4453247 GAGGTGGGGACAGGGTTGGGGGG + Intronic
1143105936 17:4530605-4530627 GAGGAGGGGTGGAGGATGCTGGG - Intronic
1143483203 17:7238766-7238788 GAGGTGGGCAGGTAGTTGTGGGG - Intronic
1143563889 17:7710015-7710037 GATGTGGGGAGGAGGATGCTAGG - Exonic
1143602390 17:7956736-7956758 GAGGGTGGGAGGAGGGAGCGGGG - Intergenic
1143880068 17:10023132-10023154 GAGGTGGGGAGGAGGGCACTGGG + Intronic
1144575980 17:16429746-16429768 GTGGAGGTGAGGAGGTTGGGAGG + Intronic
1144698549 17:17321998-17322020 GAGGTGGAGAGGAAGTTGTTTGG + Intronic
1144721894 17:17476872-17476894 GGGGTGGGGAGGCTGTTGCTAGG - Intergenic
1144777471 17:17791990-17792012 GAGGTGGGGAGGAACTGGCCAGG + Intronic
1145895384 17:28454544-28454566 GAGAGGGGGTGGAGGTTGGGAGG - Intergenic
1145897270 17:28466463-28466485 GAGGTGGGGAGGGGGTCCTGGGG - Intronic
1146928444 17:36761564-36761586 GAGGAGGGGACGAGGGTGCTGGG - Intergenic
1147163119 17:38579144-38579166 TAGGAGGGGAGGGGGTTGTGTGG - Intronic
1147219261 17:38919095-38919117 GAGCTGGGCAGGAGGATGTGAGG - Exonic
1147326565 17:39672474-39672496 GATGTGGGGAGGAGGCTGATGGG + Exonic
1147382330 17:40063090-40063112 GAGGTAAGGAGGAGGGAGCGAGG + Exonic
1147455669 17:40536659-40536681 CAGGTGGGGAGGAGGAGGTGAGG + Intergenic
1147602305 17:41754198-41754220 GAGGTGGGCAGGAGCTGGGGTGG + Intergenic
1147864392 17:43543199-43543221 GAGGTGGGGTGGGGATTGCAAGG - Intronic
1148193608 17:45697783-45697805 GAGGAGGGGAGGAGCTTCTGAGG - Intergenic
1148228643 17:45917156-45917178 GAGTTGGGCAGGAGGCTGCAGGG - Intronic
1148337407 17:46851282-46851304 GAGGCGGGGAGGAGGGTACGAGG - Intronic
1148340886 17:46872771-46872793 GAGGTGGGGAGGAGGGCTAGGGG + Exonic
1148455902 17:47811227-47811249 GGTGTGGGGTGGAGGTTGCAGGG - Intronic
1148688757 17:49514759-49514781 CAGGTGGGGAGGGGGTTTGGGGG + Exonic
1148852631 17:50562139-50562161 GCGGTGGGGAGGAAGCTGCGGGG + Intronic
1148964430 17:51422764-51422786 GAGGTGTGGAGGAGGATTAGGGG + Intergenic
1149445121 17:56707537-56707559 GAGGTGGGGAGGGGATGGTGCGG + Intergenic
1149459186 17:56813249-56813271 GTGATGGGGAGGAGGATGCCTGG - Intronic
1149938675 17:60838401-60838423 GAGGTGGTGAGGTGGGTGTGGGG + Intronic
1150364856 17:64573204-64573226 GAGGAGGGGAGGAGGAGGGGAGG + Intronic
1150364861 17:64573215-64573237 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1150672858 17:67217173-67217195 CAGCTGGGGAGGAGGTTTTGTGG - Intronic
1150714754 17:67562378-67562400 GAGATGTGGAGGAGGGTGAGAGG - Intronic
1150983470 17:70169389-70169411 GGGGAGGGGAGGATGCTGCGAGG - Intronic
1151366138 17:73617488-73617510 AAGGTGGGGAGGAGGGTGACAGG + Intronic
1151378414 17:73707920-73707942 GAGGTGGAGAGGAGGGTGAAAGG - Intergenic
1151506223 17:74529287-74529309 GAGTTGGGGAGGATGCTGCTGGG - Intronic
1151558358 17:74858590-74858612 GAGGTGGGGAGGGGGAGGCAAGG - Intronic
1151570931 17:74924955-74924977 GAGGTGGGGGCGAGGTAGGGTGG + Intronic
1151649346 17:75456689-75456711 GAAGTGAGGAGGGGGTTGGGAGG + Exonic
1151653872 17:75486384-75486406 GAGGTAGAGCGGAGGCTGCGAGG + Exonic
1151747898 17:76021598-76021620 GAGGTGGGGCGGACGTGGGGGGG - Intronic
1151854321 17:76710568-76710590 GGGGTGGGGAGGGGGCCGCGAGG + Intronic
1151919883 17:77146174-77146196 GAGCTGGGGAGGAGGCAGTGGGG + Intronic
1151947177 17:77326074-77326096 GAGGCGGGGAGGTGGGTGTGGGG - Intronic
1152336947 17:79703959-79703981 GTGGGGGGTAGGAGGTGGCGTGG + Intergenic
1152362398 17:79838892-79838914 GAGGCGGGGTGGAGGTGGGGTGG - Intronic
1152362476 17:79839113-79839135 GAGGCGGGGAGGGGGTGGGGAGG - Intronic
1152363220 17:79841844-79841866 GAGCTGGGGAGGAAGGGGCGGGG + Intergenic
1152597019 17:81242664-81242686 GAGGGGGAGGGGAGGTTGTGGGG + Intergenic
1152597266 17:81243856-81243878 GAGGCTGGGAGGGGGTTGCGGGG - Intergenic
1152784370 17:82240343-82240365 GAGGTGGGGAGCAGGCAGCCCGG + Intronic
1152853056 17:82648733-82648755 GGGGCGGGGAGGAGGGGGCGGGG + Intergenic
1152999859 18:444629-444651 GAGGTGGGGGTGAGGTAGGGAGG + Intronic
1153715205 18:7840072-7840094 GGGGTGGGGTGGAGGTGGGGGGG + Intronic
1153972492 18:10239166-10239188 GCGGTGGGGAGGAGGAGGAGAGG + Intergenic
1155102561 18:22626895-22626917 GAGGTGGGTAGGAGAATGGGAGG - Intergenic
1155110679 18:22711213-22711235 GGGGTGGGGAGGTGGGAGCGGGG - Intergenic
1156462950 18:37331866-37331888 GAGGTGGGGAGGATCTGGTGTGG + Intronic
1157105660 18:44772103-44772125 GAGGTGGGGAGGCTGGGGCGGGG - Intronic
1157610485 18:48952115-48952137 GGGGCGGGGAGGAGGCGGCGCGG - Intergenic
1157907386 18:51581679-51581701 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907391 18:51581690-51581712 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907396 18:51581701-51581723 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907401 18:51581712-51581734 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1157907406 18:51581723-51581745 GAGGGTGGGAGGAGGGTGGGAGG - Intergenic
1158118583 18:54024183-54024205 GAGGTGGGGACGGGGTTGGGGGG + Intergenic
1158137509 18:54223984-54224006 GGGGCGGGGAGGGGGTGGCGGGG - Intronic
1158224623 18:55187781-55187803 GAGGCAGGCAGGAGGTTGTGAGG + Intergenic
1158260169 18:55597820-55597842 TAGGTGGGGAGGGGGTTGGAGGG - Intronic
1159019941 18:63135232-63135254 GAGGCAGGGAGGAGGTTCCCTGG - Intronic
1159662687 18:71118415-71118437 GGGGTGGGGAGGAGGGAGCGGGG - Intergenic
1159695954 18:71556572-71556594 GGGGTGGCGAGGAGGGTGCTGGG + Intergenic
1160270577 18:77379814-77379836 GAGGTGGAGAGGATGCTCCGTGG - Intergenic
1160930937 19:1569042-1569064 GTGGGGCGGAGGAGGTGGCGTGG - Intergenic
1160947679 19:1651290-1651312 GGGGTGGGGAGGAGCCTCCGAGG + Intronic
1161088022 19:2344090-2344112 GTGATGGGGCGGGGGTTGCGAGG - Intronic
1161206963 19:3046573-3046595 GAGGTGGGGTGGGGGGTGGGGGG - Intronic
1161415725 19:4145431-4145453 GAGGTGGGGAGGAGGGGAAGAGG + Intergenic
1161530561 19:4786569-4786591 GAGGGAGGGAGGAGGTTGGAGGG + Intergenic
1161530568 19:4786587-4786609 GAGGGAGGGAGGAGGTTGGAGGG + Intergenic
1161530585 19:4786633-4786655 GAGGGAGGGAGGAGGTTGGAGGG + Intergenic
1161530598 19:4786669-4786691 GAGGGAGGGAGGAGGTTGGAGGG + Intergenic
1161530624 19:4786747-4786769 GAGGGAGGGAGGAGGTTGGAGGG + Intergenic
1161741993 19:6026949-6026971 GAGGTGGGGAGGGAGGTGGGCGG + Intronic
1162237732 19:9321780-9321802 GGGGTGGGGAGGAGGGTGGGGGG - Intergenic
1162340671 19:10089862-10089884 CAGGTGGGGATGAGGTGGGGGGG - Intronic
1162549711 19:11351658-11351680 GAGGTGGGGAGGTGGAGGCCAGG + Intronic
1163020283 19:14477877-14477899 GAGGTGGGGAGGAGGTTGCGGGG + Exonic
1163029802 19:14536950-14536972 GATGTGGGGAGGAGGGGCCGAGG + Intronic
1163182641 19:15615236-15615258 AAGGAGGAGAGGAGGTTGTGCGG + Exonic
1163186136 19:15640901-15640923 GAAGGGGAGAGGAGGTTGTGTGG + Exonic
1163202772 19:15780341-15780363 GAAGAGGAGAGGAGGTTGTGTGG - Intergenic
1163329704 19:16628407-16628429 GCCGTTGGGAGGAGGTTGGGCGG + Intronic
1163423141 19:17226351-17226373 CAGGTGGGGCGGAGGTCCCGAGG + Intronic
1163446664 19:17351024-17351046 GAGTTGGGGAGGAGGTTCCCTGG + Intergenic
1163634020 19:18430212-18430234 AAGGTGGGGAGGGGGATGTGAGG - Intronic
1163637823 19:18445541-18445563 GGGGTGGGGAGGGGGTGGGGGGG + Intronic
1163729646 19:18941422-18941444 GAGTGGGGGGGGGGGTTGCGTGG + Intergenic
1163765791 19:19162630-19162652 GAGGTGGGAAGGAGGGTCTGAGG - Intronic
1164292536 19:23880872-23880894 GAGGAGAGGAGGAGGATGAGAGG + Intergenic
1164434646 19:28218964-28218986 GAGGCGGGGAGGAGCCTGCATGG - Intergenic
1165120780 19:33557111-33557133 GAGGTGGGCTGGGGGTTGTGGGG - Intergenic
1165136832 19:33674832-33674854 GAGCTGGGGTGAAGGTTGCCAGG + Intronic
1165255907 19:34577152-34577174 GAGGTGGGGAGGTATTTGGGTGG + Intergenic
1165266651 19:34667146-34667168 GAGGTGGGGAAGTGTTTGGGTGG - Intronic
1165286266 19:34844863-34844885 GAGGAGGGGAGGAAGGTGCCAGG - Intergenic
1165364972 19:35359755-35359777 GAGCTGCTGAGGAGGTTGTGTGG + Exonic
1165366791 19:35372224-35372246 GAGCTGCTGAGGAGGTTGTGTGG + Exonic
1165617923 19:37218377-37218399 GTGGTGGGGAGGCGGGCGCGAGG + Intronic
1165784449 19:38453009-38453031 GAGGAGGTGAGGACGTGGCGAGG + Exonic
1166066958 19:40365828-40365850 GAGGGTGGGAGGAGGGGGCGGGG - Exonic
1166119087 19:40674262-40674284 GAGGTGGGAAGAAGGCTGGGAGG - Intronic
1166200373 19:41233726-41233748 GGGGAGGGGAGGAGGATGGGAGG - Intronic
1166691067 19:44821345-44821367 GGGGTGGGGCGGAGGTAGGGCGG - Exonic
1166856030 19:45783014-45783036 GAGGTGGGGAAGGGGTGGTGAGG + Exonic
1166862678 19:45819018-45819040 CAGGTGGGGAGGAGGCTGAATGG + Intronic
1167197461 19:48040494-48040516 GGGGTGGAGAGGAGGATGAGAGG - Intronic
1167234558 19:48306091-48306113 GAGGTGGGGAACTGGTGGCGGGG + Intronic
1167236919 19:48320889-48320911 GAGGGGCGGAGAAGGATGCGAGG + Intronic
1167270586 19:48503561-48503583 GAGGCTGGGAGGAGGCTGTGGGG - Intronic
1167341821 19:48921050-48921072 GAGGTGTAGAGGAGGCTGGGAGG - Intronic
1167396344 19:49231958-49231980 GAAGTGGGCAGGAGGATGCAGGG + Intergenic
1167577864 19:50326383-50326405 GAGGTGGGGAAGAGGAGGTGCGG - Intronic
1167849822 19:52192807-52192829 GAGGTGTGGGGGAAGTTGTGTGG + Intronic
1168289009 19:55347903-55347925 GCGGTGGGGGGAAGGTTGGGGGG + Exonic
1168337288 19:55603786-55603808 GGGGTGGGGCTGAGATTGCGGGG + Intergenic
1168524225 19:57075944-57075966 GAGATGGGGAGGAGGCTGAGAGG - Intergenic
1168718085 19:58540568-58540590 GAGGTGGGAAGCAGGGTGTGTGG - Intergenic
925275311 2:2644549-2644571 GAGGAGGGGAAGAGCTTGTGTGG - Intergenic
925395916 2:3533687-3533709 TACGTGGAGAGGAGATTGCGGGG - Intronic
925830555 2:7890014-7890036 GGGGTGGAGGGGAGGTTGCAAGG - Intergenic
925831553 2:7900843-7900865 GAGCTGTGGAGGAGCTTGCCTGG - Intergenic
926056520 2:9777136-9777158 TAGGAGAGGAGGAGGTAGCGTGG - Intergenic
926645855 2:15289183-15289205 GAGGTGGGTAGGTGGGTGGGTGG - Intronic
926920743 2:17937436-17937458 GAGGTGGGGAGGAAGGGGAGGGG - Intronic
927132458 2:20072094-20072116 GAGAAGGGGAGGAGGCTGCTAGG - Intergenic
927467676 2:23349606-23349628 GAGCTGGGGAGAAGGAAGCGGGG - Intergenic
927516548 2:23675000-23675022 GAGGTGGAGAGGACTTTGTGTGG - Intronic
927650973 2:24913543-24913565 GAGGTTGAGAGGAGGTAGTGGGG - Intronic
928212015 2:29330378-29330400 GAGGTGGGGAGGAAGGTGTGAGG - Intronic
928308838 2:30193487-30193509 GAGGTGGGGAGGAGGGACCTAGG - Intergenic
928338268 2:30417600-30417622 GAGCTGGGGATGAGGATGGGAGG + Intergenic
928372432 2:30750312-30750334 GAGGGTGGGAGGAGGGAGCGGGG + Intronic
929188765 2:39120897-39120919 GAGCTGGGGCGGAGGTCTCGCGG + Intronic
929564708 2:42977074-42977096 GGGGTGGGTGGGAGGTTGTGTGG + Intergenic
929594773 2:43169291-43169313 GTGGTGGGAGGGAGGTTTCGGGG + Intergenic
929740916 2:44598749-44598771 TGGGTGGGGAGGTGGTTGTGAGG + Intronic
930245979 2:48983812-48983834 GAGCAGGGGAGGAGGTTCTGGGG + Intronic
930711303 2:54553315-54553337 GAGGTGGGCAAGAGGTTCCTAGG + Intronic
931211688 2:60203033-60203055 GTGGTGGGGAGGGGGGAGCGGGG + Intergenic
931653888 2:64492322-64492344 GGGGTGGGGATGGGGTTGGGGGG + Intergenic
932133941 2:69212212-69212234 GAGGGGAGGAGGAGGATGGGAGG + Intronic
932495499 2:72143943-72143965 GAGGTGGGGGAGGGATTGCGCGG + Intronic
932625929 2:73295881-73295903 GAGGAGGGGAGGAGTTTGACTGG + Intergenic
934514487 2:94977712-94977734 CAGGTTGGGAAGAGGCTGCGTGG - Intergenic
934661447 2:96145584-96145606 GGGGCGGGGGGGAGGTTGAGGGG + Intergenic
934983153 2:98864397-98864419 GAGGTGGGGAGAGGGATGCTGGG + Intronic
934985054 2:98879053-98879075 GAGGAAGGGAGCAGGTTGCCAGG - Intronic
936153753 2:110035504-110035526 GAGGTGGGGAGGAGGAGGGAGGG - Intergenic
936190932 2:110335911-110335933 GAGGTGGGGAGGAGGAGGGAGGG + Intergenic
936528962 2:113261900-113261922 CGGGTGGGGCGGAGGTTGCAGGG - Intronic
937086519 2:119175341-119175363 GAGTAGGTGAGGAGGTTTCGAGG + Intergenic
937177018 2:119948332-119948354 GAGATGGGGAGGTGGTAGGGAGG + Intronic
937307467 2:120881332-120881354 CAGGTGGGGAGGAGGATGGGTGG + Intronic
937450780 2:122000686-122000708 GAGCTGGGGAGGCGGTTGCTGGG + Intergenic
938143276 2:128813235-128813257 GAGGAGGGGAGGAAGTTGGGAGG - Intergenic
938158257 2:128959523-128959545 GAGATGGGGAGGAGGAGGAGAGG - Intergenic
938304290 2:130240719-130240741 GAGTTGGGAAGGAGTTTGCTGGG - Intergenic
938426082 2:131189250-131189272 GATGTGGGCAGGAGTTTGGGGGG + Intronic
938789010 2:134660129-134660151 GAGGTGGGGAGGTAGGTGGGGGG + Intronic
939369716 2:141283428-141283450 GAGGTGGGGAGGTGGTGAGGTGG + Intronic
940416844 2:153432716-153432738 GGGGTGGGGAGGTGGTTGGGGGG + Intergenic
941721486 2:168817399-168817421 GGGGTGAGGAGGAGGTTAAGTGG + Intronic
942043543 2:172086102-172086124 GAGGTGGGGTGGGGGTGGGGAGG + Intronic
942228690 2:173839409-173839431 GATGTGGTGAGGAGGCTGGGGGG - Intergenic
942502431 2:176605718-176605740 GGGGTGGGGGGGAGGGTGGGCGG - Intergenic
942560479 2:177213184-177213206 GCGGTTGGGAGGAGGTGGTGGGG + Intronic
942712170 2:178848770-178848792 GTGGTGGGGTGGAGGTGGGGAGG + Intronic
942763668 2:179429118-179429140 GAGTAGGCGAGCAGGTTGCGTGG + Intergenic
943222797 2:185132598-185132620 GAGGTGTGGAGGAAGAGGCGCGG + Intergenic
943649473 2:190441474-190441496 GAGGAGGGGCGGGGGTTGGGGGG + Intronic
943947904 2:194090763-194090785 GAGGTGTGGAGGGAGATGCGTGG - Intergenic
945196310 2:207240532-207240554 GAGGTTGGGAGGAGGGAGAGAGG + Intergenic
945306447 2:208263734-208263756 GGGGTGGGGTGGAGGTCGGGGGG + Intronic
947039770 2:225903582-225903604 GAGGTGGGGTGGGGATTGTGTGG + Intergenic
947156083 2:227164285-227164307 GCGGTGGGGAGGTGGCTGCGCGG - Intergenic
948125460 2:235561634-235561656 TAGCTGGGGAGGATGTTGAGAGG + Intronic
948165583 2:235859383-235859405 GGGGGGGGGGGGAGGTTGTGGGG - Intronic
948266359 2:236637931-236637953 GAGGAGGGAAGGAGGTGGAGAGG - Intergenic
948609334 2:239156864-239156886 GAGGTGGGGCTGAGGTTTCAAGG - Intronic
1168760773 20:348072-348094 GAGGTGTGGAGGGGGCTTCGGGG - Intronic
1169131089 20:3166721-3166743 GAGGTGGCCAGGAGCTTGGGTGG + Exonic
1170041793 20:12046574-12046596 GAGTTGGGGAGAAGGTTTCCAGG + Intergenic
1170210748 20:13844171-13844193 GAGGATGGGAGGTGGTTGAGAGG + Intergenic
1170871377 20:20209803-20209825 CAGGCGGGGAGGAGGCTGGGAGG + Intronic
1171009871 20:21503395-21503417 GAGGTGAGCAGGAGGGTGCTGGG - Intergenic
1171393333 20:24815361-24815383 GAGGTGGGGAGGAAGCGGCTGGG + Intergenic
1171811746 20:29750295-29750317 GGGGTGGGGTGGGGGTTGGGGGG - Intergenic
1171823371 20:29874932-29874954 GGGGTGGGGTGGAGGGTGCTTGG - Intergenic
1171896726 20:30815376-30815398 GGGGTGGGGTGGAGGGTGCTTGG + Intergenic
1172047589 20:32091603-32091625 GAAATGGGGATGAGGTTGCCAGG - Intronic
1172180990 20:33003304-33003326 GAGGTAGGGGGGTGGTTACGAGG + Intronic
1172795646 20:37535355-37535377 GAAGTGGGGAGGTGGTGGGGAGG + Intergenic
1173661568 20:44737886-44737908 GAGGTGGGGGGAAGGTTCCATGG + Intergenic
1173672815 20:44810081-44810103 GGGGTGGGGAGGAGGGCGCACGG + Intronic
1173866548 20:46316235-46316257 GAGGTGGGGAGGGGGTGGGAGGG - Intergenic
1174031523 20:47632273-47632295 GGGGTGGGGATGAGGTTTGGAGG + Intronic
1174063619 20:47849365-47849387 GGGGTGAGGAGGAGGTGGGGAGG + Intergenic
1174327406 20:49790370-49790392 GAGGTGGAGAGGAGGCAGCCAGG - Intergenic
1174390230 20:50214416-50214438 GAGGTGGGGAGGTGGTGGGCAGG + Intergenic
1174611253 20:51800716-51800738 GGGGTGGGGTGGGGGTTGAGGGG - Intronic
1175057767 20:56213832-56213854 GAGTTGGGGAGGAGGCAGCATGG - Intergenic
1175186064 20:57180311-57180333 GGAGTGGGGAGGAGGCTGTGGGG - Intronic
1175222536 20:57425658-57425680 GGGGAGGGGAGGAAGTTGCCAGG - Intergenic
1175491667 20:59384342-59384364 GAGGGGGGAAAGAGGTGGCGGGG + Intergenic
1175627483 20:60501107-60501129 GAGGATGGGATGAGGTTACGGGG + Intergenic
1175916510 20:62428433-62428455 GAGGCGGGGAGGAGGGAGTGGGG - Intergenic
1176048188 20:63103290-63103312 GAAGTGGGGAGGAGGGAGCGGGG + Intergenic
1176048199 20:63103318-63103340 GGAGTGGGGAGGAGGGAGCGGGG + Intergenic
1176048211 20:63103349-63103371 GGAGTGGGGAGGAGGGAGCGGGG + Intergenic
1176048228 20:63103391-63103413 GGAGTGGGGAGGAGGGAGCGGGG + Intergenic
1176048240 20:63103422-63103444 GGAGTGGGGAGGAGGGAGCGGGG + Intergenic
1176052975 20:63130298-63130320 GAGGAGGGGAGGAGGGCGAGTGG - Intergenic
1176305626 21:5121662-5121684 GAGGGAGGGAGGAGGGTGCGTGG - Intronic
1177162519 21:17563422-17563444 GAGATGGGGAGGATGTTGGGGGG + Intronic
1177458022 21:21369098-21369120 GTGGTGGTGAGGAGATTGGGGGG - Intronic
1178082415 21:29078774-29078796 GGAGTGGGGATGAGGTTGAGGGG + Intronic
1178258798 21:31079843-31079865 GGGGTGGGGAGGAGGTAGTTGGG - Intergenic
1178259818 21:31088574-31088596 GAGGTGTGGAGGAAGAGGCGCGG - Intergenic
1178262869 21:31116265-31116287 GAGGTGTTGAGCAGGTTGGGGGG - Intergenic
1178723377 21:35029763-35029785 GAAGTGGTGAGGAGGGTGCCAGG - Intronic
1178822087 21:35984474-35984496 GGGGTGGGGAGGAGGAAGCAAGG + Intronic
1178824565 21:36004833-36004855 GAGGCGGGGGGGAGGAGGCGGGG + Intergenic
1179491031 21:41741739-41741761 GCCGTGGAGAGGAGGGTGCGGGG - Exonic
1179585187 21:42370163-42370185 GAGGGAGGGAGGAGTTTGGGAGG + Intergenic
1179714342 21:43279980-43280002 GAGGTGAGGTGGAGGTGGAGGGG + Intergenic
1179714372 21:43280061-43280083 GAGGGGAGGAGGAGGTGGAGGGG + Intergenic
1179714384 21:43280089-43280111 GAGGTGGAGGGGAGGTGGAGGGG + Intergenic
1179714407 21:43280134-43280156 GAGGTGGAGGGGAGGTGGAGGGG + Intergenic
1179714455 21:43280237-43280259 GAGGTGGAGGGGAGGTGGAGGGG + Intergenic
1179714681 21:43280755-43280777 GAGGGGAGGTGGAGGTGGCGGGG + Intergenic
1179851431 21:44140369-44140391 GAGGGAGGGAGGAGGGTGCGTGG + Intronic
1180041650 21:45283274-45283296 GTGGTGGGGAGGAGTGGGCGGGG + Intronic
1180059878 21:45379326-45379348 GGGCTGGGGAGGAGGTTCCGAGG - Intergenic
1180317142 22:11285174-11285196 GAGGTGAGGTGGAGGGTGCTTGG + Intergenic
1180467255 22:15623403-15623425 GATGTGGGCAGGAGTTTGGGGGG + Intergenic
1180762339 22:18219988-18220010 GAGGTGGGGGGGCGGTTTCGGGG + Intergenic
1180773329 22:18404620-18404642 GAGGTGGGGGGGCGGTTTCGGGG - Intergenic
1180781547 22:18522947-18522969 GAGGTGGGGGAGAGGTGGGGCGG - Intergenic
1180804682 22:18654169-18654191 GAGGTGGGGGGGCGGTTTCGGGG - Intergenic
1180806066 22:18715241-18715263 GAGGTGGGGGGGCGGTTTCGGGG + Intergenic
1181117780 22:20644160-20644182 GAAGTGGGGAGGAGGCTTCCAGG + Intergenic
1181192425 22:21151553-21151575 GAGGTGGGGGGGCGGTTTCGGGG - Intergenic
1181217014 22:21341022-21341044 GAGGTGGGGGGGCGGTTTCGGGG + Intergenic
1181238431 22:21462290-21462312 GAGGTGGGGGAGAGGTGGGGCGG - Intergenic
1181359485 22:22323578-22323600 GAGGTGAGGAGCAGTTTGCAAGG - Intergenic
1181487214 22:23238872-23238894 GGGGTGGGGGGCAGGTGGCGGGG + Intronic
1181568303 22:23752646-23752668 GGGGTGGGGAGCAGTGTGCGGGG - Intergenic
1182567694 22:31212371-31212393 GAAATGGGGAGGAGGAGGCGGGG - Intronic
1183108352 22:35630333-35630355 GAGGGGGGGAGGAGGAGGAGGGG + Intronic
1183108358 22:35630347-35630369 GAGGAGGGGAGGAGGAGGGGAGG + Intronic
1183359417 22:37375753-37375775 GCGGTGGGGAGCAGGCTGTGGGG - Exonic
1183380582 22:37488745-37488767 GCGGTGGGGAGGATGTGGCTGGG + Intergenic
1183420673 22:37709665-37709687 GAGGTGGGGAGGAATTGGGGGGG + Intronic
1183590592 22:38777302-38777324 GAGGTGGGGAGCAGGCGCCGAGG - Intronic
1183627154 22:39011429-39011451 CAGATAGGGAGGAGGCTGCGTGG - Intergenic
1184018102 22:41800846-41800868 GTGGTGGGGAGGGAGTTTCGTGG + Intronic
1184098728 22:42330375-42330397 GAGGTGGGGGGGAAGGAGCGAGG - Intronic
1184594105 22:45503670-45503692 GAGGCAGGGAGGAGGTGGCCAGG - Intronic
1185111874 22:48904882-48904904 GAGAGGGTGAGGAGGATGCGGGG - Intergenic
1185163095 22:49241338-49241360 GGGGTGGGGACGGAGTTGCGAGG - Intergenic
1203235159 22_KI270731v1_random:145602-145624 GAGGTGGGGGGGCGGTTTCGGGG - Intergenic
949879712 3:8651818-8651840 GAGGAGGGGAGGAGCTGGCATGG - Intronic
950097800 3:10340121-10340143 GAGATAGGGAGGAGCTTGCCTGG + Intronic
950138985 3:10602115-10602137 GAAGTGGGGAGGGGGCTCCGAGG - Intronic
950146835 3:10656157-10656179 AAGGTGGTGAGGAAGTTGCTGGG + Intronic
950177931 3:10888951-10888973 GGAGTGGGGTGGAGGTTGGGTGG + Intronic
950339947 3:12234285-12234307 GAGGTGGTGATGTGATTGCGGGG - Intergenic
950395290 3:12729390-12729412 GGGGTGAGGAGGAGGTTATGTGG - Intergenic
950655127 3:14431793-14431815 GAGGTGGGGCGGAGGTAGGAAGG + Intronic
950765913 3:15272939-15272961 GAGGTGGGGCAGGGGTTGGGGGG - Intronic
951293207 3:20899907-20899929 GGGATGGGGAGGAGATTGAGGGG - Intergenic
951540491 3:23777470-23777492 GAGCTGGGGAGGATGGTGCTGGG - Intergenic
951620229 3:24593600-24593622 GAGGTGGGGAGGAGGGGGGAGGG - Intergenic
951846617 3:27091367-27091389 GAGGTGGTGAGGAGGATGATGGG - Intergenic
952223207 3:31345916-31345938 GAGATGGGGAGCAGGATGAGAGG + Intergenic
952860907 3:37811564-37811586 GGGGAGGGGAGGAGGGTGAGAGG - Intronic
952932823 3:38373312-38373334 GGGGTGGGGGTGAGGTTGAGGGG - Intronic
953194338 3:40718178-40718200 GGGGTGGGGAGGAGATGGGGAGG + Intergenic
953397139 3:42582159-42582181 GAGGTGGGAAGAAAGTTGGGAGG - Intronic
953797608 3:45997440-45997462 GAGGTGTGGAGGAAGGGGCGTGG + Intergenic
954378271 3:50206009-50206031 CAGGTGGGGAGGAGCTCGCACGG - Intronic
954434575 3:50489426-50489448 CAGCTGGGGAGGGGGTTGTGGGG - Intronic
954796215 3:53162254-53162276 GATGAGGGGAGGAGGTCGGGGGG + Intronic
954959777 3:54553993-54554015 GAGGTGGGGAGGTCGTGGCAAGG - Intronic
955081362 3:55660465-55660487 GGGGTGGGGCGGGGGTGGCGTGG + Intronic
955235477 3:57135285-57135307 AAGGTGGGCAGGAGGCTGGGAGG + Intronic
955892067 3:63660718-63660740 GAGGTGGGATGGAGGTAGGGAGG + Intronic
956878643 3:73488858-73488880 GAGATGGGGAGGAGGGGGCCAGG - Intronic
957386410 3:79502246-79502268 GAGGTGTGGAGGGAGATGCGCGG + Intronic
957630905 3:82715319-82715341 GAGGTGTGGAGGAAGAGGCGCGG + Intergenic
958141727 3:89570925-89570947 GAGGTGGGGGGGGGGGGGCGGGG + Intergenic
959539731 3:107524787-107524809 GAGGTGGGGTGGAGGTGGGGGGG + Intronic
959629273 3:108490168-108490190 GAGGTGGAGAGAAGGTGGGGAGG + Intronic
960450264 3:117798425-117798447 GAGGTGGGGTAGGGGTTGGGAGG - Intergenic
960525437 3:118704834-118704856 GAGGTGGGGAGGGGGGAGGGAGG - Intergenic
960692668 3:120363191-120363213 GTGGTGGGGAGGAGGGCGGGGGG + Intergenic
961404528 3:126668769-126668791 GAGGTGGGGAGGAGCTGGGAGGG + Intergenic
961527996 3:127519814-127519836 TTGGTGGGGAGCAGGTGGCGGGG + Intergenic
961821459 3:129577626-129577648 GAGGTGGGGAGGGGGGTGGCTGG + Intronic
962070999 3:132034074-132034096 GTGTGGGGGAGGAGGTTGAGAGG + Intronic
962347185 3:134626631-134626653 GATGTGGGGAGAAGGTGGGGAGG + Intronic
962916211 3:139906156-139906178 GAAGTGGATAGGAGGTTGGGCGG - Intergenic
962960604 3:140308034-140308056 GGGGTGGGGAGGAGGTGCTGTGG - Intronic
963436365 3:145272656-145272678 GAGGTGGGGAGGGGGGAGGGGGG - Intergenic
965226520 3:165999017-165999039 GAGGTGGGGAAGAGTATGCACGG - Intergenic
965390324 3:168095878-168095900 AAGTTGGGCAGGAGGTGGCGGGG - Exonic
966372453 3:179263379-179263401 GAGGTGGGGAGGGAGAGGCGCGG - Intronic
966854904 3:184187032-184187054 GGGGTGGGGAGGAGGTTGGAGGG + Intronic
966957242 3:184895600-184895622 GAGGGGGGGAGGAGGAGGGGGGG - Intronic
967265786 3:187691154-187691176 GAGGTGGGCAGGAGGATGGAGGG - Intergenic
967877152 3:194275356-194275378 GAGGTGGGAATGAGCTTGCTTGG + Intergenic
968383023 4:111222-111244 GAAGTGGGGAGGGGGTTTCCAGG - Intergenic
968472144 4:787050-787072 GGGGTGGGCAGGATGCTGCGTGG + Intronic
968482062 4:837667-837689 CAGGTGGGGAGGAGGTGGTCGGG - Intergenic
968564545 4:1304082-1304104 GACAGGGGGAGGAGGGTGCGTGG - Intronic
968698016 4:2042173-2042195 GAGGTGGGGAGGGGGCTCCCGGG + Intronic
968883029 4:3310780-3310802 GAGGTGGGCAGGCGCCTGCGGGG + Intronic
968886889 4:3339728-3339750 GAGGTGGGCGGGCGGTTGCTGGG + Intronic
968975974 4:3822235-3822257 GGGGCGTGTAGGAGGTTGCGGGG - Intergenic
969277438 4:6146224-6146246 GGGGCTGGGGGGAGGTTGCGGGG + Intronic
969409426 4:7018414-7018436 GCGGTGGGGAGCAGGTTTGGTGG - Intronic
969424353 4:7115580-7115602 GAGGTGAGGAGGAGGTGAGGTGG + Intergenic
969424359 4:7115602-7115624 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424362 4:7115613-7115635 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424364 4:7115624-7115646 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424370 4:7115646-7115668 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424373 4:7115657-7115679 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424375 4:7115668-7115690 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424381 4:7115690-7115712 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424384 4:7115701-7115723 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969424386 4:7115712-7115734 GAGGTGAGGAGGAGGTGATGTGG + Intergenic
969424392 4:7115734-7115756 GAGGTGAGGAGGAGGTGAGGAGG + Intergenic
969466760 4:7361896-7361918 GCGGTGGGGGGGAGGACGCGGGG + Intronic
969516604 4:7651727-7651749 TGGGTTGGGAGGAGGTTGCTAGG - Intronic
969870100 4:10099162-10099184 GAGGGGGGGAGGCGGTGGTGGGG + Intronic
970319279 4:14859922-14859944 GAGGTGGGGAGGAGATGAAGGGG + Intergenic
970967455 4:21944974-21944996 GAGGCAGGGAGGGGGTTGTGGGG - Intronic
971043384 4:22778951-22778973 GAGGTGTGGAGGAAGAGGCGCGG - Intergenic
971784648 4:31084761-31084783 GAGATGGGGAGGAGGGGGAGGGG + Intronic
971847389 4:31937020-31937042 CAGGTGGGGAGGAGATTGGGAGG + Intergenic
972187996 4:36555519-36555541 GAAGTGGGGAGGGGGTTTCCAGG - Intergenic
973613730 4:52659470-52659492 GAGCTGGGAAGGAGGCGGCGCGG - Intergenic
973774085 4:54229937-54229959 GAGGTGGGGAGAGGGGAGCGTGG + Intronic
974716163 4:65670530-65670552 GAGGAGGGAAGGAGGGTGGGAGG - Intergenic
975141414 4:70922445-70922467 GAGGTGGGGAGGGGGCTTGGGGG + Intronic
976475271 4:85475645-85475667 GGGGCGGGGAGGGGGCTGCGGGG + Intronic
976475283 4:85475666-85475688 GGGGCGGGGAGGGGGCTGCGGGG + Intronic
976475295 4:85475687-85475709 GGGGCGGGGAGGGGGCTGCGGGG + Intronic
976475307 4:85475708-85475730 GGGGCGGGGAGGGGGCTGCGGGG + Intronic
976630959 4:87235892-87235914 TCGGTGGGGAGGAGGGTGCGGGG + Intronic
977437254 4:97014152-97014174 GAACTGGGGAGGAGGTGGCCAGG - Intergenic
977997984 4:103517668-103517690 GAGGAGGGAAGGAGGTTGGGGGG - Intergenic
980113977 4:128661706-128661728 GGAGTGGGGAGGAGGTAACGAGG - Intergenic
980328420 4:131379357-131379379 GAGGTGTGGAGGAGGAGGCGCGG + Intergenic
980824144 4:138053271-138053293 GAGGTGTGGAGGAAGAAGCGTGG - Intergenic
981025075 4:140069552-140069574 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
981319859 4:143379105-143379127 GAGGTGGGGTAGGGGTTGCTGGG + Intronic
981513960 4:145587376-145587398 GTGGTGGGGAGGAGCTAGTGGGG + Intergenic
983077477 4:163343868-163343890 GCGGTGGGGAAGAGGGGGCGGGG - Intronic
983110373 4:163742375-163742397 GAGGAAGGAAGGAGGTAGCGAGG - Intronic
983761233 4:171408980-171409002 GAAGTGGGGAGGAGGTTTCCAGG - Intergenic
983939562 4:173525610-173525632 GAAGGGGGGAGGAGGCTGGGAGG - Intronic
985155455 4:186982997-186983019 AGGGTGGGGAGGAGGGTGCAGGG + Intergenic
985252981 4:188042024-188042046 GCGGTGGAGAGGAGGTCGAGAGG + Intergenic
985269261 4:188178968-188178990 GAGGTGTGGAGGAAGAGGCGAGG + Intergenic
985445277 4:190018275-190018297 GGGGTGGGGTGGAGGGTGCTTGG - Intergenic
985843476 5:2327055-2327077 GAGCTGGGGTGGAGGTGGGGTGG + Intergenic
985880717 5:2636910-2636932 GAGGTGGGGAGAAGGTGGGGTGG + Intergenic
985892559 5:2726949-2726971 GAGGTAGGCAGGAGGCTGCCGGG - Intergenic
985922840 5:2993017-2993039 GAGGTGGAGAGGGGGTTGTCTGG + Intergenic
985986063 5:3517456-3517478 GACGGGGGGAGGGGGTGGCGAGG - Intergenic
985988775 5:3538481-3538503 GAGGTGGGGATGAGGATGCAGGG - Intergenic
986399737 5:7369167-7369189 GTGGTGGGGAGGAGGAAGAGGGG + Intergenic
986606612 5:9529292-9529314 CAGCTGGGGAGGAGGCTGTGGGG - Intronic
987212257 5:15694765-15694787 GAGCTGGGGAGGAGGTTGAGTGG + Intronic
988568578 5:32341715-32341737 GCGGGGGGGCGGAGGTTGCAGGG + Intergenic
989777348 5:45225623-45225645 GAGGTGTGGAGGAAGAGGCGCGG + Intergenic
990639508 5:57765681-57765703 GAGGTGAGGTTGAGGTTGCCAGG - Intergenic
990866928 5:60390149-60390171 GAGGAAGGGAGGAAGTTGCATGG - Intronic
991422485 5:66455375-66455397 GAGGTGGGGAGGAAAGTGGGAGG - Intergenic
991472737 5:66986161-66986183 GAAGAGAGGAGGAGGTAGCGAGG + Intronic
992515041 5:77482902-77482924 GAGTGGGGGTGGAGGTTCCGGGG - Intronic
992828137 5:80569701-80569723 GGGGTGTCGAGGAGGATGCGGGG - Intronic
993481187 5:88426320-88426342 GAGGTGGGGAGAAGGGAGGGAGG + Intergenic
993625456 5:90219336-90219358 GAGGTGGGGAAGAGGAGGGGGGG + Intergenic
993625460 5:90219350-90219372 GAGGGGGGGAGGAGGAGGAGCGG + Intergenic
994141005 5:96341326-96341348 GGGGTGGGGTGGAGGGTGGGGGG - Intergenic
995001697 5:107139523-107139545 GACTTGGGGAGGAGTTTGGGAGG - Intergenic
995694068 5:114860039-114860061 GAGGTGGGGAGAAGGGAGAGTGG + Intergenic
996988909 5:129604098-129604120 TCGGTGGGGAGGAGGTGGGGAGG + Intronic
997302938 5:132819717-132819739 GAGCTGGGGAGGCGGCCGCGGGG + Intergenic
998081343 5:139277380-139277402 GAAATGGGGAGGATGTTGGGGGG + Intronic
998136258 5:139676193-139676215 GAGGTGGGGAGGAGGGCTTGGGG - Intronic
998136299 5:139676305-139676327 GAGGTGGGGAGGAGGGCTTGGGG - Intronic
998136402 5:139676569-139676591 GAGGTGGGGAGGAGATGGGGAGG - Intronic
998373097 5:141673548-141673570 GAGGCTGGGAGGTGGTTGCGCGG - Intronic
998399231 5:141839503-141839525 GAGGTGGGGAGGAGCTGGAGAGG + Intergenic
998582834 5:143398722-143398744 GAATTGGGGATGAGGTTACGGGG + Intronic
999342276 5:150782449-150782471 GAGGTGGGGAGGAGGGACCAGGG - Intronic
1002381365 5:178832057-178832079 GAGGTGGGGGGGTGGTTGATTGG - Intergenic
1003028124 6:2576686-2576708 GCGGTGGGGTGGGGGTTGGGGGG + Intergenic
1003046729 6:2740250-2740272 GAGGTGGGGGAGAGCATGCGCGG - Intronic
1003065784 6:2902911-2902933 CAGGTGGGGAGGAGGCTGCAGGG + Intronic
1003086387 6:3064328-3064350 CAGGTGGGGAGGAGGCTGCAGGG - Intronic
1003165056 6:3670317-3670339 GGGGTGGGGAGGGGGTGGGGGGG + Intergenic
1003189017 6:3856726-3856748 GAGGAGGGCAGGAGGGAGCGTGG - Intergenic
1003537041 6:6984512-6984534 GAGGTCGGGAGGTGGGTGGGTGG + Intergenic
1003556773 6:7146777-7146799 TTGGTGGGGAGGAGGTGGTGGGG + Intronic
1004045392 6:12018257-12018279 GAGGTGTGGAGGAAGAAGCGCGG - Intronic
1004080636 6:12389183-12389205 GAGGAGGAGAGGAGGCTGGGAGG - Intergenic
1004193728 6:13486601-13486623 GGGGTGGGACGGAGGATGCGGGG + Intronic
1004450057 6:15736915-15736937 GAGGTGGGGAGGAGGCAGGGGGG - Intergenic
1006170118 6:32087607-32087629 GCGGTGGGGCGGGGGTGGCGGGG + Intronic
1006368099 6:33627865-33627887 GAAGTGGAGAGGGGGTGGCGCGG + Intronic
1006401392 6:33819685-33819707 ACGATGGGGAGGAGGTTGGGAGG + Intergenic
1006428110 6:33978731-33978753 GCGGTGGGGTGGTGCTTGCGGGG + Intergenic
1006438964 6:34041496-34041518 GGGGAGGGGAGGAGGATGGGAGG - Intronic
1006514765 6:34539613-34539635 GAGGAGGGGAGGCGTTTGGGTGG + Intronic
1006767985 6:36525845-36525867 GGGGAGGGGGGCAGGTTGCGAGG + Intronic
1006824655 6:36925888-36925910 GAGGTGGGGAGTTGGTTAGGTGG - Intronic
1006829785 6:36961822-36961844 GAGTTGGGGAGAGGGTTGGGAGG + Intronic
1006829792 6:36961857-36961879 GAGGTCAGGAGGATGCTGCGGGG - Intronic
1007840420 6:44711715-44711737 GATGTGTGGAGTAGGATGCGTGG - Intergenic
1007912222 6:45527402-45527424 GGGGTAGGGAGGAGGTTAGGAGG + Intronic
1008221501 6:48859807-48859829 GAAGTGGTGAGAAGGTTGAGGGG + Intergenic
1008537491 6:52517901-52517923 GGGGGTGGGAGGAGGTGGCGAGG + Intronic
1009804009 6:68578775-68578797 GAGGAGGGGAGGAGGAAGGGCGG + Intergenic
1011410290 6:87059855-87059877 GAGGAGGGGAGGAGGGTAGGTGG + Intergenic
1011499947 6:87976972-87976994 GAGGTGAGGAGGAGGTGAGGTGG - Intergenic
1013288346 6:108699179-108699201 GAGGTGGGCAGGAGGATGCCAGG + Intergenic
1013443784 6:110199812-110199834 GAGGTGGGGTGGAGGGGGCATGG - Intronic
1013467503 6:110430407-110430429 GGGGCGGGGAGGAGGCTGGGAGG + Intronic
1013517668 6:110903292-110903314 AAGGTGGGGAGGATGTTTTGAGG - Intergenic
1014272550 6:119349874-119349896 GAGGCGAGGAGGGGGATGCGCGG + Intergenic
1015134558 6:129852869-129852891 GAGATGGTGAGGAGGTGGCTGGG - Intronic
1015502080 6:133945152-133945174 GGGGTTGGGGGGAGGTTGAGGGG - Intergenic
1016667161 6:146655408-146655430 GAGGTGGGGAGTAGGAGGTGGGG - Intronic
1016758308 6:147710973-147710995 AAGGTGGGGAGGAGGGAGGGAGG + Intronic
1017637453 6:156456376-156456398 GAGGAGGGGAGGAGGGGGAGGGG - Intergenic
1018333036 6:162753252-162753274 GAGGTGGGGTGGGGGTGGAGAGG - Intronic
1018400273 6:163414443-163414465 GAGGCAGGGAGGAGGGGGCGCGG + Intronic
1018711026 6:166498338-166498360 GGGATGGGGAGGAGGCTGCCAGG + Intronic
1019010327 6:168839628-168839650 GAGGTGGGGAGGAAGGGGCGTGG + Intergenic
1019173219 6:170146446-170146468 GAGGTGTGTAGGAGGGTGAGAGG + Intergenic
1019174420 6:170153000-170153022 CCGGTGGGGGGGAGGTTGGGAGG - Intergenic
1019223486 6:170493207-170493229 GAGGTGAGGAGGAGGGGGGGAGG + Intergenic
1019223500 6:170493247-170493269 GAGGAGGGGAGGAGGAGGGGAGG + Intergenic
1019223552 6:170493377-170493399 GAGGAGGGGAGGAGGAGGGGAGG + Intergenic
1019327594 7:445956-445978 GAGGTGGGGAGAAGGGAGAGAGG + Intergenic
1019597346 7:1864261-1864283 GAGGAGGGGAGGCGGCTGCAGGG + Intronic
1020140266 7:5607882-5607904 GACCTGGGGAGGAGGGTGGGAGG + Intergenic
1020235681 7:6353530-6353552 GAGGTGGGAGGGAGGGAGCGAGG + Intergenic
1020592912 7:10166397-10166419 GTGGTGGGGAGGGGGTAGGGGGG - Intergenic
1022001487 7:26230354-26230376 GAGGTGGGTAGGAGGTTGGAAGG - Intergenic
1022427693 7:30284656-30284678 CAGATGGGGAGGAGGTTCCCCGG - Exonic
1022875512 7:34524389-34524411 GCAGTGGGGAGGATGCTGCGGGG - Intergenic
1023035886 7:36131109-36131131 GAGGTGGGGAGGAGTTGCTGAGG + Intergenic
1023226719 7:37977598-37977620 GAGATGGGAAGGAGTTTGCTGGG + Intronic
1024234217 7:47385717-47385739 GAGGGTGGGAAGAGGCTGCGAGG - Intronic
1024342476 7:48281603-48281625 GTGGTGGGAATGAGGTTGGGAGG - Intronic
1024471654 7:49773425-49773447 GAGGTGGGGACGCGGCCGCGCGG + Intergenic
1024579975 7:50793437-50793459 GAGGTCGGGAGGAGGCAGAGAGG - Intronic
1025174006 7:56787665-56787687 GTCGCGGGGAGGAGGTGGCGGGG - Intergenic
1025698095 7:63790290-63790312 GTCGCGGGGAGGAGGTGGCGGGG + Intergenic
1025828755 7:65032401-65032423 GAGGATGGGAGGAGGGTGAGGGG + Intergenic
1025916277 7:65868810-65868832 GAGGATGGGAGGAGGGTGAGGGG + Intergenic
1025945062 7:66099114-66099136 GAGGAGGGGAGGAGGAGGAGAGG + Intronic
1025945111 7:66099275-66099297 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1025945134 7:66099339-66099361 GAGGAGGGGAGGAGGAGGGGAGG + Intronic
1025945139 7:66099350-66099372 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1025945169 7:66099444-66099466 GAGGAGGGGAGGAGGAGGAGAGG + Intronic
1026492067 7:70871821-70871843 GAGGTGGGGGGGAGGGAGGGAGG + Intergenic
1026610866 7:71858736-71858758 GAGGTGGGGAGGGGGCTTCCAGG - Intronic
1027188427 7:75984974-75984996 GTGACGGGGCGGAGGTTGCGGGG - Intronic
1027189576 7:75989076-75989098 GTGGAGGGGTGGAGGTTGAGGGG + Intronic
1027189602 7:75989122-75989144 GTGGAGGGGTGGAGGTTGGGGGG + Intronic
1028121436 7:87059763-87059785 GAGCTGGGGAGCAGGTGGCGCGG + Intergenic
1028567333 7:92246812-92246834 GGGGTGGGGGGGAGGCTGCGAGG - Intronic
1029067978 7:97871808-97871830 GAGGGGAGGAGGAGGGTGAGCGG + Exonic
1029137053 7:98380815-98380837 GGGGTGGGGCGGGGGTTGGGTGG - Intronic
1029232039 7:99078510-99078532 GGGATGGGGAGGAGGGTGCAGGG - Intronic
1029367920 7:100127982-100128004 GAGATGGGGACGAGGATTCGTGG + Exonic
1029448524 7:100627860-100627882 GTGAAGGGGAGTAGGTTGCGGGG - Intronic
1029451435 7:100643441-100643463 GAGGTGGGGAGGGGCTTCAGAGG - Intronic
1029490694 7:100868505-100868527 GCGGTAGGCAGGAGGTGGCGGGG - Exonic
1030065520 7:105656075-105656097 GAGGTGGGCAGGAGGCAGAGAGG - Intronic
1030435184 7:109508941-109508963 GGGGTGGGGTGGAGGTGGTGGGG - Intergenic
1031101583 7:117486875-117486897 GGGGTGGGGGGGAGGGGGCGGGG + Intronic
1032078149 7:128845849-128845871 GAGGGGGAGAGGAGGGTGAGAGG + Intronic
1032284915 7:130532558-130532580 GATGTGAGGAGGAGGGTGGGGGG + Intronic
1033278442 7:139989622-139989644 GAGATGGGGAGGATGCTGTGAGG - Intronic
1033542716 7:142372172-142372194 TAGGTGGGGAGGAGGCTGAGAGG + Intergenic
1034266520 7:149783702-149783724 GAGGAGGGGAGGAGCCTGGGTGG - Intergenic
1034402804 7:150876975-150876997 GTGGTGGGGAGGAGGCGGGGGGG - Intergenic
1034461008 7:151198091-151198113 GAGGTGGGTAGAAGGGTGGGTGG + Intronic
1034461035 7:151198195-151198217 GAGGTGGGTAGGTGGGTGGGTGG + Intronic
1034461046 7:151198243-151198265 GAGGTGGGTAGAAGGGTGGGTGG + Intronic
1034474983 7:151276713-151276735 GAGGAGGGGAGGAAGATGCCAGG + Intronic
1034509139 7:151520010-151520032 GAGGCGGGGAGGGGGGGGCGGGG + Intronic
1035230733 7:157464045-157464067 GGGGTGGGGAAGAGGATGGGAGG - Intergenic
1035280868 7:157777020-157777042 GAGGTAGGGAGGAGGAGGAGAGG - Intronic
1035421156 7:158729794-158729816 CAGGTGTGGAGGTGCTTGCGGGG + Intergenic
1035570271 8:667948-667970 GAGGAGTGGAGGAGGGTCCGTGG - Intronic
1035678630 8:1471531-1471553 GAGGTTAGGAGGAGGCTGGGAGG - Intergenic
1035832617 8:2714013-2714035 GAGGTGGGGACGGGGTTTCCAGG + Intergenic
1036200308 8:6765392-6765414 GGGGTGGGGAGGGTGTTGAGCGG - Intergenic
1036406894 8:8463121-8463143 GAGGTGGACAGCAGGTTGCAGGG - Intergenic
1036441515 8:8785844-8785866 GAGGTGGGGAGGGGGTGGTGGGG - Exonic
1036521270 8:9493911-9493933 AGGGTGGGGAGGAGGGTGCTGGG - Intergenic
1037110537 8:15159734-15159756 GGGGTGGGGGGGAGGGTGGGGGG - Intronic
1037420460 8:18696231-18696253 GAGGTGAGGAGGAGGTGGAAAGG - Intronic
1037674767 8:21043418-21043440 GAGGTCGGGGGGAGGTGGGGTGG - Intergenic
1037675006 8:21043950-21043972 AAGGTGGGGGGGAGGTGGGGTGG - Intergenic
1037675040 8:21044031-21044053 AAGGTGGGGAGGAGGTGGGGTGG - Intergenic
1037811712 8:22090307-22090329 GGGTTGGGGAGGAGGTGGTGGGG - Intronic
1038093005 8:24275324-24275346 TAGGTGGGTAGGGGGTTGGGGGG + Intergenic
1038542614 8:28402222-28402244 GAGGGAGGGAGGAGGTGGGGAGG + Intronic
1038542619 8:28402233-28402255 GAGGTGGGGAGGAGGGAGGGAGG + Intronic
1039195417 8:35025724-35025746 GAGGTGGGGAGGTGGATGAGTGG + Intergenic
1039781714 8:40792701-40792723 GGGGAGGGGAGGAGGTGGGGAGG + Intronic
1040014483 8:42689743-42689765 GGGGTGGGGGGGAGGCTGGGTGG - Intergenic
1040388819 8:46932764-46932786 CAGGTGGGAAGGAGGTGGCGAGG - Intergenic
1040665899 8:49632699-49632721 GAGGTGGGGAGGTGGGGGAGAGG + Intergenic
1041007315 8:53508017-53508039 GTGGTGGGGTGGAGGGTGAGTGG - Intergenic
1041636664 8:60153110-60153132 GAGGGGGGAAGGGGGGTGCGGGG + Intergenic
1044014184 8:87030900-87030922 GAGGGGGGGAGGAGGAGGTGGGG - Intronic
1044548136 8:93482244-93482266 GAGGTGGGGAGGAGGAGACTAGG + Intergenic
1044760065 8:95508562-95508584 GTGGTGGGGAGGAGGCAGGGAGG - Intergenic
1044765229 8:95565112-95565134 GAGGTTGGCAGGAGGTTGTGGGG + Intergenic
1044767975 8:95597180-95597202 GAGGAGGGGAGGAGGGGGAGGGG - Intergenic
1044925858 8:97208265-97208287 GAGGTGGGAAGGAAGTTGGCAGG - Intergenic
1046438692 8:114230469-114230491 GGGGTGGGGAGGAGCCTGGGTGG - Intergenic
1046661242 8:116950106-116950128 GAGGTGTGGAGGGAGTGGCGCGG - Intergenic
1047203587 8:122785780-122785802 GAGGTGGAGAGGGGGATGCAGGG + Intronic
1047212817 8:122853732-122853754 GTGGGTGGGAGGAGGTTGCATGG - Intronic
1047274446 8:123395308-123395330 GGGGTGGGGAGGTGGATGGGAGG + Intronic
1048980238 8:139699411-139699433 GTGGTGGGGCGGGGGTTGGGGGG + Intronic
1049115783 8:140686245-140686267 GAGGGTGGGAGGAGGGTGAGAGG + Intronic
1049230432 8:141478826-141478848 GAGCTGTGGAGGTGGTTGCCTGG + Intergenic
1049438003 8:142596468-142596490 TAGGTGGGGAGAAGGCTGCTAGG + Intergenic
1049468725 8:142765471-142765493 GGGGTGGGGAGGAGGTGGAGGGG + Intronic
1049641800 8:143719278-143719300 GAGGTGGGGGTGGGGTTGCTGGG - Intronic
1049760841 8:144331422-144331444 GAGGTGGGGAGGAGTGTAGGGGG + Exonic
1049814734 8:144592884-144592906 GAGGTGGGGAGGACATTGTGTGG + Intronic
1049831600 8:144704597-144704619 GAGGAGGGGAGCAGGTGGAGGGG + Intergenic
1051525300 9:18036260-18036282 GAGGCAGGGAAGAGGTTGAGAGG + Intergenic
1051726181 9:20089684-20089706 GTGGTGGGCAGGGGGTGGCGGGG - Intergenic
1051818312 9:21135116-21135138 CAGGTGGTGAGGAGGATGAGAGG + Intergenic
1052056280 9:23911153-23911175 GAGGTGGGGAGGGGGCAGAGGGG - Intergenic
1053003331 9:34589755-34589777 GAGGGAGGGAGGAGGATGGGGGG - Intronic
1053123414 9:35561921-35561943 GAGGTGGGTGGGAGGGTGGGAGG - Intronic
1053433537 9:38059723-38059745 GGGGTGGTGTGGAGGTGGCGTGG - Intronic
1053475206 9:38377566-38377588 GAGGTGTGGAGGAAGAGGCGCGG + Intergenic
1054716572 9:68562944-68562966 CACGTGGGGAGGAGGTGGCAGGG - Intergenic
1056259938 9:84838249-84838271 GAGATGGGGAGGAAGTTATGTGG + Intronic
1056771055 9:89478753-89478775 GGGGTGGGGTGGAGGATGAGGGG - Intronic
1057996302 9:99823882-99823904 GAGCGGGGGCGGAGGTTGGGCGG - Intronic
1058065143 9:100540496-100540518 GAGGTGGGGAGGGGGAGGCACGG - Intronic
1058893941 9:109383891-109383913 GAGGTGGGGAGGGGCCTGAGGGG - Intronic
1059269031 9:113060831-113060853 GGGGTGGGGAGGAGGGCGCAGGG - Intergenic
1059270167 9:113066280-113066302 GGGGTGGGGAGGAGGGCGCAGGG - Intergenic
1059271303 9:113071730-113071752 GGGGTGGGGAGGAGGGCGCAGGG - Intergenic
1059272434 9:113077174-113077196 GGGGTGGGGAGGAGGGCGCAGGG - Intergenic
1059273569 9:113082616-113082638 GGGGTGGGGAGGAGGGCGCAGGG - Intergenic
1059274705 9:113088062-113088084 GGGGTGGGGAGGAGGGCGCAGGG - Intergenic
1059366303 9:113789138-113789160 GAGGGTGGGAGGAGGTAGTGAGG - Intergenic
1059380596 9:113920293-113920315 ATGGTGGGGAGGAGCCTGCGGGG + Intronic
1059466331 9:114470978-114471000 GAGGTGGCGGGGAGGTGGGGAGG - Intronic
1059999693 9:119946992-119947014 GGGGTGGGGAGGGGGTGGGGAGG + Intergenic
1060047390 9:120351513-120351535 GATGTGAGGAGGAGGATGAGTGG + Intergenic
1060074597 9:120580066-120580088 GAGCTGGGGTGGAGGGGGCGGGG - Exonic
1060128454 9:121073319-121073341 GAGGTGGGGAAGAATTTGCTTGG - Intergenic
1060488701 9:124065802-124065824 GAGGTAGGGAGGAGGAGGCGGGG + Intergenic
1060513510 9:124251142-124251164 GGGCTGGGGAGGAGGTGGAGAGG - Intergenic
1060513865 9:124253659-124253681 GGGCTGGGGAGGAGGTGGAGAGG + Intergenic
1060877769 9:127095606-127095628 CAAGTGGGGAGGAGGTAGTGAGG - Intronic
1060893486 9:127202887-127202909 GAGGTGGGGAGGCGGCCGCAGGG + Intronic
1060947546 9:127579083-127579105 GAGGTGGGAGGGAGGTGGTGGGG - Intergenic
1060949934 9:127594994-127595016 GAGGGAGGGAGGAGGTTGGCAGG + Intergenic
1061012020 9:127961380-127961402 GAGGTGGGAATGAGGATGCCAGG + Intronic
1061057779 9:128233457-128233479 GAGCTGGGGAGGGGGTTCAGGGG - Intronic
1061137215 9:128741756-128741778 GAGGTGGGGAAAGGGTAGCGTGG + Intronic
1061246145 9:129402117-129402139 GAGGTGGGGAGGAGGGAGGAGGG - Intergenic
1061266067 9:129505722-129505744 GAGGAGGGCAGGGGGTTGGGCGG - Intergenic
1061285408 9:129619979-129620001 GTGGTGGGGTGGTGGGTGCGGGG + Intronic
1061411742 9:130425652-130425674 GAGGAGGGGAGGAGGAGGAGGGG - Intronic
1061483220 9:130907311-130907333 GAGGGAGGGAGGAGGTGGCGTGG - Intronic
1061505861 9:131031551-131031573 GAGCAGGGGAGAAGGTTGCGGGG + Intronic
1061600350 9:131665643-131665665 GAGGTGGGGAGGGGGTTGGTTGG - Intronic
1061874105 9:133535372-133535394 GAGGTGGGGGGCAGGCGGCGGGG + Intronic
1061985061 9:134125843-134125865 GAGGAGGGGATGAGGCTGTGCGG + Intergenic
1062046130 9:134425420-134425442 CAGGTGGGAAGGAGGTTGGACGG - Intronic
1062456475 9:136641742-136641764 GAGCTCGGGAGGAGGCTGCAGGG - Intergenic
1062519286 9:136950956-136950978 GATGAGGGGAGGAGGTGGCCAGG + Intronic
1062714262 9:137998103-137998125 GTGGTGGGGTGGGGGTTGCTGGG + Intronic
1185446290 X:259543-259565 GAGGTGGGGAGTAGTTAGAGAGG + Intergenic
1185581361 X:1213224-1213246 GAGGTGGGGAGGAGGAGGGGAGG - Intergenic
1185581537 X:1213666-1213688 GAGGTGGGGAGGGGGAGGGGAGG - Intergenic
1186130492 X:6460526-6460548 GAGGTGGGGTTGAGGTTTCCAGG + Intergenic
1186306177 X:8261026-8261048 GAAGTGGGAAGGATGTGGCGGGG + Intergenic
1186383829 X:9089359-9089381 GGGGTGGGTAGGGGGTTGGGAGG - Intronic
1186812783 X:13206652-13206674 GATGTGGGGTGGAGGGTGCTGGG + Intergenic
1187601985 X:20841583-20841605 GAGGTGTGGAGGTGGATGGGAGG + Intergenic
1188048290 X:25453238-25453260 GGGGTAGGGAGGTGGTAGCGGGG + Intergenic
1190216164 X:48480803-48480825 GAGATGGGGAGGATGGTGGGAGG + Intronic
1190753423 X:53381119-53381141 GAGGCGGGGAGGGGGTGGCAAGG + Intronic
1190938668 X:55019471-55019493 GAGATGGGGAGGAGGGGGTGTGG + Intronic
1191023254 X:55885847-55885869 GTTGTGGGGTGGGGGTTGCGGGG - Intergenic
1192141504 X:68650461-68650483 GAGGAGGGGAGGAGGAGGAGGGG + Intronic
1192230939 X:69264516-69264538 CAGGTGGGGAGGGGGGTGGGGGG + Intergenic
1193606809 X:83579150-83579172 GAGGTGGGGAGTAGGTGGGCAGG + Intergenic
1193809835 X:86038367-86038389 GAAGTGGGGAGGAGGCTTCTGGG - Intronic
1194185091 X:90765652-90765674 GAGGTGGGGAGGGAGAGGCGTGG + Intergenic
1194211301 X:91072492-91072514 GATGTGGAGAGGACGTTGAGGGG - Intergenic
1195076777 X:101334911-101334933 GGGGTGGGGTGCAGGTTGCTTGG - Intergenic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1195364151 X:104111615-104111637 GAGGGGGTGAGGAGGTAGTGGGG - Intronic
1195570153 X:106391828-106391850 GAGGAGGGGAGGGGGCTGCCTGG - Intergenic
1195858052 X:109351944-109351966 GAAGGAGGGAGGAGGTTGGGAGG - Intergenic
1196860905 X:120026157-120026179 GAGGTGTGGAGGGAGATGCGCGG - Intergenic
1196976707 X:121166159-121166181 AGGGTGGGGAGGAGGTAGCTTGG - Intergenic
1197195927 X:123700529-123700551 GAGGTGGTGAGGGGGTGGGGGGG + Intronic
1197749790 X:129956811-129956833 GGGGTGGGGGGGAGGTGGGGAGG - Intergenic
1198178115 X:134175037-134175059 GGGGAGGGGACGGGGTTGCGGGG - Intergenic
1198421422 X:136473256-136473278 TAGGTGGGAAGGAGGGTGGGAGG + Intergenic
1198518584 X:137430617-137430639 GAGGTGGGAATGGGGTTGGGCGG - Intergenic
1199428873 X:147736172-147736194 GCGGTGGGGGGGTGGTTGGGGGG - Intergenic
1199570137 X:149259129-149259151 GGGGTGGGGAAGAGGTTTCCAGG - Intergenic
1200098024 X:153673292-153673314 GGGGTGCGGGGGAGGGTGCGTGG - Intronic
1200531715 Y:4347763-4347785 GAGGTGGGGAGGGAGAGGCGTGG + Intergenic
1200887123 Y:8281160-8281182 GAAGTGGAGAGAGGGTTGCGGGG - Intergenic
1201075950 Y:10188191-10188213 GGGGTGGGGTGGGGGTTGGGGGG + Intergenic
1201300212 Y:12498655-12498677 GAGGAGGGGAGGAGGAGGGGAGG - Intergenic
1201575906 Y:15461116-15461138 GAGTTGAGGAGGAGGTTAGGAGG - Intergenic