ID: 1163020953

View in Genome Browser
Species Human (GRCh38)
Location 19:14480514-14480536
Sequence GGGGCTCTGCCCTGGTTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163020941_1163020953 18 Left 1163020941 19:14480473-14480495 CCTCCTTGATGCGCTGCGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG 0: 1
1: 0
2: 4
3: 35
4: 397
1163020939_1163020953 19 Left 1163020939 19:14480472-14480494 CCCTCCTTGATGCGCTGCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG 0: 1
1: 0
2: 4
3: 35
4: 397
1163020943_1163020953 15 Left 1163020943 19:14480476-14480498 CCTTGATGCGCTGCGGGGGCGGG 0: 1
1: 1
2: 0
3: 7
4: 91
Right 1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG 0: 1
1: 0
2: 4
3: 35
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163020953 Original CRISPR GGGGCTCTGCCCTGGTTTCC GGG Intronic
900550556 1:3252386-3252408 GGGGATCTTCCCTGGCTTCTTGG + Intronic
900712152 1:4121215-4121237 GAGGCTCAGCCCTGTGTTCCTGG + Intergenic
900973439 1:6004032-6004054 GGGGCTCCTCCCTGCTCTCCGGG - Intronic
901111162 1:6797250-6797272 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
901142557 1:7044431-7044453 GTGGCACTGCCCTGCTTTCCCGG - Intronic
901180178 1:7336341-7336363 AGGGCTTTGCCATGGATTCCTGG + Intronic
901677925 1:10897680-10897702 AGGGCTCTGGCCTGTTTTTCCGG + Intergenic
901921506 1:12540639-12540661 GGGGCACTGTCCTGGGGTCCTGG + Intergenic
902552607 1:17228546-17228568 GGGGCTCTGTCCTGGATTCCTGG + Intronic
903067203 1:20706692-20706714 GGGGTTTTGCCATGTTTTCCAGG - Intronic
903546547 1:24127502-24127524 GGGGTTTTGCCCTGTTTCCCAGG + Intronic
904027614 1:27514289-27514311 GGGGCCCTGCCCAGCTGTCCTGG + Intergenic
904598791 1:31662658-31662680 GGGGGGCGGCGCTGGTTTCCAGG - Exonic
906098184 1:43238374-43238396 GGGGCTCTGCCAAGCTGTCCAGG - Intronic
906524025 1:46484074-46484096 GGGGCTCTTTCCTGGTTTGAAGG + Intergenic
906780231 1:48566785-48566807 TTGGCTCTTCCCTGGTCTCCAGG + Intronic
910804642 1:91178370-91178392 GGGGCTCTTGCCTGGCTTCTGGG + Intergenic
912510398 1:110185765-110185787 GGGGCTCTTTCCAGGATTCCTGG - Intronic
913207117 1:116549369-116549391 GGGGACCTGCCCTGCTCTCCTGG - Intronic
915295979 1:154922302-154922324 GGGGTGCTGCCCTGCTTTCTTGG - Intergenic
915659609 1:157391591-157391613 TGTGTTCTGCCCTGGTTTTCAGG + Intergenic
916078662 1:161218331-161218353 GGGGCTCTAGCCTGGGTTTCCGG + Intronic
918024688 1:180731999-180732021 GGGGCTTTGCCCTGTTGGCCAGG - Intronic
919096500 1:193043528-193043550 TGGGCTTTGCCCTTGGTTCCTGG + Intronic
919944508 1:202309529-202309551 TGGGCTCTGCCCTGATTCCAGGG - Intronic
920446483 1:206022328-206022350 GGAGCTTTCCCCTGGCTTCCTGG - Intronic
921193358 1:212729345-212729367 GGGTCTGTGCCTTGGTTTACAGG + Intronic
921785921 1:219229521-219229543 GGGATTTTGCCCTGGTTTACCGG - Intergenic
922189353 1:223303578-223303600 GGGGCTCTTTCCTTGTTCCCAGG + Intronic
923419750 1:233800831-233800853 AGGGCTCTGTCTTGATTTCCTGG + Intergenic
923525338 1:234768335-234768357 GGGACTCTGCCCCGGTTAACTGG + Intergenic
1062799268 10:367841-367863 TGTCCTCTGCCCTGGGTTCCGGG - Intronic
1063524460 10:6772077-6772099 AGGGCTCTCCCCTGGCTACCAGG - Intergenic
1064464483 10:15565779-15565801 GGGGTTTTGCCATGGTTGCCAGG + Intronic
1064643119 10:17434228-17434250 GGGACTCTGCCCTGGTCAGCCGG - Intronic
1065190005 10:23199649-23199671 GGGGGTCTGCCCTTGCTTCTCGG + Intergenic
1066182914 10:32980875-32980897 GGCGCTCTGCGCTGGCGTCCTGG + Intronic
1067058920 10:43067851-43067873 GGGTGTCTGCACTGTTTTCCAGG - Intergenic
1067183283 10:44006273-44006295 GGGGCACTTCCCTGGGTTCTAGG + Intergenic
1068156507 10:53206053-53206075 GGGGCTCTGCCCAGGCACCCAGG - Intergenic
1069717378 10:70529807-70529829 GGAGCTCTGTCCTGGGCTCCAGG - Intronic
1070936548 10:80302590-80302612 GGGGTTCTGCCATGTTGTCCAGG - Intergenic
1072407675 10:95169961-95169983 GGGGGTCTGTCCTGGTCACCGGG - Intergenic
1073137025 10:101225788-101225810 GGGGCTCAGCCCTGTTTTCGGGG + Intergenic
1074044048 10:109820471-109820493 GTTGCTCTGCCCTGGTTCCCTGG + Intergenic
1074118339 10:110474606-110474628 CAGGCCCTGCCCTGGCTTCCAGG - Intergenic
1074489255 10:113924291-113924313 TGGTCTTTGCCCTGGGTTCCTGG + Intergenic
1074607649 10:114989536-114989558 GGGGTTCAGACCTGGATTCCTGG + Intergenic
1075274852 10:121084351-121084373 AGGCTTCTGTCCTGGTTTCCAGG + Intergenic
1075740720 10:124694398-124694420 GGGCCTCTGCCTTGGTCTCTGGG + Intronic
1076037994 10:127216977-127216999 AGGGCTCTGCCCTGATCTCAAGG - Intronic
1077106255 11:843772-843794 GGGGCTCTGGGCTGGTTTGCCGG + Intronic
1077387141 11:2275394-2275416 CTGCCTCTGCCCTGGTCTCCTGG + Intergenic
1077550255 11:3197033-3197055 GGGGCCCTGCCCTGCCATCCAGG - Intergenic
1077614958 11:3667825-3667847 GGGGGTCTGCCCTGGGCTCCCGG - Intronic
1079338992 11:19596595-19596617 AGGCCACTGCCCTGGTGTCCGGG - Intronic
1081979943 11:47259942-47259964 GGGGCTCTGCCCTGGTGAGCAGG - Exonic
1082839935 11:57680687-57680709 GGGGCTCTGACCTGGATGACTGG + Intronic
1083179413 11:60974587-60974609 GGGCCTCTGCCCAGGTGGCCCGG + Intronic
1083685213 11:64371403-64371425 GGGGCTCGGCCCGGGTTGGCTGG - Exonic
1084716438 11:70877272-70877294 AGGGCTCTGCCCAGGCCTCCTGG - Intronic
1084964675 11:72738468-72738490 AGGCCTCTGCCCTGGGTTCAAGG + Intronic
1084965314 11:72741458-72741480 AGGGCTCTGGCCTGGCTCCCTGG + Intronic
1085026266 11:73238361-73238383 GGGTCTCTGCCCTGGGTGGCAGG + Intergenic
1085158883 11:74322786-74322808 GGGGCTCTGCCCAGGCACCCAGG + Intergenic
1086246448 11:84759067-84759089 GGGGCTTTGCCATGTTGTCCAGG + Intronic
1086866134 11:91982348-91982370 TGAGGTCTGCCCTGGTTGCCAGG - Intergenic
1087362532 11:97178623-97178645 TGGTCTCTGCCCTTGGTTCCTGG - Intergenic
1087391099 11:97536577-97536599 GGGGTTTTGCCATGTTTTCCAGG + Intergenic
1088183991 11:107143129-107143151 GGGGCTCTGCCTAAGGTTCCAGG + Intergenic
1088215339 11:107501862-107501884 GGACCTTTGCCCTGGGTTCCTGG + Intergenic
1088932128 11:114363023-114363045 TGGCCTCTGCCCTGGTTTCCTGG + Intergenic
1090030680 11:123203531-123203553 GGGCCTCTCCCCTGACTTCCTGG + Intergenic
1090763055 11:129854002-129854024 GGGCCTCTGCCTTGTTTACCCGG + Intronic
1090922697 11:131220762-131220784 TGAAGTCTGCCCTGGTTTCCTGG - Intergenic
1091170162 11:133512876-133512898 TGGTCTCTGCCCTGGTTCCTGGG - Intronic
1092155663 12:6280091-6280113 GGGACTCTTCCCTGCTTTCCAGG + Intergenic
1092734699 12:11569298-11569320 GGGGTTCTGCCATGTTGTCCAGG + Intergenic
1096784311 12:54008527-54008549 GGGGCCCTGCTCTGGCTTGCAGG + Intronic
1100192476 12:92207784-92207806 GGGGTTTTGCCATGTTTTCCAGG + Intergenic
1100858028 12:98775641-98775663 GGGGCTTTGCCATGTTTCCCAGG + Intronic
1101726860 12:107395202-107395224 GTGTTTCTGCCTTGGTTTCCTGG + Intronic
1101970174 12:109307380-109307402 GGAGCCCTGACCTCGTTTCCAGG - Intronic
1103122970 12:118396136-118396158 GGGTCCCTGCCCTGGTTTGGAGG + Intronic
1103529155 12:121588338-121588360 GGGGCTTTGCCATGGTGCCCAGG - Intergenic
1103912274 12:124359101-124359123 GGGGCTCAGGCCTGGCTTCATGG + Intronic
1104895184 12:132160521-132160543 GGGGCTCTGTCGGGGTCTCCTGG + Intergenic
1104945922 12:132414869-132414891 GAGGCTCTCCCCTCGTTTCACGG + Intergenic
1105823925 13:24105328-24105350 GGGGATCTGCCGTGTTGTCCAGG + Intronic
1105941793 13:25154168-25154190 GCAGCTCTGCCCAGGTCTCCAGG - Intergenic
1106484897 13:30163344-30163366 GTGTCTTTGCCCTGTTTTCCTGG - Intergenic
1106553874 13:30793823-30793845 GTGGCCCTGCCTGGGTTTCCGGG - Intergenic
1107854164 13:44598299-44598321 GGGGTTCTGCCATGTTTGCCAGG + Intergenic
1113561280 13:111283489-111283511 GGGGGTCTGCCTTGGTTCTCTGG + Intronic
1113892542 13:113743988-113744010 GGCGCTGTGCCCTGGTGTCTGGG + Intergenic
1114538906 14:23440472-23440494 CGGACTCTGCCCTGTTTCCCAGG + Intergenic
1115031038 14:28794283-28794305 GGGGTTGTGCCATGGTGTCCAGG + Intronic
1115245066 14:31286717-31286739 GGGGTTTTGCCATGTTTTCCAGG + Intergenic
1115394494 14:32892417-32892439 GGGGATCTGACCTGGTTTGGTGG - Intergenic
1118588039 14:67375009-67375031 AGGCCTCTGCCTTGCTTTCCTGG - Intronic
1118980281 14:70710566-70710588 GGGACTCTGCGCTGGGTTCCAGG + Intergenic
1119206274 14:72796308-72796330 GGGGTTCTGCCATGTTGTCCAGG - Intronic
1119243779 14:73085636-73085658 GGGATTTTGCCCTGGTTGCCAGG + Intronic
1119484053 14:74976974-74976996 ATGGCTCTGCCCTGGTCCCCAGG + Intergenic
1119618851 14:76116685-76116707 GAGGCCCTGCCCTGCCTTCCCGG - Intergenic
1121245665 14:92459429-92459451 GGGGCTCTGCCCTTGCTTGGGGG + Intronic
1121398705 14:93652449-93652471 GGGGGTTTGCCCTGTTTCCCAGG + Intronic
1121558652 14:94857857-94857879 GGGTCCCTGTCCTGGTTTCTAGG - Intergenic
1121646398 14:95520220-95520242 GGGGCATTGCCCAGGGTTCCAGG + Intergenic
1122265741 14:100546133-100546155 GGGGCCCAGCCATGGTTCCCTGG - Intronic
1122607174 14:102954546-102954568 TGGGGTCTGCCCTCGTGTCCAGG - Intronic
1123420409 15:20126000-20126022 TGGGCTCTGCCCTGAGTGCCTGG - Intergenic
1123529633 15:21132536-21132558 TGGGCTCTGCCCTGAGTGCCTGG - Intergenic
1124411837 15:29443391-29443413 GGGCCTCTTCCCTGGATTTCTGG - Intronic
1126167843 15:45668593-45668615 GAGGCCCTGCCCTGGCATCCGGG - Intronic
1127318310 15:57817958-57817980 GGGGCCCTGCTTTGGTTTCTGGG - Intergenic
1128348051 15:66867224-66867246 GGGGCTCTGCCATGTTGGCCAGG + Intergenic
1128349920 15:66881771-66881793 GGGGCTCTGCGCTGCTCTCCTGG + Intergenic
1128535480 15:68486973-68486995 GGGGCTCTGCCCCAGTTTTGAGG - Intergenic
1130321333 15:82844944-82844966 GGGACTCTGCCGTGGTTTACGGG + Intronic
1130660664 15:85829424-85829446 GGGGCTCTGGCCAGGAATCCAGG - Intergenic
1132283588 15:100642575-100642597 GGGGCTTTGCCCTTGGTACCAGG - Intronic
1132562077 16:600167-600189 TGGGCTATGCCCTGAGTTCCCGG + Intronic
1132580813 16:683909-683931 GCGACTCTGCCCTTCTTTCCAGG - Exonic
1132750373 16:1454819-1454841 TGGGCTCAGGCCTAGTTTCCAGG - Intronic
1132924668 16:2422835-2422857 GGGGCTTTGCCCTGCTCTCCAGG - Intergenic
1134091112 16:11392194-11392216 GGTTGTCTGCCCTGGTTTCTGGG + Intronic
1134167584 16:11942760-11942782 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1134493117 16:14710952-14710974 GGGGGTCTGTCCTGGTCACCAGG + Intronic
1134498498 16:14750076-14750098 GGGGGTCTGTCCTGGTCACCAGG + Intronic
1134525050 16:14936706-14936728 GGGGGTCTGTCCTGGTCACCAGG + Intronic
1134547845 16:15124213-15124235 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1134582078 16:15379009-15379031 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1134712640 16:16335193-16335215 GGGGGTCTGTCCTGGTCACCAGG + Intergenic
1134720504 16:16378508-16378530 GGGGGTCTGTCCTGGTCACCAGG + Intergenic
1134946923 16:18333377-18333399 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1134954187 16:18373500-18373522 GGGGGTCTGTCCTGGTCACCAGG - Intergenic
1135207053 16:20492675-20492697 GGGTGTCTGCCCTCGTTGCCTGG + Intergenic
1135207074 16:20492742-20492764 GGGTGTCTGCCCTCGTTGCCTGG + Intergenic
1135211811 16:20530890-20530912 GGGTGTCTGCCCTCGTTGCCTGG - Intergenic
1135211832 16:20530957-20530979 GGGTGTCTGCCCTCGTTGCCTGG - Intergenic
1135313011 16:21420412-21420434 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1135365935 16:21852692-21852714 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1135445880 16:22518470-22518492 GGGGGTCTGTCCTGGTCACCAGG + Intronic
1136111128 16:28064007-28064029 CAGGCTCTGCCCTTGTCTCCTGG - Intergenic
1136139808 16:28281420-28281442 GGGGCACTGTCCTGGTGTCCCGG - Intergenic
1136323124 16:29500920-29500942 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1136411416 16:30079661-30079683 GGAGGTCTGCCCTGGCTTTCTGG - Intronic
1136437808 16:30240888-30240910 GGGGGTCTGTCCTGGTCACCAGG - Intronic
1137382717 16:48013697-48013719 GGGGATCTGCCCTGCCTTTCTGG + Intergenic
1138405330 16:56788301-56788323 CGGGCTCTGGCCTGATTTTCTGG + Intronic
1138579031 16:57927576-57927598 TGGGCTCTGCCCTGGGTGCTGGG - Intronic
1139625869 16:68187978-68188000 GCAGCTCAGCCCTGGTTTGCAGG - Intronic
1140473816 16:75228814-75228836 CAGGCTCTGCCCTGGCTCCCAGG + Intronic
1141251379 16:82362066-82362088 GGGGCTTTAGCCTGGTGTCCTGG + Intergenic
1141461808 16:84182261-84182283 GGCGCGCTGGCCTGGGTTCCTGG - Exonic
1142000677 16:87662581-87662603 GAGGCTCTGCCCTCCTTTCCTGG + Intronic
1142189160 16:88709662-88709684 GGGGCTCTGCCCTCGTTTGCTGG + Intronic
1142262010 16:89047448-89047470 GGAGAACAGCCCTGGTTTCCAGG + Intergenic
1143013161 17:3877381-3877403 GGAGGTCTGCCCTGCTTTCTGGG + Intronic
1143537862 17:7551975-7551997 GGGGTTTTGCCATGTTTTCCAGG + Intronic
1143608044 17:8002488-8002510 TGGGATCTGTCCTGGCTTCCAGG - Intergenic
1145272554 17:21412587-21412609 GGGGCTCAGCCCCAGATTCCTGG - Intronic
1145310765 17:21700050-21700072 GGGGCTCAGCCCCAGATTCCTGG - Intronic
1146588648 17:34107308-34107330 GGGGTTTTGCCATGTTTTCCAGG - Intronic
1147253006 17:39164982-39165004 GGAGCTCTTCCCTGGGTTCCCGG - Intronic
1147775835 17:42900508-42900530 GTGTCTCTGGCCTGGTTTCGGGG + Intergenic
1148200636 17:45747929-45747951 GGGACTCTGGACTGGTCTCCTGG + Intergenic
1148785389 17:50143780-50143802 GGGGCTGTGCCCTGGAATTCGGG - Intronic
1148874429 17:50678230-50678252 GTGGCCCTGCCCTGGGGTCCAGG - Intronic
1148958828 17:51376088-51376110 AGGACTCTGCCCTGGCTCCCTGG - Intergenic
1149528612 17:57377447-57377469 GGGGCTCTGCCCAGGTGAGCAGG + Intronic
1150115018 17:62539882-62539904 AGGGCTCTGCCCTGAATTTCAGG + Intronic
1151473944 17:74334837-74334859 GGGGCTGTGGCCTGGCTCCCTGG + Intronic
1151625090 17:75271296-75271318 GGGGCACTGCCCTGGCCTCCAGG + Intergenic
1152256463 17:79242834-79242856 GGAGCCCTGCCCGGGCTTCCTGG - Intronic
1152758834 17:82098056-82098078 GGGGCTGGGCCCGGGGTTCCCGG - Intronic
1152843448 17:82585103-82585125 GGGCCTCTGCCATGGTTTGGGGG - Intronic
1153220641 18:2857850-2857872 GGGGCCCTGACCTTGCTTCCTGG - Intronic
1153328719 18:3849619-3849641 GGAGCTCTGCCCTGGTTCTCTGG - Intronic
1153583608 18:6599626-6599648 GGATCTTTGCCCTTGTTTCCTGG - Intergenic
1154118810 18:11634767-11634789 GGGGGTCTGTCCTGGTCACCAGG - Intergenic
1156475960 18:37405476-37405498 GGGGCTCTGCCCCGGGATGCAGG + Intronic
1157103302 18:44749499-44749521 GGAGCTTTTCCCTGGATTCCAGG + Intronic
1160511415 18:79455553-79455575 GGGGCCCTGCCCTGGTTCGCAGG + Intronic
1160603670 18:80033591-80033613 GCGGCCCTGCCCAGGTCTCCAGG + Intronic
1160799880 19:962880-962902 GAGGCTCTGGGCAGGTTTCCGGG + Intronic
1160907162 19:1456780-1456802 AGGGCTCCGACCGGGTTTCCAGG + Intronic
1160940460 19:1618320-1618342 TGGCCTCTGCCTTGGTCTCCCGG + Intronic
1161004729 19:1929513-1929535 CGGGCTCTGCCCTGGCTCCCGGG + Intergenic
1161064819 19:2232426-2232448 GAGGCTCTGCCGTGTCTTCCGGG + Exonic
1161138494 19:2634533-2634555 GGGGCTCTGCCACAGTCTCCAGG - Intronic
1161636003 19:5389270-5389292 GGGGTTCTGCCCTGTTGGCCAGG - Intergenic
1161670912 19:5608725-5608747 TTGGCACTGCCCTGGTCTCCTGG - Intronic
1161994455 19:7703807-7703829 GGGGGTCTGCCGTGGTGGCCAGG - Intergenic
1162921704 19:13906689-13906711 GGGGCCCTGCCCCGGGTTCGGGG + Intronic
1163020953 19:14480514-14480536 GGGGCTCTGCCCTGGTTTCCGGG + Intronic
1163640134 19:18457390-18457412 GGGGCACTGCCCTGGCTTGGCGG - Intronic
1165075704 19:33278903-33278925 GGGGGCTTGCCCTGGTCTCCAGG - Intergenic
1165465154 19:35970017-35970039 GGGGCTCTGCTCTGGTTAGAAGG + Intergenic
1165611753 19:37160139-37160161 GGGGTTTTGCCCTGTTTCCCAGG - Intronic
1165739157 19:38195410-38195432 GGGGCTCTGCCCTCGGTGCCAGG + Intronic
1166226735 19:41400573-41400595 GGGGTTTTGCCATGTTTTCCAGG + Intronic
1166316318 19:41991939-41991961 GGGGCTGGGGCCTGGATTCCTGG + Intronic
1166523945 19:43499347-43499369 GGGGCTGGGGCCTGGATTCCTGG + Intronic
1166663329 19:44661607-44661629 GAAGCACTGCCCTGGCTTCCAGG + Intronic
1166743208 19:45126529-45126551 AGAGCTCAGGCCTGGTTTCCAGG + Intronic
1167452670 19:49581339-49581361 GGGGATCAGGCCTGGTTACCGGG + Exonic
1168250315 19:55137856-55137878 GGGGCTGAGGCCTGGATTCCTGG - Intronic
926302916 2:11617268-11617290 GGGGCTCTGCCCTCCTCTGCGGG - Intronic
926303153 2:11618371-11618393 GGGGCTCTGCCCTCCTCTGCGGG - Exonic
927213287 2:20651496-20651518 GGGGCTCTGTCCAGGCTTCGTGG + Intergenic
927827206 2:26317144-26317166 GGGGGTCTGCTCTGCATTCCTGG - Intronic
928061681 2:28119817-28119839 GCAGCTCTGTCCTGGTGTCCTGG + Intronic
929615341 2:43302551-43302573 TGTGCTATGTCCTGGTTTCCTGG + Intronic
930055752 2:47250791-47250813 GAGGCTGAGCCCTGGTGTCCAGG - Intergenic
930143830 2:47981041-47981063 GGGGCTTTGCCATGGTGTTCAGG + Intergenic
931149162 2:59553697-59553719 GGGGCTTTGCCCTGTTGCCCAGG - Intergenic
931471669 2:62544829-62544851 GGGCCTCTGCCCTGGGCCCCAGG + Intergenic
932415322 2:71570108-71570130 GGGGCTCTGCCCTTCTGTCTGGG + Intronic
932668771 2:73719069-73719091 AGGGCTATGCCCTGCATTCCAGG + Intergenic
932737556 2:74265043-74265065 GGGGAGCTGCCCTGGTTTGCAGG + Intronic
934619181 2:95793717-95793739 GGAGCTGTGCCCAGGTTTCGGGG + Intergenic
934641710 2:96030840-96030862 GGAGCTGTGCCCAGGTTTCGGGG - Exonic
934650433 2:96088455-96088477 GCAGCTCTGCCCTCTTTTCCAGG + Intergenic
937471517 2:122177846-122177868 GGGTTTTTGCCCTGATTTCCAGG - Intergenic
938293472 2:130162518-130162540 GTGGCTCTGCCCTTGCTTGCAGG + Intronic
938463081 2:131510443-131510465 GTGGCTCTGCCCTTGCTTGCAGG - Intergenic
938692265 2:133802527-133802549 GGTGCTCTGTCCTGGTTTGAAGG - Intergenic
938838818 2:135138016-135138038 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
939021183 2:136960328-136960350 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
939199293 2:139014475-139014497 GGGGTTTTGCCATGTTTTCCAGG + Intergenic
940745379 2:157561902-157561924 TGGACTCTGCCCTGCTTTTCTGG - Intronic
941430411 2:165407907-165407929 GGGGTTCTGCCATGTTGTCCAGG - Intergenic
942421047 2:175808111-175808133 GGGGCTCTTCACTTGTTTTCAGG + Intergenic
943232792 2:185276587-185276609 GGGGCTCTTTCTTTGTTTCCAGG - Intergenic
945991848 2:216402747-216402769 GGTCCTCAGCACTGGTTTCCAGG - Intergenic
946172987 2:217906285-217906307 GGGGCTGGGCCCTGGTGGCCAGG - Intronic
948257187 2:236577057-236577079 GGGCCTCTGGCTTTGTTTCCTGG + Intronic
948764527 2:240212588-240212610 GGGTCTCTGCCCTTGGCTCCTGG + Intergenic
948893619 2:240918444-240918466 GGGGCTCTGCCCTGTCTTGGTGG - Intergenic
949050444 2:241894960-241894982 GGGGATCTGCCCAGGTCTCGGGG - Intronic
1168761561 20:353449-353471 AGGGCTCTGCCTTGGTGTCCTGG - Exonic
1169257689 20:4111364-4111386 TGGGCTCTGGCCTGAGTTCCTGG - Intergenic
1171779783 20:29408565-29408587 GAGGCTCTGCTCTGGTATACAGG - Intergenic
1172221915 20:33280075-33280097 GAGGCTCTGCCCTGGTGTGGGGG - Intronic
1172307705 20:33893125-33893147 GGGGCTTTGCCATGTTTCCCAGG - Intergenic
1172311389 20:33921024-33921046 GGGGCTTTGCCATGGTGTCCAGG + Intergenic
1172510466 20:35497469-35497491 GGGCTTCAGCCCTGGCTTCCTGG - Intronic
1174904322 20:54534378-54534400 GGGGTTTTGCCCTGTTGTCCAGG + Intronic
1175173237 20:57094088-57094110 GGGACTCAGCCCTGATCTCCGGG + Intergenic
1175366451 20:58459617-58459639 GGGACTCTGCCCATGTTCCCAGG - Exonic
1176182175 20:63755119-63755141 GCGGCTCTGCCCTGGGTCCGTGG - Intronic
1178134507 21:29611965-29611987 GAGCCTCTGCTCTGGCTTCCAGG + Intronic
1178321741 21:31611147-31611169 GGGGCTCTGCCCTGTGTATCAGG - Intergenic
1178410644 21:32360943-32360965 AGGGCTCTGCTCTGGTTTATTGG + Intronic
1179835340 21:44028302-44028324 AGAGCTCTGCCCCGCTTTCCCGG + Intronic
1179891161 21:44335701-44335723 GAGGCTCTGCCCCGGCTTCCAGG + Intronic
1180147784 21:45930878-45930900 GGGGCTCTGCTCTGCTGCCCTGG - Intronic
1180737071 22:18025060-18025082 AGGGCTCTGCGCTGATCTCCAGG - Intergenic
1180863948 22:19105129-19105151 GGGGCTTTGCCATGCTGTCCAGG - Intronic
1180895770 22:19331175-19331197 GGAGCTCTGCCCAGGTGCCCTGG - Exonic
1181000419 22:19985447-19985469 TGGGCTCAGCCCTGTGTTCCCGG - Intronic
1181258607 22:21581246-21581268 GGGGTTTTGCCATGTTTTCCAGG + Intronic
1181457848 22:23069998-23070020 TGGGCTCAGGCTTGGTTTCCCGG + Intronic
1182526689 22:30924828-30924850 GGTCCTCTTTCCTGGTTTCCTGG - Intergenic
1182753695 22:32661359-32661381 GGGGCTCTCCACTTGTTCCCGGG - Intronic
1182890182 22:33811645-33811667 TGGGCTCTGGCCTTCTTTCCTGG - Intronic
1182962645 22:34490071-34490093 GGGGATTTGGACTGGTTTCCTGG - Intergenic
1183261483 22:36798527-36798549 AGGGCTCTGACCTGGTTTCCGGG + Intergenic
1183271844 22:36867296-36867318 GGGGCTCTGGCCAGGGTTCCTGG + Intronic
1183326255 22:37196343-37196365 GACTCTCTGCCCTGGCTTCCTGG + Intronic
1183575224 22:38683809-38683831 GGGGCTCTACCCTCACTTCCTGG + Exonic
1184201132 22:42970751-42970773 GGGGCCCTGCCTTCCTTTCCAGG - Intronic
1185211780 22:49574560-49574582 TGGGCTGTGGCCTGGTTTTCAGG - Intronic
1185285044 22:49996342-49996364 GTGGCTCTGCCTTGGAGTCCAGG - Exonic
949956235 3:9271139-9271161 GGGGTTTTGCCATGTTTTCCAGG - Intronic
950566621 3:13773192-13773214 GGCGCGCTCCCCTGCTTTCCTGG + Intergenic
952849445 3:37715488-37715510 GGGCCTCTGCCCTCATTCCCTGG + Intronic
953383703 3:42492845-42492867 GGGGCTGGGGCCTGGTGTCCAGG - Intronic
953541831 3:43826423-43826445 GGGACACTGCCCTAATTTCCAGG - Intergenic
953729092 3:45429891-45429913 GGGGTTTTGCCATGTTTTCCAGG + Intronic
953859427 3:46530386-46530408 GGGGTTTTGCCATGGTGTCCAGG - Intronic
954458361 3:50612009-50612031 GGGGCCCCGCCCCGTTTTCCTGG - Exonic
954705149 3:52476168-52476190 GGGCCTTTGCCCTGGTGACCTGG - Intronic
954856712 3:53650081-53650103 GAGGCTCTGCCTAGGTTTCCTGG + Intronic
956653694 3:71529391-71529413 TGGTCTCTGCCCTTGTTTCTTGG + Intronic
958985556 3:100776287-100776309 GGGCCTCTGACCTGGCCTCCAGG + Intronic
960992056 3:123318278-123318300 GGTGATCTGGACTGGTTTCCTGG - Intronic
961166743 3:124768912-124768934 GAGGCACTGCCCAGGCTTCCTGG - Intronic
961474166 3:127136482-127136504 GAGGCTCTACCCTGGCTTCCAGG - Intergenic
961561748 3:127734888-127734910 GGGTGTCTGCCCTGCATTCCTGG + Intronic
961654951 3:128436021-128436043 TGTGCTCTGCCCTGGGTCCCTGG - Intergenic
961727548 3:128942605-128942627 TGGGCTCTGCCCTTGGCTCCTGG - Intronic
963509447 3:146229124-146229146 TGGTCTTTGCCCTGGGTTCCGGG + Intronic
965229689 3:166034483-166034505 GGGGTTTTGCCATGGTTGCCAGG + Intergenic
967017383 3:185494554-185494576 GGGGGTCTGCCCTGGGTTATTGG - Intronic
968076837 3:195820628-195820650 TGGCCTCTCTCCTGGTTTCCAGG + Intergenic
968513405 4:1005058-1005080 GGGGCTCCCCCGTGGCTTCCTGG - Intergenic
968532860 4:1104414-1104436 GCAGCTCTGCCCTGTTCTCCAGG + Intronic
968713907 4:2140553-2140575 GGGGCTCTGCCATGGTGGCCAGG - Intronic
968941695 4:3642400-3642422 CGTGCTCTGCGCGGGTTTCCGGG + Intergenic
968941714 4:3642526-3642548 CGTGCTCTGCGCGGGTTTCCGGG + Intergenic
969623971 4:8293213-8293235 GAGGCCGTGCCCTGGTTTCAAGG + Intronic
969666161 4:8558572-8558594 GTGGCTCTGGCCGGGCTTCCCGG - Intergenic
970145920 4:13035602-13035624 GGGTCTCTTCCCTGCTTTTCTGG + Intergenic
973726662 4:53783799-53783821 GGGGTTCTGCCATGTTTCCCAGG + Intronic
975230632 4:71928588-71928610 GGGGTTTTGCCATGGTTTTCAGG + Intergenic
976526031 4:86090071-86090093 TGCGCTCTGCCCTGGCTTCCTGG - Intronic
978169488 4:105652044-105652066 CTGGCTCTGCCCTGGTAACCAGG - Intronic
979367661 4:119844593-119844615 GGGGTTTTGCCATGCTTTCCAGG + Intergenic
982266417 4:153542289-153542311 ATGGCTCTCCCTTGGTTTCCAGG - Intronic
985799573 5:1995718-1995740 GGTGCACTGCCCTGGGTTCTAGG - Intergenic
986338798 5:6773470-6773492 GGGATTCTGGCCTGGCTTCCCGG + Intergenic
988496109 5:31747634-31747656 GGGGCTCTGGCCAGCTTCCCGGG + Intronic
990994595 5:61719128-61719150 AGTTCTCTGCCTTGGTTTCCAGG + Intronic
991093996 5:62720140-62720162 GGGGCTCAGCCCTGGTGCCGAGG - Intergenic
991100521 5:62787282-62787304 GGTGCTCTGCTATGGCTTCCTGG + Intergenic
991643976 5:68782073-68782095 GGGGCTTTGCCATGTTTCCCAGG + Intergenic
992311967 5:75510934-75510956 GGGGCACTGTCCTTGTTGCCCGG - Intronic
994808112 5:104478287-104478309 TGGGTTCTGCCATGTTTTCCAGG - Intergenic
994814895 5:104573170-104573192 GGGGCTTTTTCCTGGTTTACGGG - Intergenic
996048880 5:118909531-118909553 GGGTGGCTGCCCTGGTTCCCAGG - Intronic
996553426 5:124753097-124753119 GGTGTCCTGCCCTGGTTTCTAGG + Intergenic
996786114 5:127238245-127238267 GGGGCTTTGCCATGTTGTCCAGG + Intergenic
996915115 5:128703171-128703193 GGGGCTCTGCACTGGAATTCAGG - Intronic
999521851 5:152358996-152359018 GGGGCTCTCTCTTTGTTTCCAGG - Intergenic
1000274909 5:159725549-159725571 GGGGCTCTGACCTGGTGTTTGGG - Intergenic
1001381629 5:171309863-171309885 GGGCCTCTGAAATGGTTTCCGGG - Intronic
1001858513 5:175033164-175033186 TGTGCTCTGCCCTGGAGTCCAGG - Intergenic
1002376058 5:178789827-178789849 GGGACTTTGCCCAGGTTTGCTGG - Intergenic
1002391514 5:178916247-178916269 TGGGCTCTTCCCTGGGTCCCAGG - Intronic
1002471650 5:179439215-179439237 GGTGCCCTGCCCTGGGATCCTGG - Intergenic
1002485291 5:179530795-179530817 GGGGCTCTGCGCTTGCGTCCAGG + Intergenic
1003476430 6:6488111-6488133 GGGGTGCTGCCCTGGGTACCCGG - Intergenic
1005510260 6:26506204-26506226 AGGGCTCTGTCTAGGTTTCCAGG + Intronic
1005934933 6:30514082-30514104 GGGGTTTTGCCCTGTTTCCCAGG - Intergenic
1005935298 6:30516523-30516545 GCGGCTCTGTCCCTGTTTCCTGG + Intergenic
1006450576 6:34103650-34103672 GGGCCTCTGCCCTGCCTGCCTGG - Intronic
1006865326 6:37205186-37205208 GGGGCTCAGTCCTTGTCTCCAGG + Intergenic
1007116301 6:39345555-39345577 TGGCCTCTGCCCTGGTCCCCTGG - Intronic
1007390905 6:41548912-41548934 GGGGCTCTGCTCTTGGTACCTGG + Intronic
1007701251 6:43767850-43767872 GGGGCTTTGCCCAGGGATCCAGG - Intergenic
1008299038 6:49811640-49811662 GGGGCTTTGCCATGTTGTCCAGG + Intergenic
1011777474 6:90748067-90748089 GGGCCTCTGCCCTTGTCTCTGGG - Intergenic
1011826986 6:91319223-91319245 AGGGCTCTGCCCTGGTGAACGGG + Intergenic
1011854427 6:91671125-91671147 GGGGTTTTGCCCTGTTTCCCAGG + Intergenic
1014392657 6:120882371-120882393 GGGGTTTTGCCATGTTTTCCAGG + Intergenic
1016408482 6:143756854-143756876 GGGGCTTTGCCCTGTTGGCCAGG - Intronic
1016912905 6:149216448-149216470 GGGGCTCTGCCTTGTTACCCAGG - Intergenic
1017693942 6:156995129-156995151 GGGGCTGTGCCCTCTTCTCCCGG + Intronic
1017754977 6:157521739-157521761 GAGGCTATGACATGGTTTCCTGG + Intronic
1018730345 6:166645557-166645579 GGAGGTCTGCCCTGGTTCCTAGG + Intronic
1018918739 6:168156024-168156046 TGGACTCTGTCCTGGGTTCCCGG + Intergenic
1019132400 6:169886828-169886850 GGGTCTCTGCCCTCTGTTCCAGG + Intergenic
1019338469 7:496094-496116 GCGGCTCTGCCCTGCGTTCCCGG - Intergenic
1020332998 7:7039350-7039372 GTGGCTCTGCCTTGGATTGCAGG + Intergenic
1020802723 7:12751303-12751325 GTGGCTCTTTTCTGGTTTCCTGG - Intergenic
1023135795 7:37050263-37050285 GGGGTTTTGCCATGTTTTCCAGG + Intronic
1024090998 7:45939696-45939718 GGGCCTCTCCCCTTCTTTCCTGG - Intergenic
1024981156 7:55158786-55158808 CTGGCTCTGCCCTGGTGTCCTGG + Intronic
1026720868 7:72829609-72829631 GCGGGTCAGCCCTGGTTTGCCGG + Intergenic
1026742870 7:72990089-72990111 GGAGCTCAGCCTTGGTGTCCCGG + Intergenic
1026802725 7:73410479-73410501 GGGGCTCAGCCTTGGTGTCCCGG + Intergenic
1027028984 7:74874794-74874816 GGAGCTCAGCCTTGGTGTCCCGG + Intergenic
1027100865 7:75374989-75375011 GGAGCTCAGCCTTGGTGTCCCGG - Intergenic
1027215314 7:76179783-76179805 GGGGCTGGGCCCGGGTCTCCCGG + Intergenic
1029171947 7:98636836-98636858 AGGTCTCTGCCCTGTTGTCCAGG + Intergenic
1029261898 7:99308432-99308454 GGGGCTCAGCTCTGCCTTCCTGG + Intergenic
1030017433 7:105238384-105238406 GGGCCTCTGCCTTGGCTGCCTGG - Intronic
1030304083 7:108002325-108002347 GGGGCTCTGGAGTGGTTTCAAGG + Intronic
1031967921 7:128041333-128041355 TGGGCGCTGGGCTGGTTTCCCGG - Intronic
1032974465 7:137206402-137206424 GGGGCTCTCTCTTTGTTTCCAGG - Intergenic
1033566947 7:142587916-142587938 TGGGTCCTGCCATGGTTTCCAGG + Intergenic
1034390188 7:150780970-150780992 GGGGCTCTGTCCTTAGTTCCAGG - Intergenic
1034489506 7:151385821-151385843 GGGCCTCTTCCCTTGTCTCCTGG - Intronic
1035108774 7:156463387-156463409 GAGGTTCTTCCCAGGTTTCCAGG - Intergenic
1039350343 8:36757345-36757367 GTGGCTCTTCCATGGTTTCCTGG + Intergenic
1039433038 8:37540518-37540540 GGTGCTCTCCTCTGGTTTTCTGG + Intergenic
1039514175 8:38117864-38117886 GGGGCTTTGCCATGGTGGCCAGG - Intronic
1039613702 8:38938404-38938426 CGGCCTCTGCCCTGGTATCTGGG - Intronic
1039954127 8:42194560-42194582 AGCGCTCTGGCTTGGTTTCCTGG + Intronic
1041288317 8:56283293-56283315 GGTTCTCTGCCCTAGTTCCCGGG + Intergenic
1048324145 8:133426141-133426163 GTGGCTCTGCCATAGCTTCCTGG + Intergenic
1048470276 8:134698704-134698726 GGTGCTGTGCCCTGGATCCCTGG - Intronic
1049507993 8:143014005-143014027 TGAGCTCTGCCCTGTTTTCTGGG - Intergenic
1049532158 8:143160091-143160113 GGGACTCGGCCCGGGGTTCCCGG - Intronic
1049709839 8:144058507-144058529 GGGCTTCTGCCGTGGCTTCCAGG - Exonic
1049738219 8:144221362-144221384 TGGCCTCTGCCCTGGGGTCCTGG - Intronic
1049853568 8:144847889-144847911 TGGCCTCTGCCCTGGAGTCCAGG + Intronic
1050531565 9:6594502-6594524 AGGGCTTTGCCATGTTTTCCAGG - Intronic
1051423441 9:16911671-16911693 GGTTCTCTGCCCAGGTTTTCAGG - Intergenic
1052816904 9:33108820-33108842 TGGCCTCTGCGCTGGGTTCCTGG + Intronic
1053162965 9:35826209-35826231 TGGGCTCTGCCCTGACTTGCCGG - Intronic
1053788420 9:41668986-41669008 GGGGTCCTGCCCTGGATCCCAGG - Intergenic
1054176703 9:61880325-61880347 GGGGTCCTGCCCTGGATCCCAGG - Intergenic
1054476492 9:65576791-65576813 GGGGTCCTGCCCTGGATCCCAGG + Intergenic
1054501990 9:65880636-65880658 GGGGTTCTGCCATGTTGTCCAGG + Intronic
1054660832 9:67700481-67700503 GGGGTCCTGCCCTGGATCCCAGG + Intergenic
1055171534 9:73265254-73265276 GGGGCTCTTCCCCCCTTTCCTGG + Intergenic
1055339703 9:75267839-75267861 GGTGAACTGCCCTGCTTTCCTGG - Intergenic
1056481296 9:87009096-87009118 GTGGCTCAGGCCTGTTTTCCTGG + Intergenic
1056591722 9:87970081-87970103 GGGGCTTTGCTCTGGGTTCTAGG - Intronic
1056951596 9:91044562-91044584 GGGGCTCTGCCCAGCATCCCTGG - Intergenic
1057394780 9:94670263-94670285 TGGGATCTTCCCTGCTTTCCTGG + Intergenic
1058930954 9:109718269-109718291 GGGGTTTTGCCATGTTTTCCAGG + Intronic
1058994680 9:110288112-110288134 GGGGCTTTGCCATGTTGTCCAGG - Intergenic
1059048382 9:110895482-110895504 GTGGGTCTCCCCTAGTTTCCCGG - Intronic
1059284473 9:113160854-113160876 CTGTTTCTGCCCTGGTTTCCTGG - Intronic
1059328320 9:113518244-113518266 TGGGCTCTGCCCTGGCTACCTGG + Intronic
1059511772 9:114855073-114855095 GGGGCTTTGCCATGTTGTCCAGG + Intergenic
1060888918 9:127175988-127176010 AAGGCTCTGCCCTGATTCCCAGG + Intronic
1060969703 9:127731077-127731099 GGGCCTCTGCCTTGGGCTCCGGG - Exonic
1061019098 9:128002427-128002449 AGGACCCTGCCCTGGTCTCCAGG - Intergenic
1061450912 9:130666571-130666593 CGGGCTCTGACCGGTTTTCCTGG + Intronic
1061627615 9:131850542-131850564 TGGGCACTGCCCCGTTTTCCTGG - Intergenic
1061650961 9:132049627-132049649 GATGCTCTGTGCTGGTTTCCCGG - Intronic
1061674317 9:132207228-132207250 TGGGCACTGCCTTGGTTTCTTGG + Intronic
1061845723 9:133387040-133387062 GGGGCCCTGACCTGGTCTGCTGG + Intronic
1062343892 9:136105993-136106015 GGGGCTCTGCCGTGCCTCCCGGG - Intergenic
1062431879 9:136529993-136530015 GGGGCCCTGCCCTGGCTCCCAGG + Intronic
1062549559 9:137079710-137079732 GGGGACCTGCCCTGGTGCCCAGG + Intronic
1062571097 9:137185737-137185759 GGGGCTCTGCTCTGGGCTCCCGG - Intronic
1062625345 9:137439902-137439924 GGGGCACTGTCCTGGTCTCGGGG - Intronic
1186705830 X:12138575-12138597 GAGGCGCTGCTCTGGCTTCCCGG - Exonic
1189792693 X:44618951-44618973 GAGGCACTGCCAGGGTTTCCTGG - Intergenic
1190064864 X:47232941-47232963 GGGGCTCTGCTTCCGTTTCCGGG + Exonic
1190079074 X:47341145-47341167 GGGGTTTTGCCATGTTTTCCAGG + Intergenic
1190955452 X:55188544-55188566 ATGGCTCTGCCATGGTGTCCTGG + Intronic
1195201429 X:102553896-102553918 GGGGTTTTGCCATGTTTTCCAGG - Intergenic
1195705992 X:107738449-107738471 GGAGCACAGCCCAGGTTTCCTGG + Intronic
1195941639 X:110172472-110172494 ATGGCTCTGCTCTGGTTTGCTGG + Intronic
1197898469 X:131342483-131342505 GGGGCTGGGCCTTGCTTTCCAGG + Intronic
1198676322 X:139134837-139134859 GGGGCTTTGCCATGTTGTCCCGG + Intronic
1199769112 X:150962827-150962849 GGGTCTCTGCCCTGTTGCCCAGG + Intergenic
1199991475 X:152989908-152989930 GGGGCTCTGGCCTGGTCCTCTGG - Exonic
1200858134 Y:7961031-7961053 GGGGCTCTTTCTTTGTTTCCAGG + Intergenic