ID: 1163021372

View in Genome Browser
Species Human (GRCh38)
Location 19:14482640-14482662
Sequence GGTCCCTGATGGTGGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163021372_1163021386 15 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021386 19:14482678-14482700 CCAGTGGATACCTCGGCAGTTGG 0: 1
1: 0
2: 1
3: 5
4: 67
1163021372_1163021390 26 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021390 19:14482689-14482711 CTCGGCAGTTGGCAGGCGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 224
1163021372_1163021387 19 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021387 19:14482682-14482704 TGGATACCTCGGCAGTTGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1163021372_1163021379 -1 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021379 19:14482662-14482684 CCTGGTGCCCGGCTCCCCAGTGG 0: 1
1: 0
2: 4
3: 27
4: 276
1163021372_1163021388 22 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021388 19:14482685-14482707 ATACCTCGGCAGTTGGCAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 78
1163021372_1163021382 8 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021382 19:14482671-14482693 CGGCTCCCCAGTGGATACCTCGG 0: 1
1: 0
2: 1
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163021372 Original CRISPR GGTCCCTGATGGTGGACCAG AGG (reversed) Intronic