ID: 1163021372

View in Genome Browser
Species Human (GRCh38)
Location 19:14482640-14482662
Sequence GGTCCCTGATGGTGGACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163021372_1163021386 15 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021386 19:14482678-14482700 CCAGTGGATACCTCGGCAGTTGG 0: 1
1: 0
2: 1
3: 5
4: 67
1163021372_1163021388 22 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021388 19:14482685-14482707 ATACCTCGGCAGTTGGCAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 78
1163021372_1163021390 26 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021390 19:14482689-14482711 CTCGGCAGTTGGCAGGCGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 224
1163021372_1163021379 -1 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021379 19:14482662-14482684 CCTGGTGCCCGGCTCCCCAGTGG 0: 1
1: 0
2: 4
3: 27
4: 276
1163021372_1163021382 8 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021382 19:14482671-14482693 CGGCTCCCCAGTGGATACCTCGG 0: 1
1: 0
2: 1
3: 7
4: 82
1163021372_1163021387 19 Left 1163021372 19:14482640-14482662 CCTCTGGTCCACCATCAGGGACC 0: 1
1: 0
2: 2
3: 12
4: 154
Right 1163021387 19:14482682-14482704 TGGATACCTCGGCAGTTGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163021372 Original CRISPR GGTCCCTGATGGTGGACCAG AGG (reversed) Intronic
900177217 1:1296229-1296251 GGTCCCTGACGCTGGACTCGTGG - Exonic
901855550 1:12042096-12042118 GGTCCCTGATGTGGGTTCAGAGG + Intergenic
903342086 1:22660909-22660931 GGGCCCTAAAGGTGGCCCAGGGG + Exonic
904286248 1:29454832-29454854 GCTCCCAGATGGTGGACCCTGGG - Intergenic
904291072 1:29486122-29486144 GGTCCCTGTTGGTGGAGATGAGG + Intergenic
905490323 1:38338334-38338356 GGGCACTGATGCTGGAGCAGAGG - Intergenic
907800186 1:57757171-57757193 GGTCCATGCTGCTGGCCCAGGGG + Intronic
909622979 1:77687069-77687091 CTTCCCAGATGGTGGAGCAGCGG - Intergenic
910592983 1:88947635-88947657 GTTCCCTGATGGGGCTCCAGGGG - Intronic
912460573 1:109828287-109828309 GGTCCCTGAGGCTGGGCCTGAGG + Intergenic
913133443 1:115863925-115863947 GGTCCCTAAGGTGGGACCAGAGG + Intergenic
914804918 1:150984696-150984718 GGTCCCAGATGCTGGAGAAGGGG + Intronic
915440347 1:155941921-155941943 GGTGTCTGAAGGTGGGCCAGGGG - Exonic
915624361 1:157105793-157105815 GGTCCCTGAAGGTGTGTCAGGGG - Intergenic
918430432 1:184454518-184454540 GGTCCCTGATGTTGGAGGTGGGG + Intronic
922543067 1:226433637-226433659 GCTCCCTCATGGTGGACCGAGGG + Intergenic
923094333 1:230762694-230762716 GGTCCCTGAAGGTGGGCAGGCGG - Exonic
1065514514 10:26511784-26511806 AGTCACTGATGGTGGATGAGCGG + Exonic
1066080985 10:31929543-31929565 GGTCTTTGATGGTGATCCAGTGG + Intergenic
1067569397 10:47360452-47360474 GGGCCCTGACTGTGCACCAGAGG + Intergenic
1067704081 10:48594274-48594296 GTTCCCTGATGGTGGTCCCATGG - Intronic
1067933148 10:50583513-50583535 TGTGCCTCATGCTGGACCAGTGG - Intronic
1069060670 10:63891466-63891488 GGTCATTCATGGTGAACCAGAGG + Intergenic
1076847184 10:133075080-133075102 GCTCCCTGGGGGTGGAGCAGAGG + Intronic
1077107158 11:847240-847262 GGTCCCTGAAGGCTGACCAGTGG - Exonic
1083298448 11:61727729-61727751 GGTCCCAGCTGGTGGGTCAGAGG + Intronic
1083591667 11:63898999-63899021 GGTGCCTGAGGGTGGGCCACAGG - Intronic
1083940747 11:65894176-65894198 CGCCCCTCATGGTGGCCCAGTGG + Intronic
1084318967 11:68362892-68362914 GCTCCCTGAGGGTGGGCCTGGGG - Intronic
1084411889 11:69010346-69010368 GGTCCCAGAAGGAGGAGCAGGGG + Intronic
1084943181 11:72625231-72625253 GATCCAGGTTGGTGGACCAGGGG - Intronic
1085024818 11:73230252-73230274 GTTCCCTGATGGAGGAACGGTGG - Intronic
1089366977 11:117926417-117926439 GGTGCCTTATCCTGGACCAGCGG + Intronic
1092217985 12:6695644-6695666 GGTCCCAGCTGGGGTACCAGAGG + Exonic
1093092999 12:14942297-14942319 TGGCCCTGATGGAGGATCAGAGG + Exonic
1095542290 12:43324624-43324646 GATCCCTGATGGTGGAAGTGGGG + Intergenic
1096976748 12:55703703-55703725 GGTCCCTGATGAGGGGGCAGTGG - Intronic
1098861275 12:75713140-75713162 GGCCACTGATGGTGGAAGAGTGG - Intergenic
1107714927 13:43190648-43190670 GATACCTGATGGAGGAGCAGTGG + Intergenic
1110236449 13:73222257-73222279 TGTCACTCATGCTGGACCAGTGG - Intergenic
1110549503 13:76796415-76796437 GCTCCCTGCTGCTGGATCAGTGG - Intergenic
1112462378 13:99614199-99614221 GGTCCAAGATGGTAGACCACAGG + Intronic
1121097680 14:91229191-91229213 AGCCCCTGATGTTGGACCACAGG - Intergenic
1121273637 14:92653311-92653333 GGCCCCTGATGGTGGAAGAGAGG - Intronic
1122032913 14:98926603-98926625 GGTCCCTGAGGGGATACCAGAGG + Intergenic
1122303866 14:100749097-100749119 GGTCTCTGCTGGTGGCCCATCGG - Intergenic
1122354518 14:101114917-101114939 GGGCCCTGAAGGGGGACCAGGGG - Intergenic
1122898444 14:104772007-104772029 GCTGGCTGGTGGTGGACCAGGGG - Intronic
1124097801 15:26665533-26665555 TGTCACTTAAGGTGGACCAGAGG - Intronic
1124895040 15:33768489-33768511 TGTTCCTGAGTGTGGACCAGAGG + Intronic
1127825204 15:62696847-62696869 GGTCAATGGTGGTGGACCTGAGG + Intronic
1131704133 15:94974432-94974454 GGTCCCTAATGCTGCACCGGTGG - Intergenic
1132395298 15:101468700-101468722 CGTCCTTGATGCTGGGCCAGTGG + Intronic
1132653356 16:1031371-1031393 GGCCCCTGATGGGGGCTCAGAGG + Intergenic
1133247975 16:4461816-4461838 AGGCCCTGACGCTGGACCAGTGG - Exonic
1133971943 16:10574503-10574525 GGACCCTGCTGGAGGAGCAGTGG - Intronic
1136293157 16:29287844-29287866 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG + Intergenic
1139016530 16:62696268-62696290 GGTCCCTGATGCTGGATAATAGG + Intergenic
1139094120 16:63684265-63684287 GGTCCATGATGGTGAACCCTGGG - Intergenic
1139468703 16:67167119-67167141 GGTCCCTGATGCTGGATGAGGGG + Exonic
1139593513 16:67945815-67945837 GGACGCTGATGATGGAGCAGCGG - Exonic
1140220181 16:73038128-73038150 GGTCCCTTTTGTTGGACAAGGGG - Intronic
1140507880 16:75485815-75485837 GGGACCTGATGGTGTCCCAGTGG + Intronic
1141604317 16:85144328-85144350 GGGCTCAGATGGTGGACCTGTGG - Intergenic
1142006639 16:87692455-87692477 AGACCCTGCTGGTGGCCCAGGGG - Intronic
1142099041 16:88261851-88261873 GTTCCCTGCTGGTGGCACAGAGG + Intergenic
1143677327 17:8444078-8444100 GGTCCCTGAGAGTGGAGCAGTGG + Intronic
1143848727 17:9793429-9793451 TGTCCCTGATGATGGAGAAGAGG + Intronic
1147758948 17:42785260-42785282 GGTCCTGGATGGTGAACCTGAGG - Exonic
1152058761 17:78052707-78052729 GGGCCCAGCTGGTGGGCCAGGGG - Intronic
1152091905 17:78251906-78251928 GGTCCCTGACGCTGGCCCAGAGG + Intergenic
1152199658 17:78938019-78938041 GGTGCCTGCTGGTGGAAAAGGGG - Intergenic
1161042489 19:2117411-2117433 TGTCCCTGAAGGTGGCCGAGTGG - Intronic
1161048442 19:2149733-2149755 GGACCCTGACGATGGGCCAGGGG - Intronic
1161684186 19:5695014-5695036 GGTCCCTGATGGTGAAACCAGGG + Intronic
1162302121 19:9850041-9850063 AGTGCCTGAAGGTGGAGCAGAGG + Intergenic
1162807332 19:13144732-13144754 GGACCCTGGGGGTGGGCCAGGGG - Intronic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1163415790 19:17185777-17185799 GGTCCCTGGTGGTGGGACACAGG - Intronic
1166881546 19:45933545-45933567 GGTCCCAGATGGGGGAGCTGGGG - Intergenic
1168492541 19:56822762-56822784 GGTTCCTGGTGTGGGACCAGCGG + Exonic
928293095 2:30057185-30057207 GTTCCCTGCTGCTGGACCAGGGG - Intergenic
929769373 2:44879068-44879090 GGTCCCGGAAGGTGGACCCGTGG - Intergenic
930409832 2:51011450-51011472 TGTCCCTGCTGGAGAACCAGGGG + Intronic
934553972 2:95277855-95277877 GATCCCTGAGGGTGGATGAGGGG - Intronic
938244869 2:129768566-129768588 GCTCCAGGATGGTGGAGCAGAGG - Intergenic
939680766 2:145129331-145129353 GTTAACTGATGGTGGAGCAGAGG + Intergenic
946273805 2:218615714-218615736 GGTGCCAGCTGGTGGAACAGTGG + Exonic
947981821 2:234416944-234416966 GGTGAATGATGGTGGACGAGAGG - Intergenic
948840902 2:240648393-240648415 GGTCCCTGCTGGATGTCCAGTGG + Intergenic
1172013604 20:31860762-31860784 GGCCCCTCATGGTGGAGGAGAGG + Intronic
1172843315 20:37915068-37915090 GGTCCCTAATGGAGGCCCGGCGG + Intronic
1175917480 20:62433394-62433416 GGTGCCTGGGGGTGAACCAGCGG + Intergenic
1176331665 21:5553964-5553986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1176441065 21:6722117-6722139 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176465327 21:7049186-7049208 GGTCCTCGATGCTGGCCCAGCGG - Intronic
1176488888 21:7430964-7430986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1178171201 21:30041525-30041547 GGTCATTGATGGTGGAGCTGAGG - Intergenic
1179396725 21:41046946-41046968 GGTCACTGCTGCTGGTCCAGCGG - Intergenic
1179510748 21:41871600-41871622 GGTCCCAGATTGGGAACCAGAGG - Exonic
1181806374 22:25376840-25376862 GCTCCCTGAGGGTGGGCCTGGGG + Intronic
1183210776 22:36449910-36449932 GGCCCCTCATGGTGGGACAGAGG + Intergenic
1184340415 22:43882831-43882853 GGTCTATGATGGTGAACCACAGG - Intronic
950399349 3:12758739-12758761 AGTCACTGATGGTGGTGCAGAGG + Intronic
961357063 3:126345980-126346002 GGCCCCTGAGGCTGGAGCAGAGG + Intronic
968407042 4:349942-349964 GGTCCCTGATTGTGTACAACTGG + Intronic
968440016 4:618578-618600 GATCCCTGATGTTGGACGTGGGG - Intergenic
969494806 4:7520451-7520473 GGGCACTGATGGTGGAGGAGGGG + Intronic
970399387 4:15703137-15703159 GTTCCCCGATGGCGGCCCAGGGG + Exonic
970716426 4:18931104-18931126 TGTCCATCATGGTGGCCCAGAGG + Intergenic
972221086 4:36955459-36955481 GTTCCCTAAGGGTAGACCAGTGG + Intergenic
972339654 4:38140444-38140466 AGTCACTGATGGTGCACCACTGG + Intergenic
979744343 4:124191841-124191863 GGTGCCTGAAGGTGAGCCAGAGG - Intergenic
984107111 4:175561767-175561789 GGGCACAGATGGTGGACCTGGGG + Intergenic
987137912 5:14917012-14917034 GGACCCTGAAGTTAGACCAGGGG + Intergenic
989421959 5:41250647-41250669 GGTCCCAGCTAGAGGACCAGTGG - Intronic
997385943 5:133472860-133472882 GGTCCCTGAGTGTGTAGCAGGGG + Intronic
1002655803 5:180745697-180745719 GGTCCCTGAGTGTAGACCTGTGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006464267 6:34182098-34182120 TGTCCCTGATGGTGGAACAGTGG - Intergenic
1008418110 6:51266788-51266810 GGTGCCTGGTGGGGGACCACAGG + Intergenic
1015946310 6:138504667-138504689 GGTCCCTGATGGAGGATCAGAGG + Intronic
1017550149 6:155496929-155496951 GGTACATCATGGTAGACCAGAGG + Intergenic
1019309166 7:351925-351947 GGTCTCTGATGGAGGCCCACGGG - Intergenic
1019351238 7:554974-554996 GGTCCCTCATGGGGGCACAGAGG + Intronic
1021618165 7:22523828-22523850 GGTCCCTGATCGTGGAGTGGAGG + Intronic
1022501311 7:30883779-30883801 GGTCCCTTCTGGGGGAGCAGTGG + Intronic
1022694580 7:32691792-32691814 GGTCCCTGATCCTGGAGCGGAGG + Intergenic
1022927761 7:35073303-35073325 GGTCCCTGATCGTGGAGTGGAGG + Intergenic
1025812675 7:64885093-64885115 TCTCCCTCTTGGTGGACCAGGGG + Intronic
1026214048 7:68332501-68332523 GGACCCTGATAGGGGACTAGTGG + Intergenic
1026482459 7:70790414-70790436 GGTCCCGGATGGGGTCCCAGTGG - Exonic
1026982118 7:74532966-74532988 GGTGCCTGGTGGTGGGTCAGGGG - Intronic
1028374515 7:90132281-90132303 GGTCCCTGATCGTGGAGTGGAGG - Intergenic
1029864771 7:103615578-103615600 GATCCCTGATGGTCTCCCAGAGG - Intronic
1031893338 7:127320613-127320635 GGTCCCTCTTGATGGCCCAGTGG + Intergenic
1032470365 7:132174275-132174297 GGTCCCTGCTGGTAGAAGAGAGG + Intronic
1032491942 7:132330310-132330332 GGTCACTGCTGGTGTCCCAGAGG - Intronic
1032881149 7:136091866-136091888 GGTGCCTGGTGGTGTACAAGAGG + Intergenic
1034292666 7:149945264-149945286 GGTCCCTGAGGGAGGGCAAGGGG + Intergenic
1034672279 7:152867889-152867911 GGTTCCTGATGGTGGCCTTGTGG + Intergenic
1034813404 7:154151628-154151650 GGTCCCTGAGGGAGGGCAAGGGG - Intronic
1034938236 7:155213533-155213555 GGTCCCTCATGGAGGCCCAGAGG + Intergenic
1035325592 7:158064045-158064067 GGTCCCTGCTGGTGGAATTGTGG - Intronic
1036652972 8:10657305-10657327 GATCTCTGCTGGTGGAGCAGGGG + Intronic
1037752783 8:21693519-21693541 GGTCCCTGTGGGTGGAAGAGAGG - Intronic
1037882592 8:22580233-22580255 GAGCCCTGATGGTGGAGGAGGGG + Intronic
1038433934 8:27521556-27521578 GCGCCCTGCTGGTGAACCAGAGG - Intronic
1038779333 8:30557049-30557071 GGTACCTGCTGGTGGCCCTGAGG + Intronic
1039562585 8:38524854-38524876 GTTCCCTGATGCTGCAGCAGAGG + Intronic
1043914138 8:85900793-85900815 GCTCCCTGGTCCTGGACCAGGGG + Intergenic
1053344643 9:37369624-37369646 GCTCCCTGGTGGTGGAGAAGGGG - Intergenic
1056108596 9:83372279-83372301 GGTCCCAGGTGGATGACCAGGGG + Intronic
1056583193 9:87909550-87909572 GATCTCTGATGGTGGATCTGAGG - Intergenic
1057051469 9:91927427-91927449 GGACCCTGAAGGGGGACCAGGGG + Intronic
1057159483 9:92877751-92877773 GATCTCTGATGGTGGATCTGAGG - Intronic
1059383791 9:113948731-113948753 AGTCCCTGATGTTGAAGCAGTGG + Intronic
1061188792 9:129070151-129070173 GGGCTCTGGTGGTGGACAAGGGG + Intronic
1061275990 9:129569538-129569560 GGTCCCTGGTGGGAGTCCAGAGG - Intergenic
1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1186726384 X:12363564-12363586 GGTCTCTGATGGTGGCTTAGGGG - Intronic
1188676908 X:32952474-32952496 TGTCCCTGATGCTGGAAAAGTGG - Intronic
1192249252 X:69397362-69397384 TGACCCTGAAGCTGGACCAGTGG - Intergenic
1192629319 X:72763435-72763457 GGCCCCTGATGGGGGACAACTGG - Intergenic
1192652391 X:72957379-72957401 GGCCCCTGATGGGGGACAACTGG + Intergenic
1197759413 X:130016896-130016918 GGTCCCTTCTGGGGGACCAGGGG - Intronic
1200117825 X:153776886-153776908 GGTCCCAGATGGAGCAACAGTGG + Exonic