ID: 1163023193

View in Genome Browser
Species Human (GRCh38)
Location 19:14494921-14494943
Sequence CAGTGTGGCCAGCAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 627
Summary {0: 1, 1: 0, 2: 11, 3: 52, 4: 563}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163023183_1163023193 11 Left 1163023183 19:14494887-14494909 CCTGAAACTTAGCAACCCCACGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023181_1163023193 28 Left 1163023181 19:14494870-14494892 CCTCATCCTGGGAAGGGCCTGAA 0: 1
1: 0
2: 0
3: 23
4: 245
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023182_1163023193 22 Left 1163023182 19:14494876-14494898 CCTGGGAAGGGCCTGAAACTTAG 0: 1
1: 1
2: 0
3: 15
4: 187
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023186_1163023193 -5 Left 1163023186 19:14494903-14494925 CCCACGGCCACACAGAAGCAGTG 0: 1
1: 0
2: 1
3: 24
4: 166
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023185_1163023193 -4 Left 1163023185 19:14494902-14494924 CCCCACGGCCACACAGAAGCAGT 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023180_1163023193 29 Left 1163023180 19:14494869-14494891 CCCTCATCCTGGGAAGGGCCTGA 0: 1
1: 0
2: 1
3: 44
4: 301
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023187_1163023193 -6 Left 1163023187 19:14494904-14494926 CCACGGCCACACAGAAGCAGTGT 0: 1
1: 0
2: 1
3: 16
4: 175
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563
1163023179_1163023193 30 Left 1163023179 19:14494868-14494890 CCCCTCATCCTGGGAAGGGCCTG 0: 1
1: 0
2: 2
3: 31
4: 325
Right 1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG 0: 1
1: 0
2: 11
3: 52
4: 563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163023193 Original CRISPR CAGTGTGGCCAGCAGGAGGA GGG Intronic
900242445 1:1623516-1623538 AAGTGGGGCCAGCAGGACGGCGG + Exonic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
902035064 1:13451945-13451967 CAGTGTGGCCATCTGAAAGATGG - Intergenic
902289931 1:15429116-15429138 CGGTGCGGCCTGCTGGAGGAGGG - Exonic
902416773 1:16244383-16244405 CAGGTAGGCCAGCTGGAGGATGG + Intergenic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
902883448 1:19388068-19388090 CAGTGTGCCTGGCAGGAGAAGGG - Intronic
903323631 1:22556828-22556850 CAGTGTGGCTAGCGGCTGGAAGG + Intergenic
903798629 1:25949632-25949654 CACTGCGCCCAGCATGAGGATGG + Intergenic
904598569 1:31661677-31661699 CAGGGGGGCCAGCAGGACCAGGG + Exonic
904703916 1:32376388-32376410 CGGTGTGGCCAGCAGGCGTTAGG + Exonic
904845812 1:33414303-33414325 CAGTGTGGCCAGCAAGGACAGGG + Intronic
905019076 1:34796037-34796059 CAGTGTGGCCAGGGCGACGATGG - Intronic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
906036346 1:42752434-42752456 AACTGTGGCCAGGAAGAGGAAGG + Intronic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
906868409 1:49448517-49448539 CACTGTGGCCAGGAGAAGTAGGG + Intronic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907400884 1:54224048-54224070 CAGGGTGCCTAGCTGGAGGAAGG - Intronic
907848800 1:58234553-58234575 AGGTGGGCCCAGCAGGAGGAGGG - Intronic
908498836 1:64722675-64722697 CAGTGGAGCGAGCAGGAAGATGG + Intergenic
911002409 1:93180192-93180214 CAGAGCGGCCAGAAGGAGCACGG + Exonic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
912754207 1:112310774-112310796 GAGTGTGGCCAGCAGGGGCACGG + Intergenic
912949853 1:114113130-114113152 GAGTGTGGGGAGCAGGAGGTGGG - Intronic
914239907 1:145846401-145846423 CAGTGGGGCCAGTAGGTGAATGG - Intronic
915267743 1:154731095-154731117 CAGGGTTGCCAGTAGGTGGATGG - Intronic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
915466362 1:156100614-156100636 AGGTGGGGCCTGCAGGAGGAAGG + Intronic
915550168 1:156627806-156627828 CAGCTCAGCCAGCAGGAGGATGG + Intergenic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
919249089 1:195030069-195030091 CAATGTGGCTAGCAGGAGTTGGG + Intergenic
919545656 1:198914957-198914979 CAGGGTAGCTAGCAGTAGGAGGG - Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920106448 1:203556631-203556653 CACTGTGGCATGCAGGAGGTGGG - Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
921890617 1:220350084-220350106 CAGGCTGTCAAGCAGGAGGAGGG + Intergenic
922059461 1:222073960-222073982 CAGCTTGGCCATCAGGATGATGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
923918045 1:238530547-238530569 CAGAGTGGGCACCAGGAGCAGGG + Intergenic
924022476 1:239798981-239799003 AAGTGTAGCTAGCAGGAGGCAGG + Intronic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062982997 10:1741121-1741143 CTGTGTGGTCAGCCGCAGGAAGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064015938 10:11772391-11772413 CACTGGTGTCAGCAGGAGGAGGG - Intergenic
1064681563 10:17815525-17815547 TAGGGCGGTCAGCAGGAGGAAGG + Intronic
1065944899 10:30597344-30597366 CAGTGTAACCAGCAGGAGTTGGG + Intergenic
1067448830 10:46368954-46368976 CAGTGAGGGCGGCAGCAGGAAGG - Intergenic
1067588542 10:47491811-47491833 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067635668 10:47999902-47999924 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067753928 10:48989794-48989816 CTGTGTGGCCAACATCAGGAAGG + Intergenic
1068710123 10:60124727-60124749 CCTAGTGGCCAGCAGGAGAATGG + Intronic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069032909 10:63617054-63617076 CAGTGTGGCAAGGAAGGGGATGG - Intronic
1069362433 10:67657947-67657969 CAGTTTGCCCAGCAGAGGGAGGG + Intronic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070260949 10:74855207-74855229 CAGTGAGGCCTGCAGGAAGGAGG + Intronic
1070323711 10:75373908-75373930 AGGTGTGGCCAGCAGCAGAAGGG + Intergenic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1071525235 10:86354505-86354527 ACGTATGGCCAGCAGGAGGGAGG - Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072622173 10:97087344-97087366 CAGGGAGGCAAGCCGGAGGATGG - Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073425965 10:103455712-103455734 CAGAGTGGTCAGCAGCACGAAGG + Exonic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074997490 10:118770426-118770448 ATGGCTGGCCAGCAGGAGGATGG + Intergenic
1075717554 10:124565857-124565879 CAGTGGGGACAGGAGGGGGAAGG + Intronic
1075895309 10:125989938-125989960 CGGTGGGGACAGCAAGAGGATGG - Intronic
1076059219 10:127400488-127400510 CTATGTGGCCATCAGGAGCAAGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076620082 10:131781392-131781414 GAGTGTGGTCACCAGAAGGAAGG + Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1076818494 10:132926287-132926309 CCGTGGGGGCTGCAGGAGGAGGG + Intronic
1076883465 10:133250988-133251010 CGATGGGGCCAGCAGGAAGACGG - Intergenic
1077166105 11:1139698-1139720 AGGAGGGGCCAGCAGGAGGAAGG + Intergenic
1077192603 11:1261729-1261751 CGGGGTGGGCAGCAGGAGCACGG - Exonic
1077217607 11:1401543-1401565 CAGTGCAGCCTGCAGGAGGTGGG - Intronic
1077353871 11:2105721-2105743 CTGAGAGGCCAGCAGGACGAAGG + Intergenic
1077358047 11:2127682-2127704 CAGTGGGGACAGGAGCAGGAGGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077798404 11:5514949-5514971 CTCTGTGGCCAGCAGCTGGAGGG + Exonic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1078521730 11:12069126-12069148 CACTGTGCCCAGCTGGAAGAGGG - Intergenic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1078673642 11:13388866-13388888 CACTGTTGCCAGAAGGGGGATGG + Exonic
1079129485 11:17738941-17738963 CACTGAGGCCCGTAGGAGGAGGG + Intronic
1079254054 11:18811271-18811293 GAGAGTGGGCAGCTGGAGGATGG + Intergenic
1079274977 11:19027003-19027025 AAGTGTGGCAAGGAGGTGGAGGG + Intergenic
1079444183 11:20545063-20545085 TAGTGTGGGCAGGAAGAGGAGGG - Intergenic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080815468 11:35752296-35752318 AAGAGTGGCCAACAGGAAGAAGG - Intronic
1081190153 11:40094207-40094229 CAGTGTAGCCAGTGGAAGGAAGG + Intergenic
1081741391 11:45443411-45443433 CCGTGCTGCCAGCAGGAGAAAGG + Intergenic
1081836588 11:46160414-46160436 CACTGCTGCCAGCAGGTGGAGGG - Intergenic
1081856171 11:46305170-46305192 CAGTGTGGCCACCATGAACAGGG + Intronic
1081856744 11:46308719-46308741 CCGTGTGGCCAGCAGGGGGCAGG - Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083320493 11:61842961-61842983 CAGTGCAGCCAACAGGAAGAAGG - Intronic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083727693 11:64637036-64637058 TAGTGAGGCCAGCAGGGGGTTGG + Intronic
1083756057 11:64792232-64792254 CAGGGCGGCCAGCAGGAAGGTGG + Exonic
1083835821 11:65266599-65266621 CAGTATGGACAGAATGAGGAGGG + Exonic
1083882501 11:65555456-65555478 CAGTGTCTCCACCAGGAGGGAGG + Intronic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1084713818 11:70860998-70861020 CCGTGTGCCCAGCAGGTCGAGGG - Intronic
1084875459 11:72129064-72129086 CAGTGTGGCCAGCAGTGAGCTGG - Intronic
1085215789 11:74829838-74829860 CACTGGGGCCTGCAGGAGAATGG + Intronic
1085519792 11:77131138-77131160 CACTGTGGCCCTCAGTAGGAAGG - Intronic
1086271617 11:85074091-85074113 GAGTGTGGAGAGTAGGAGGAAGG + Intronic
1086589343 11:88493795-88493817 CAGCATGGCAAGCAGGAGAAAGG + Intergenic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1088332205 11:108665503-108665525 CAGTGTGGCAAGCAGAAGAGTGG - Intronic
1088720116 11:112584811-112584833 CAGCGTGGCAAGCAGTGGGAGGG + Intergenic
1088812971 11:113403945-113403967 GAGAGTGGCCAGCTGAAGGAGGG + Intergenic
1088816485 11:113424394-113424416 CAGTGTGGCGACGAGGAGGTCGG + Exonic
1089336210 11:117725657-117725679 CAGAGAGGTCTGCAGGAGGAGGG + Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089608080 11:119653416-119653438 CAGTGTCCCCTGCAGGAGGGTGG + Intronic
1090104792 11:123841270-123841292 CAGTGAGGTCAGGAGGATGAGGG + Intergenic
1090388229 11:126368963-126368985 CAGTTTGGCAAGTAGGGGGAGGG + Intronic
1090390965 11:126386942-126386964 CAGTTTGGCAAGTAGGAGGAGGG + Intronic
1090460099 11:126883477-126883499 CAGAGTTGCCAGCATGAGTAAGG - Intronic
1090789348 11:130076944-130076966 GCATGTGGCCAGGAGGAGGAGGG + Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1092273831 12:7044210-7044232 CAGTGTGCACAGCAGCAGGGAGG - Intronic
1093573415 12:20695751-20695773 CAATGTGCTCAGCAAGAGGATGG - Exonic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1095974340 12:47929023-47929045 CAGCGTGGCCAGTAGGGAGAGGG + Intronic
1096146936 12:49284924-49284946 GAGTGAGGCCAGCAGGACTAGGG - Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1100823861 12:98456867-98456889 CAGCGTGAGCAGCAGGATGAAGG + Intergenic
1101580970 12:106040493-106040515 CAGGGTGGGCACCAGGAGCAGGG + Intergenic
1101624540 12:106426110-106426132 CAGTGCTGCTGGCAGGAGGAGGG - Intronic
1101973398 12:109333586-109333608 GACTGTGGCCAGCATGAGGAGGG + Intergenic
1102087403 12:110153953-110153975 CAGTGTGGCCATCAGGACCAGGG + Intronic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102478254 12:113202665-113202687 CAGTCTAGCCAGCAGGAAGGAGG - Intronic
1102765214 12:115426975-115426997 CAGTGAGGTCAGCAGCAAGAAGG + Intergenic
1102855993 12:116294251-116294273 CTCTGTGGCCAGCAGGAGCTTGG + Intergenic
1103303544 12:119946389-119946411 CACTGTGGGCAGCAGGAGCTCGG - Intergenic
1104653625 12:130556795-130556817 CAGTGTGGAGAGGAGCAGGAAGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1104958955 12:132479118-132479140 CAGAGTGGGCCGCAGGAGGCCGG + Intergenic
1105274055 13:18904574-18904596 AAGGGTGGCGAGTAGGAGGAAGG - Intergenic
1105787762 13:23766788-23766810 AGGTGTGACCATCAGGAGGATGG - Intronic
1106099136 13:26679339-26679361 AAGGGTGCCCATCAGGAGGACGG - Intronic
1106158966 13:27183680-27183702 AAGTGTGGCCTGTGGGAGGAGGG - Intergenic
1107040821 13:35945410-35945432 CAGCCTGGCCAGCAGGGAGAAGG + Intronic
1107271875 13:38628838-38628860 CTCTGTGGCTAACAGGAGGAAGG - Intergenic
1110810505 13:79807033-79807055 CAGAATGGCCACCAGGAGGGAGG + Intergenic
1113267220 13:108633062-108633084 CATTGTTTGCAGCAGGAGGAAGG + Intronic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113753977 13:112796253-112796275 TAGTGTGGCAGGCAGAAGGATGG + Intronic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1113902439 13:113804500-113804522 CAGTGTGACTAGCAGGTGGCGGG + Intronic
1114655008 14:24310738-24310760 CAGCGCCGCCAGCAGCAGGAAGG - Exonic
1114980599 14:28158518-28158540 CAGAGTGGGCACCAGGAGCAGGG + Intergenic
1115305487 14:31929747-31929769 CAGTGTTACCAGCAGGATTAAGG - Intergenic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1121173150 14:91871004-91871026 CAGGGTGGGAGGCAGGAGGAGGG + Intronic
1121583218 14:95046001-95046023 TGCTGTGGCCAGCAGGTGGATGG + Intergenic
1121814702 14:96920382-96920404 CAGTGAGGCCACCAGCAAGAGGG + Intronic
1122295086 14:100700941-100700963 CCTAGTGGCCAGCAGGAAGAGGG + Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1123468206 15:20531416-20531438 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1123649909 15:22469648-22469670 CACTGTGTCCAGCCGGGGGAAGG - Intergenic
1123728522 15:23126626-23126648 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1123740312 15:23278467-23278489 CACTGTGTCCAGCCGGGGGAAGG - Intergenic
1123746686 15:23324091-23324113 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1124278954 15:28347407-28347429 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1124303745 15:28564201-28564223 CACTGTGTCCAGCCGGGGGAAGG - Intergenic
1126363535 15:47870763-47870785 GGTTGTGCCCAGCAGGAGGAGGG - Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128470537 15:67948236-67948258 CACTGGGGCCTGTAGGAGGATGG - Intergenic
1128757282 15:70191575-70191597 CAGCATGGCCAGGAGGAGGCGGG + Intergenic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1128939554 15:71777332-71777354 CCGTGTGGCCAACAGGCAGACGG + Exonic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129710804 15:77819499-77819521 CATCGTGGCGAGCAGGAGGCAGG - Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130025496 15:80267414-80267436 CAATGTGACAATCAGGAGGATGG - Intergenic
1130226229 15:82060199-82060221 CAGTGGGGCCTGCAGTTGGAAGG - Intergenic
1130895080 15:88163667-88163689 TAATGTGGCCAGAAGGAGGCAGG + Intronic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132588386 16:715862-715884 CGGCGTGGCCTGCAGGAAGAGGG - Exonic
1132908511 16:2296744-2296766 CAGTGTGGTCAGCAGTAGGCTGG - Intronic
1133431379 16:5739989-5740011 CAGTGTGGCCAGCAGTGGGAGGG + Intergenic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1133977397 16:10609168-10609190 CAGTCTGGCCAGCAGGGAGTGGG + Intergenic
1134070182 16:11255840-11255862 CAGCCTGGCCAGCAGGCGGCGGG - Intronic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135865719 16:26099978-26100000 CTGTGTGGCTATCTGGAGGAAGG + Intronic
1136065787 16:27757411-27757433 GAGTGTGGTCACCAGAAGGAAGG + Intronic
1136476962 16:30519536-30519558 CAGTGTGGCTAACAGGCAGAGGG + Intronic
1137068895 16:35881228-35881250 CATGGTGGCCAGAAGGAGGTAGG - Intergenic
1137529222 16:49266540-49266562 CAGTGTGTCTTGCAGGAGAAAGG - Intergenic
1138008890 16:53360121-53360143 CACTGTGTCCAGCCGGGGGAAGG + Intergenic
1139517281 16:67459468-67459490 CAGTGTGGCCAGCCTGAGTCTGG - Intronic
1139923440 16:70473324-70473346 CAGCGTGGCCAGCAGGGGCCCGG - Exonic
1139958387 16:70704170-70704192 CAGGGTGGGCAGGAGGAGTAAGG + Intronic
1140220695 16:73041667-73041689 CAGTGTGTGCGGCAGGAGGTTGG - Intronic
1140664503 16:77215084-77215106 CAGTGTTGCCAAAAGGCGGAAGG + Intergenic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141224502 16:82102169-82102191 CAGTGCTGCCAGCAGGAAAATGG + Intergenic
1141461346 16:84180252-84180274 CAGTCGGGCCAGCAGGAGCGGGG + Exonic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1141992506 16:87618574-87618596 CAGTGTGGCCAGGTGGAAAAAGG - Intronic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142172582 16:88630642-88630664 CAGGGAGGCCAGCAGCAGCAGGG + Intronic
1142196817 16:88742805-88742827 CAGTGGGGGCTGCAGGTGGATGG + Intronic
1142401294 16:89860100-89860122 AGGTGTGGACTGCAGGAGGAGGG + Intronic
1142441440 16:90100882-90100904 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1142814546 17:2414980-2415002 CAGTGCTGCCCGCAGGAGGCAGG + Intronic
1142869317 17:2809921-2809943 CAGAGGAGCCAGCGGGAGGAAGG - Intronic
1142878117 17:2864592-2864614 CGGTGTGGGGAGCAGGAGGCTGG + Intronic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143561899 17:7701456-7701478 CAGCGTGGCCAGCAGCAGCCGGG + Exonic
1144100395 17:11937584-11937606 CAAAATGGCCAGCAGGAGAAAGG - Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146546924 17:33748131-33748153 GAGTGTGGCCGGCAGAAGGGTGG - Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1146935659 17:36811180-36811202 GAGTGTGGGGAGCAGGAGGGAGG - Intergenic
1147381331 17:40057976-40057998 CACTATGGGCAGCAGGTGGATGG + Intronic
1147608774 17:41789126-41789148 CAGGGTGACAAGCAGGTGGATGG - Intergenic
1147646544 17:42037842-42037864 CAGGGAGGCCAGCAGGGGGCTGG + Exonic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1148686133 17:49502212-49502234 GAGGGTGGCGGGCAGGAGGAGGG + Intronic
1149418545 17:56485879-56485901 CAGTAGGTCCAGCAGGAGGCTGG + Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1151181183 17:72329792-72329814 CACAGTGGCCAGAAGGAAGATGG - Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152216171 17:79033952-79033974 GGGCGGGGCCAGCAGGAGGAGGG + Intronic
1152261570 17:79270054-79270076 GAGGGTGGCAAGAAGGAGGAAGG - Intronic
1152318907 17:79597047-79597069 ACGTGTGGCCAGCAGGAGGGAGG - Intergenic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1153641607 18:7162540-7162562 CAGCCTTGGCAGCAGGAGGAAGG - Intergenic
1153749818 18:8217621-8217643 CAGTGTAGCCAGCCTGCGGAAGG - Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1153813143 18:8769671-8769693 CAGCCTGGCCAGCAAGTGGAAGG - Intronic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153976100 18:10269718-10269740 AAATGTGGGCAGCAGGAGTAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155919089 18:31585024-31585046 CACTGGGGCCTGCTGGAGGAGGG - Intergenic
1155986861 18:32239074-32239096 CCCTGTGGCCAGGAGGGGGATGG + Intronic
1156954266 18:42942699-42942721 GAGTGTGGCCAGCAATGGGATGG + Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1157445030 18:47738140-47738162 CAGTGTGGGCAGCAGCTGCATGG - Intergenic
1157506588 18:48230874-48230896 CAGAGTGGGCACCAGGAGCAGGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1157695950 18:49723757-49723779 CAGTGTGGGATGCAGGAGAAGGG + Intergenic
1160345599 18:78129345-78129367 CTGTGTGGCCTGCAGGACCATGG - Intergenic
1160526261 18:79540209-79540231 CACTGTGGACAGCGGGATGAGGG + Intergenic
1160527966 18:79548284-79548306 CAGCAGGGCCAGCAGGTGGAAGG - Intergenic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161303255 19:3553208-3553230 CAGACTGGCCAGCAGGAACAGGG - Intronic
1161373972 19:3929431-3929453 CAGCCAAGCCAGCAGGAGGAGGG + Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1161894439 19:7069662-7069684 CAGTGTGGCTAGCCGGAGACCGG + Exonic
1162132760 19:8537026-8537048 CAGTGTGGCCACCAGGTCGTTGG + Exonic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162695060 19:12467856-12467878 CAGGGTGGCTGCCAGGAGGAGGG - Intronic
1162743468 19:12786347-12786369 CAGTGGGGCCAGCAGGGAGGGGG + Intronic
1162746478 19:12801540-12801562 CAGTGAGGCCCGCACGAGCAGGG + Intronic
1162916011 19:13874802-13874824 CAGAGTCACCGGCAGGAGGATGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163564698 19:18043966-18043988 CACTCTGGCCAGGAGCAGGAAGG - Intergenic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164682401 19:30144687-30144709 GGGTATGGCCTGCAGGAGGAGGG + Intergenic
1165007518 19:32818741-32818763 CGTTGTAGCCAGCAGGTGGAGGG + Intronic
1165758162 19:38305840-38305862 CCGTGTGGCCAGCATAAGGGGGG - Intronic
1166099363 19:40562064-40562086 CACTGTGGCCAGATGGAGGGAGG + Intronic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167498112 19:49830918-49830940 AGCTGTGGACAGCAGGAGGAAGG - Intronic
1167674909 19:50877935-50877957 CACTGAGGCCAGATGGAGGATGG - Intronic
1167761494 19:51452668-51452690 CAGTGGGGCCAGGATGAGGCAGG + Intronic
1167810276 19:51823796-51823818 CGGTGTGGCCAGCAGGCTCAGGG - Exonic
1168298535 19:55389845-55389867 GAGTGAGGCCAGCTGGAGGTGGG - Intronic
1168332524 19:55578653-55578675 CAGCGGGGCCAGCAGGCTGAGGG + Exonic
1168611284 19:57802576-57802598 CACTGTGGCCTTCAGGATGAGGG + Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925016594 2:531798-531820 CAGTGTTGCAAACAAGAGGATGG + Intergenic
925130640 2:1491922-1491944 CACTGTGGACAGCAGGAGTCAGG + Intronic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
926115230 2:10208974-10208996 CAGTTTGGCCACCAGGAGACAGG - Intronic
926429732 2:12773690-12773712 AAGTGTGGCTAGCAAAAGGAAGG + Intergenic
927940981 2:27102583-27102605 GAGTCTGGCCTGGAGGAGGAAGG + Exonic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928820619 2:35356443-35356465 CAGAGTGGACACCAGGAGCAGGG + Intergenic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
930271608 2:49263848-49263870 CAGTGTGCCTAGCAGGATGCTGG - Intergenic
931251691 2:60536683-60536705 CGGTGTTGCCAGCAGGGGGGTGG - Intronic
931447225 2:62336716-62336738 CATTGTGGCCATCAGGAGGACGG - Intergenic
932166610 2:69513610-69513632 CACTGTGCCCAGCAGAAAGATGG + Intronic
933759429 2:85663737-85663759 CAGCGTGTCGAGCAGGATGACGG + Exonic
933977974 2:87527394-87527416 CAGTGGGGTCTGCAGCAGGAAGG - Intergenic
935112075 2:100103997-100104019 CGGTGGTGCCAGCCGGAGGAGGG + Intronic
935530697 2:104229579-104229601 CACTGTGGCCACTTGGAGGAAGG - Intergenic
936049849 2:109214348-109214370 CTGTGGGGGCAGCAGGAGGCCGG + Intronic
936122897 2:109761154-109761176 CGGTGGTGCCAGCCGGAGGAGGG - Intergenic
936221791 2:110610310-110610332 CGGTGGTGCCAGCCGGAGGAGGG + Intergenic
937152324 2:119694583-119694605 CAAAGGGGCCAGGAGGAGGATGG - Intergenic
939466326 2:142561849-142561871 CAGAGTGGGCACCAGGAGCAGGG - Intergenic
940043852 2:149388898-149388920 CAATGTGCCCAGCATTAGGAAGG - Intronic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
942944279 2:181656637-181656659 CAGTGAGGCGAGCACGGGGAGGG + Intronic
942995800 2:182258256-182258278 CAGTTTGGAGAACAGGAGGAAGG + Intronic
943788321 2:191902609-191902631 CAGCTTGGGCAGCAGGAGTATGG - Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948219675 2:236259682-236259704 CAGTGAGCCCAGCAGGATGTTGG + Intronic
948428131 2:237901581-237901603 GAATGTGGCCAGCAGGAGGGAGG + Intronic
948698383 2:239745560-239745582 GAGTGTGACCACCTGGAGGACGG - Intergenic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1170573016 20:17642950-17642972 GAGCATGGCCAGCAGGAGGGTGG + Intronic
1171467099 20:25337317-25337339 CAGTGTGGCAAACAGGTGGAAGG + Intronic
1172563959 20:35913579-35913601 CAGTGTGCCCTGCTGCAGGATGG + Intronic
1173033048 20:39380087-39380109 GATCATGGCCAGCAGGAGGAAGG - Intergenic
1173113840 20:40221504-40221526 CAGTGTGGGCTGCAGTATGATGG + Intergenic
1173321755 20:41993716-41993738 CAGTGTGGAAAGCAAGAAGAAGG - Intergenic
1173698930 20:45049175-45049197 GAGGGTGGCCAGCAGCTGGAGGG + Intronic
1173836369 20:46128718-46128740 TGGTGTGGCCAGCAGGGGGCAGG + Intronic
1174052015 20:47773497-47773519 CAGTGTGGCCCACAGGAGGCTGG + Intronic
1174182045 20:48681089-48681111 CAGTGTGGCCCGCAGGAACATGG - Intronic
1174481235 20:50832974-50832996 AAGTGTGGGCAGCAGAACGATGG - Intronic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175669447 20:60889564-60889586 GTGTGAGGCCAGCAGAAGGATGG - Intergenic
1176808825 21:13516768-13516790 AAGGGTGGCGAGTAGGAGGAAGG + Intergenic
1178871204 21:36378088-36378110 CACTGGGGCAAGCAGGGGGAGGG + Intronic
1179377395 21:40862854-40862876 GAGTGTGGGAAGCAAGAGGAGGG + Intergenic
1179409665 21:41153048-41153070 CAGAGTGGCCAGCAGGATGTGGG + Intergenic
1179571657 21:42282165-42282187 CGGTGTGTCCAGCAGGCTGAGGG + Intronic
1179912159 21:44456123-44456145 CAGGGTGGACGCCAGGAGGACGG - Intronic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180073534 21:45450403-45450425 TAGGGTGGCCAGAAGCAGGAGGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1180639578 22:17287580-17287602 CAGTGTGGCAAACAGCAGGGAGG - Intergenic
1181167734 22:20992510-20992532 CAGCCTGGCCAGCAGGGTGAGGG - Intronic
1181318816 22:21989096-21989118 AAGTGGGTGCAGCAGGAGGAAGG + Intergenic
1181562703 22:23714984-23715006 CAGTGAGGCCAGGAGCAGGCAGG - Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1182146342 22:27999062-27999084 CAGTGTGGCCACCAAGGAGAGGG - Exonic
1183033203 22:35120894-35120916 CAGTGAGGAGAGCAGAAGGAGGG + Intergenic
1183064280 22:35352805-35352827 CAGGCTGGCCAGCAGAGGGAAGG + Intergenic
1183261495 22:36798578-36798600 CTGTGTGGAATGCAGGAGGAGGG - Intergenic
1183347867 22:37317946-37317968 CAGTGGGGCCAGTAGGAGACAGG + Intergenic
1183422960 22:37723057-37723079 CAGTGAGACCTGTAGGAGGAGGG + Intronic
1183494609 22:38135483-38135505 CAGTGTGGTAAGGAGGTGGAGGG - Intronic
1183754399 22:39746734-39746756 CTGGGAGGCCAGCAGGGGGAGGG + Intronic
1184021797 22:41826200-41826222 CAGTGGGGCCAGCAGCAGGGTGG - Exonic
1184330216 22:43822310-43822332 CTGGCTGGCCGGCAGGAGGATGG + Intergenic
1184402346 22:44281326-44281348 TAGGGAGTCCAGCAGGAGGACGG + Intronic
1184689838 22:46112530-46112552 CATTGTGGCCAGCACCAGCAGGG - Intronic
1184783137 22:46658967-46658989 CAGTGCCGCCAGCAGGAAGCAGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185357730 22:50384637-50384659 CAGTGTCCCCAGCAGCAAGAAGG - Intronic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
952866000 3:37855551-37855573 CATTGTGGCCACCAGGGGGCGGG + Intergenic
953289711 3:41649309-41649331 CTGTGGGGCCAGCAAGAGGCAGG + Intronic
953417697 3:42732357-42732379 GAGTGTTGACAGCAGGAGCATGG + Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954147698 3:48642391-48642413 CAGTGGGGCCAGCATGAGCCTGG + Exonic
954301163 3:49701573-49701595 CAGTGGGGCCACCAGGTGGTGGG - Exonic
954370733 3:50168501-50168523 GGGTGTGCCAAGCAGGAGGAAGG + Intronic
954410223 3:50367358-50367380 CAGTGTGCCCAGCAGCAGGCAGG - Intronic
954868844 3:53751583-53751605 GAGTGGTGCCAGCAGCAGGAAGG + Intronic
956210854 3:66799767-66799789 CTATGGGGCCAGCAGGAAGAAGG - Intergenic
957196284 3:77072370-77072392 TAGTGTGGGCGGCAGGAGGAGGG - Intronic
958140654 3:89558468-89558490 CAGTGTGGCCTTTAGGAGAAGGG - Intergenic
959268749 3:104177321-104177343 GAGAGTGGAGAGCAGGAGGAGGG - Intergenic
959500805 3:107103954-107103976 CAATGTGGTCAGCAGGTTGACGG - Intergenic
961029243 3:123587521-123587543 CAGTTTGGCAGGCAGGAGGCTGG + Intergenic
961192092 3:124970527-124970549 CTGAGTGGCAAGCAGGAAGAGGG - Exonic
961339992 3:126211637-126211659 CAGTGAGGCCCACAGGAGGTAGG - Intergenic
961380870 3:126495859-126495881 CAGTGTGGCCACCATGGGGCTGG + Intronic
961467982 3:127092919-127092941 GGGTGTGGCCGGCAGGAGGCAGG - Intergenic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961677937 3:128578938-128578960 CAGTGGGGACAGCTGCAGGATGG + Intergenic
962197345 3:133375840-133375862 CAGAGTGGGCAACAGAAGGAGGG - Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962713056 3:138103583-138103605 CAGCGTGGTCAGCAGGAGCTGGG - Exonic
963906236 3:150775221-150775243 CTGTGAGGCCAGCAGGAGCTGGG - Intergenic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964229625 3:154449766-154449788 CAGTGGGGCCTGTAGGGGGAGGG - Intergenic
968089681 3:195892429-195892451 CAGTCTGGCCAGGAGAGGGAAGG + Intronic
968519404 4:1028881-1028903 GAGTGTGGCCAGCAGGACAGAGG + Intergenic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968661409 4:1800240-1800262 CAGGGTGGCTGGCAGGAGGGTGG + Intronic
968965433 4:3766893-3766915 CAGCGTGGCCACCAGGATGTCGG - Exonic
968983278 4:3862496-3862518 CAGTGGGGGCAGAAAGAGGAGGG - Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969327354 4:6451735-6451757 CACTGAGGCCGGGAGGAGGAGGG - Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969892181 4:10270061-10270083 CAGCATGGCCAGCAGCAGCATGG + Intergenic
970180510 4:13387078-13387100 CACTGTGGCCTACAAGAGGATGG + Intronic
971899689 4:32643509-32643531 GAGTGTGGAAGGCAGGAGGAGGG + Intergenic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
972801546 4:42481216-42481238 CAGAGTGGCCAACAGAAGGAAGG + Intronic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973555794 4:52081418-52081440 CCCTGAGGCCAGAAGGAGGAGGG - Intronic
974697865 4:65398190-65398212 CAGAGTGGGCACCAGGAGCAGGG - Intronic
974712694 4:65621308-65621330 CACTGTGGCCAGAAGTGGGATGG + Intronic
975484817 4:74924123-74924145 CAGTTTGGCCAGGAGTGGGAGGG + Intergenic
975590817 4:75998077-75998099 CAGTGTGGCCAGGAGGATTCTGG + Intergenic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
980009738 4:127581639-127581661 CAGTTTGGCCAGCTGAAGGGCGG + Intergenic
980582590 4:134773527-134773549 CAGAGTGGACACCAGGAGCAGGG - Intergenic
981265044 4:142772536-142772558 CAGTGTGGGCAGTAGCAGGAAGG + Intronic
981484979 4:145276373-145276395 CATAGTGGCCAGCAGAAGGCAGG + Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG + Intergenic
983528295 4:168783383-168783405 CAGTTTGGTCTTCAGGAGGAGGG + Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
985106097 4:186501496-186501518 CAGTGTGGCTCCCAGGAGAAAGG - Intronic
985724704 5:1509915-1509937 AGGTGAGGCCTGCAGGAGGAGGG + Intronic
987036446 5:14023693-14023715 CAGTGAAGCCAGCAGGACCAAGG + Intergenic
987322486 5:16783636-16783658 CAATGTGGCCAGCAGGAGAAAGG - Intronic
987909821 5:24126792-24126814 CAGTTTGGGTATCAGGAGGATGG + Intronic
991004179 5:61811677-61811699 CAGGGTGGCAAGCCAGAGGAGGG + Intergenic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992697365 5:79303349-79303371 CACTGTGCCCAGCCTGAGGAGGG + Intronic
993783158 5:92094956-92094978 CACTGGGGCCTACAGGAGGACGG - Intergenic
994406583 5:99352757-99352779 CACTGTGGACAGCAGGTTGATGG - Intergenic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
997317412 5:132949116-132949138 CAGTGGGGCAATCAGTAGGAAGG + Intronic
997600207 5:135133922-135133944 AGGTGTGGTGAGCAGGAGGAGGG + Intronic
998690244 5:144580190-144580212 CAGTCTGGCAACCAGGAGGGAGG - Intergenic
999136156 5:149320756-149320778 CAGAGTGGTAAACAGGAGGAGGG - Intronic
999261142 5:150239623-150239645 CAGTGCAGCCTGCAGGAGGGAGG + Intronic
999370447 5:151052111-151052133 GAGTGGGGGCTGCAGGAGGAGGG - Intronic
1000091481 5:157933062-157933084 TAGAGTGGGCAGCAGGAGGCTGG + Intergenic
1000494764 5:161967975-161967997 CAGTGTGGCAAGAACGAGGATGG - Intergenic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002571686 5:180143232-180143254 CAGTGAGGCCTCCAGAAGGAAGG - Intronic
1002644344 5:180645830-180645852 CAGTGTGTCCAGCTGGAGCCAGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1003380675 6:5621892-5621914 CAGACTGGCCAGCAGAAGGAAGG - Intronic
1003667111 6:8121682-8121704 CAGTGTGGGCAGCAGGCACATGG - Intergenic
1003980013 6:11380576-11380598 CAGTGAGGCCTGGAGGAGGGAGG + Intronic
1004583763 6:16979558-16979580 CCCTGTGGCAAGCAGGAGCATGG - Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1006147215 6:31966866-31966888 CAGTGTGTGGAGCAGGAGGTTGG + Intronic
1006518096 6:34555734-34555756 CAGTCTGGGGAGCATGAGGAGGG + Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006931578 6:37692183-37692205 AGATGTGGCCAGCAGGGGGAGGG - Intronic
1006934192 6:37705836-37705858 CAGCGTGGCCTGCAGGAGTGGGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1011227803 6:85127017-85127039 CAGTGTGGCCACCATGGGGCTGG + Intergenic
1013455611 6:110326807-110326829 GAGTTTGGCCAACAGGAGGCAGG - Intronic
1014842373 6:126235685-126235707 CAGTGGGGCCTGTTGGAGGATGG + Intergenic
1015098209 6:129442670-129442692 GAGGGTGGAGAGCAGGAGGAGGG - Intronic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1018365005 6:163110987-163111009 CAGAATGTCCAGCAGGAAGAGGG - Intronic
1018978543 6:168583684-168583706 CAGCATGGCCAGCAGGAGGTTGG - Intronic
1019047771 6:169161574-169161596 GAGTTTGGACAGCTGGAGGATGG - Intergenic
1019253983 7:36864-36886 CTGTGTGGGCAACAGAAGGAAGG + Intergenic
1019472270 7:1227363-1227385 GAATGTGGCCAGGAGGAGAAGGG - Intergenic
1020012681 7:4815296-4815318 GGGTGTGGCCAGCAGGTTGAGGG + Exonic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020847617 7:13306909-13306931 CAGTGGGGCCAGTTGGGGGATGG + Intergenic
1021343159 7:19489215-19489237 CACTGTGGACAGCAGGTTGATGG - Intergenic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1021890380 7:25180668-25180690 CAGTGTGGCCAGATAGAGGGTGG + Intergenic
1022181953 7:27929302-27929324 TGCTGTGGCCAGCAGGGGGAGGG + Intronic
1023177662 7:37448915-37448937 GTCTCTGGCCAGCAGGAGGAAGG - Exonic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1024045162 7:45580770-45580792 GAGTGTGGCCACCAGGAGGTGGG + Intronic
1024064166 7:45718879-45718901 CAGTGGGCTCAGCAGAAGGAAGG + Exonic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024331504 7:48159988-48160010 CAGGAAGGCCAGCAGGAAGAAGG - Intergenic
1024354774 7:48403291-48403313 CAGTGTGGTCAGAAGAAGCAAGG - Intronic
1024563573 7:50664036-50664058 GAGCATGGCCAGCAGGAGCATGG - Intronic
1024769261 7:52698944-52698966 CAGTGGGGCCTACAGGAGGTTGG - Intergenic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025263510 7:57438298-57438320 TTGTGGGGCCAGCAGGAGTAAGG + Intergenic
1025740629 7:64192856-64192878 TTGTGGGGCCAGCAGGGGGAAGG + Intronic
1025928990 7:65980199-65980221 CAGTGCGGCCAGGAGCAGGCAGG - Intronic
1026014939 7:66665466-66665488 CAGTGTGTCCTGCTGGGGGATGG + Intronic
1028814893 7:95132571-95132593 CAGTTTGGTGAGCAGGAGGGAGG + Intronic
1029468336 7:100740139-100740161 CCATGTGGCCAGCATGAAGAGGG + Intronic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1030860653 7:114621772-114621794 CAGTGTACCCAGCGGCAGGAGGG + Intronic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1031265145 7:119572223-119572245 CACTGCTGCCATCAGGAGGAGGG - Intergenic
1032066534 7:128775611-128775633 CAGTGTGGCCACCAGCACCATGG + Exonic
1032855905 7:135833270-135833292 CAGTGTTGTCAGCAGGAACAGGG + Intergenic
1033070538 7:138197873-138197895 TAGTGTGGTCAGTAGGTGGATGG - Intergenic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1034554135 7:151839254-151839276 CAGACTGGCCTGCAGAAGGAAGG + Intronic
1035018936 7:155789013-155789035 CGGTGTGGCAAGCAGGGAGAAGG - Intergenic
1035395069 7:158529393-158529415 AGGGGAGGCCAGCAGGAGGACGG + Intronic
1035457246 7:159016592-159016614 CAGGGTGCCAAGCAGGAGGGTGG - Intergenic
1035796263 8:2360004-2360026 AAATGTGGGCAGCAGGAAGAGGG + Intergenic
1036561751 8:9904678-9904700 CAGTGTGGAGAGGTGGAGGAGGG - Intergenic
1037383804 8:18316293-18316315 CACTGTGGCCTGGCGGAGGATGG - Intergenic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037636049 8:20701756-20701778 CAGTGGGGCTGGCAGGAGCAGGG + Intergenic
1038103905 8:24412132-24412154 CAGTGGGGCCAGTTGGAGGGTGG + Intergenic
1038401421 8:27287477-27287499 CAGTGTGGGCATTAGGAAGAGGG + Exonic
1038518809 8:28211282-28211304 CACTGGGGCCAGCTGGGGGAGGG + Intergenic
1039351651 8:36770133-36770155 CCATGTGGCCAGAAAGAGGAAGG + Intergenic
1039429887 8:37517558-37517580 CAGGGCGGCCAGCAGGGAGAGGG - Intergenic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1048205880 8:132414900-132414922 CAGTGTGTCCGGCAGAAGTAGGG + Intronic
1048335430 8:133498837-133498859 CACTGTAGCCAGCAGGAGCCTGG - Intronic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1048897253 8:139003214-139003236 GAGTGTGGACAGCAGGAGGGTGG - Intergenic
1049137697 8:140919060-140919082 CAGTGTGTGCAGCACCAGGAAGG + Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049162520 8:141106314-141106336 CAGTGTAGCCTGCAGGAGTTGGG + Intergenic
1049324830 8:142016451-142016473 CAGAGAGGCCTGGAGGAGGACGG - Intergenic
1049386105 8:142343908-142343930 CACTCTGTCCAGCAGGAGGGGGG - Intronic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049759013 8:144323489-144323511 CAGTGCGGCCAGCAGCATGTGGG + Intronic
1049807843 8:144548896-144548918 AGGTGAGCCCAGCAGGAGGAAGG + Intronic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1050174838 9:2859012-2859034 GAGTGTGGCCAGCTTGAGGGAGG - Intergenic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051584208 9:18710118-18710140 GAGTGTGGGAAGCTGGAGGAGGG - Intronic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1053350506 9:37410705-37410727 CAGTGGGGCAACCAGGAGGCTGG + Intergenic
1053510969 9:38687475-38687497 CAGTGTGCAGAGCAGGAGGCGGG - Intergenic
1054766254 9:69045002-69045024 CAGGGTGGTTAGCAGGAGGCTGG - Intronic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1056071695 9:82993805-82993827 CAGTGGGTCCAGCTGGTGGAGGG - Intronic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1057168640 9:92947582-92947604 CACAGTGGGCAGCAGGAGGCTGG - Exonic
1057481649 9:95449360-95449382 GAGTGTGGCCAGCAGGTAAATGG - Intronic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060927100 9:127462660-127462682 CAGTGAGGCCTGTCGGAGGAGGG + Intronic
1060943346 9:127555989-127556011 CAGTGGGGCCACCAGGACCAGGG + Intronic
1060966853 9:127716433-127716455 CAGTGTGGCCTGCTGGAGTGAGG + Exonic
1060975423 9:127762275-127762297 CACGGTGGCCCTCAGGAGGAAGG - Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061882419 9:133574944-133574966 CAGCGTGCCCCGCAGGAGGGGGG - Exonic
1061950081 9:133931284-133931306 CAGAGAGCCCAGCAGCAGGAGGG + Intronic
1062028760 9:134352569-134352591 AAGCGGGGCCAGCAGGAGGCTGG - Intronic
1062050273 9:134443492-134443514 CAGCGTCGCCAGCAGGGGGCAGG - Intergenic
1062162875 9:135089358-135089380 CAGTAGGGCCAGCAGCAGGATGG + Intronic
1062211999 9:135370042-135370064 CAGTTCTGCCAGCAGGAGCAGGG + Intergenic
1062221259 9:135416921-135416943 CCATTTGGCCAGCAGGAGGGAGG + Intergenic
1062239173 9:135526607-135526629 CTGGGTGGGAAGCAGGAGGAAGG + Intergenic
1062546254 9:137064948-137064970 CAGGGGGGCCCGGAGGAGGACGG + Exonic
1062695972 9:137876822-137876844 GAGTGTGGACTGCAGGAGGCTGG - Intergenic
1062746415 9:138215679-138215701 CTGTGTGGGCAACAGAAGGAAGG - Intergenic
1185790735 X:2927065-2927087 CGGTGTGGCCAGCAGGGCAATGG + Intronic
1186386262 X:9113182-9113204 CAGTATTGTCAGCAGTAGGATGG + Intronic
1186417588 X:9397356-9397378 CAGCCTGGGCAGCAGAAGGAGGG - Intergenic
1186765767 X:12769195-12769217 CATTCCGGCCAGCAGGAAGAGGG + Intergenic
1186776459 X:12869572-12869594 CACTGAGGCCTGTAGGAGGAGGG + Intronic
1187077287 X:15947779-15947801 AAGTGTAGCCAGCAGCAGGGTGG + Intergenic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1190569643 X:51768334-51768356 CAGTGAGGCCAGGAGGTGGTGGG + Intergenic
1190583702 X:51915562-51915584 CAGTGTCCCCAGCAGCAAGAGGG + Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1191904187 X:66071434-66071456 CACTGCTGCCAGCAGGATGAAGG + Intergenic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1194851059 X:98869824-98869846 GAGTGTGGAGAGCGGGAGGAGGG - Intergenic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198555011 X:137783560-137783582 GAGTGTGTCCATCAGGAGGCAGG - Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199718501 X:150525042-150525064 CAGTCTGCCCATCAGGAAGAGGG + Intergenic
1199770382 X:150971490-150971512 AAGGGTGGAGAGCAGGAGGAGGG + Intergenic
1199996988 X:153031672-153031694 CAGTGGGGTCGGCAGCAGGACGG + Intergenic
1200069003 X:153518607-153518629 CAGAAGGGCCAGCAGAAGGAAGG - Intronic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic