ID: 1163026037

View in Genome Browser
Species Human (GRCh38)
Location 19:14512918-14512940
Sequence CAGTGTGAGGAGTGGGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163026037_1163026044 -3 Left 1163026037 19:14512918-14512940 CCACCGTCCCACTCCTCACACTG No data
Right 1163026044 19:14512938-14512960 CTGCTACCTGGTAGGTTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163026037 Original CRISPR CAGTGTGAGGAGTGGGACGG TGG (reversed) Intergenic
No off target data available for this crispr