ID: 1163026975

View in Genome Browser
Species Human (GRCh38)
Location 19:14518212-14518234
Sequence CTTGAACTTCTCCTCGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163026972_1163026975 -10 Left 1163026972 19:14518199-14518221 CCTCAGCGATCTCCTTGAACTTC 0: 1
1: 1
2: 0
3: 13
4: 158
Right 1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG 0: 2
1: 0
2: 0
3: 7
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163026975 Original CRISPR CTTGAACTTCTCCTCGGCGC CGG Exonic
901748475 1:11390481-11390503 CTTGTTCTTCTCCTCTGCCCTGG - Intergenic
902098564 1:13966358-13966380 CTTGAACTTCTTCTCAGCCCTGG + Intergenic
915210614 1:154306199-154306221 CTTGAAATGCTCCTGGGCTCCGG - Intergenic
917630595 1:176887772-176887794 CTTGAACTTCTCCTTGAAGGTGG - Intronic
917660297 1:177171278-177171300 CTTGGGTTTCTCCTCGGCGGAGG + Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1063117230 10:3080022-3080044 CTCCAACTCCTCCTCGGCTCTGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1074820387 10:117174060-117174082 CTTGCACATCTCCTGGGTGCAGG + Intergenic
1080521600 11:33072176-33072198 TTTGAGCTTCTCCTGGGAGCTGG + Intronic
1081725898 11:45328921-45328943 CTTGCCCTTCTCCTCGACCCAGG + Intergenic
1088869831 11:113881068-113881090 CTTTAACTTCCACTCGGTGCTGG + Intergenic
1089507343 11:118972329-118972351 CTGGGTCTTCTCCTTGGCGCTGG + Intronic
1091992420 12:4966414-4966436 CTTGAAACTCTACTCGGCCCAGG - Intergenic
1098672469 12:73248404-73248426 CTTGAATTTCTCCTCAGCAAAGG + Intergenic
1102472958 12:113169904-113169926 CTTGAACGTCTCCTTGCTGCAGG - Exonic
1103322206 12:120098820-120098842 GTTGACATTCTCCTTGGCGCTGG + Exonic
1118437074 14:65781488-65781510 CTTGAACTACTCCTCTGAGGTGG + Intergenic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122857210 14:104565683-104565705 CTTGTCCTTGTCCTCGGGGCTGG - Intronic
1124128915 15:26967879-26967901 GTTGGACTTCACCTCGGCGGGGG - Intergenic
1127164740 15:56232565-56232587 CTTGAACTTCTCCTCAGAAAAGG + Intronic
1132646538 16:1001858-1001880 CTTGAACTTCACCTCCACGGTGG - Intergenic
1135409168 16:22220294-22220316 CCTGACGTTCTCCTCGGCCCTGG - Intronic
1136042926 16:27594503-27594525 CTTGAAAGTCACCTCGGCCCTGG + Intronic
1138361471 16:56432686-56432708 CTTTTACTTCTCCACTGCGCAGG + Exonic
1147998498 17:44374658-44374680 CCTGAGCTTCCCCTCGGGGCAGG + Exonic
1151935549 17:77258650-77258672 CTCCAACTTCTCCTCGGCTTGGG + Intergenic
1151977323 17:77490117-77490139 CTTAAACTTCTGCCCGGAGCGGG + Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG + Exonic
1165796498 19:38523054-38523076 CCTGAACAGCTCCTCCGCGCTGG - Exonic
930752750 2:54948604-54948626 CTTAACCTTCTCCTGGGAGCAGG - Intronic
936931534 2:117794841-117794863 CTTGAAATTCTCCAAGGGGCGGG - Intergenic
938923838 2:136020584-136020606 CTTGAACTCCTACTGGGCACTGG + Intergenic
941409024 2:165129771-165129793 ATTTAACTTCTCCTGGGCTCTGG - Intronic
943011214 2:182451922-182451944 CTAGAACTTCTGCTGGGCACTGG + Intronic
943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG + Intergenic
945721633 2:213424809-213424831 CTTGTTCTTCTCCTAGGCTCTGG + Intronic
947233220 2:227910385-227910407 CTTGAACTCCTCCTGGGCTCAGG - Intronic
1168847560 20:955933-955955 CTTGAAATTTTCCTCTGGGCTGG + Intergenic
1169141954 20:3231441-3231463 CTTGAATTCCTCCTCTGTGCGGG + Exonic
1172116122 20:32574621-32574643 CTTGAACATTTCCTCAGCCCGGG + Intronic
1182106770 22:27695320-27695342 GTTGAACTTCTCCTGGGTTCAGG - Intergenic
953569007 3:44057041-44057063 CTTGACCCTCACCTCAGCGCTGG + Intergenic
966205053 3:177397701-177397723 CTTGAACTTCTCCTGACCTCAGG + Intergenic
966378890 3:179323549-179323571 CTTGGAAGTCTCCTTGGCGCCGG + Intronic
971952151 4:33365749-33365771 ATTGAACTTCTCCTCTGCTCTGG - Intergenic
985356913 4:189130990-189131012 CTTGATCTTCTTCTTGTCGCAGG - Intergenic
990876786 5:60494926-60494948 CTTGACCTTTTCCTTGGCTCAGG - Intronic
999123748 5:149230685-149230707 CTTTAACTTCTTCTCTGCCCGGG - Exonic
999180514 5:149666877-149666899 TTTGAATTTCTCCTGGGCCCTGG - Intergenic
1004079010 6:12372501-12372523 ATTGACCTTCTCCTTGGTGCTGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015966912 6:138703284-138703306 CTTGACCTCCTCCTGGGCTCAGG - Intergenic
1017737676 6:157380100-157380122 GTCGTGCTTCTCCTCGGCGCAGG + Intergenic
1017914190 6:158819119-158819141 CGCGACCTTCCCCTCGGCGCCGG - Intronic
1036642813 8:10594598-10594620 CATGAACTTCTCCACGGCTCAGG - Intergenic
1051126108 9:13807657-13807679 CTTGTACTTCTCTTTGGCACAGG - Intergenic
1053055980 9:34993349-34993371 CTTAAACTTCTCCTCAGCGTTGG - Exonic
1058430789 9:104917232-104917254 ATTTAACTTCTCCTCGGCTCAGG + Intronic
1058782420 9:108351753-108351775 CTTGTACTTCTGATGGGCGCTGG + Intergenic
1200247847 X:154535362-154535384 CTTGAGCTTCTCCTCTGGGGTGG + Exonic