ID: 1163027093

View in Genome Browser
Species Human (GRCh38)
Location 19:14518614-14518636
Sequence CGCGGCGCGCGCGCACAGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163027085_1163027093 -5 Left 1163027085 19:14518596-14518618 CCCTCGGCAACACCTCCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027074_1163027093 26 Left 1163027074 19:14518565-14518587 CCCGCGCGGGGCCACGCCCCCTC 0: 1
1: 0
2: 2
3: 38
4: 342
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027082_1163027093 4 Left 1163027082 19:14518587-14518609 CCCGCTCCGCCCTCGGCAACACC 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027081_1163027093 7 Left 1163027081 19:14518584-14518606 CCTCCCGCTCCGCCCTCGGCAAC 0: 1
1: 0
2: 2
3: 15
4: 266
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027087_1163027093 -6 Left 1163027087 19:14518597-14518619 CCTCGGCAACACCTCCCCGCGGC 0: 1
1: 0
2: 0
3: 21
4: 134
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027075_1163027093 25 Left 1163027075 19:14518566-14518588 CCGCGCGGGGCCACGCCCCCTCC 0: 1
1: 0
2: 2
3: 97
4: 464
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027084_1163027093 -2 Left 1163027084 19:14518593-14518615 CCGCCCTCGGCAACACCTCCCCG 0: 1
1: 0
2: 0
3: 18
4: 227
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027073_1163027093 29 Left 1163027073 19:14518562-14518584 CCGCCCGCGCGGGGCCACGCCCC 0: 1
1: 0
2: 1
3: 40
4: 366
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027079_1163027093 9 Left 1163027079 19:14518582-14518604 CCCCTCCCGCTCCGCCCTCGGCA 0: 1
1: 0
2: 2
3: 30
4: 355
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027078_1163027093 10 Left 1163027078 19:14518581-14518603 CCCCCTCCCGCTCCGCCCTCGGC 0: 1
1: 0
2: 6
3: 95
4: 875
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027076_1163027093 15 Left 1163027076 19:14518576-14518598 CCACGCCCCCTCCCGCTCCGCCC 0: 1
1: 3
2: 48
3: 569
4: 3339
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027080_1163027093 8 Left 1163027080 19:14518583-14518605 CCCTCCCGCTCCGCCCTCGGCAA 0: 1
1: 0
2: 1
3: 15
4: 242
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72
1163027083_1163027093 3 Left 1163027083 19:14518588-14518610 CCGCTCCGCCCTCGGCAACACCT 0: 1
1: 0
2: 0
3: 15
4: 197
Right 1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG 0: 1
1: 0
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163027093 Original CRISPR CGCGGCGCGCGCGCACAGGT CGG Intronic
900110151 1:1001869-1001891 CGAGGCGCGCGCAGAGAGGTCGG - Intergenic
906805661 1:48776872-48776894 CGCGGGGCGGGCGCGGAGGTGGG + Exonic
922730740 1:227947758-227947780 GGCGGCCGGCGCGCACTGGTGGG - Intronic
1076707279 10:132308594-132308616 GGCTGCGCGCGCGCACACGCGGG + Intronic
1081576210 11:44319861-44319883 GGCGGCGCGCGCTCCCAGGTCGG + Intergenic
1082028756 11:47590249-47590271 GGCGGCGCGCACGCGCAGCTTGG - Exonic
1087014636 11:93543271-93543293 GGCGGCGCCCGCGGGCAGGTGGG - Exonic
1095986332 12:48001990-48002012 GGCGGCGGGCGGGCACAGGGGGG + Intronic
1110558533 13:76886324-76886346 AGCGGCGCGCTCGCACCGCTCGG - Exonic
1121342804 14:93115440-93115462 CGCGGCGCTCGCGAGCCGGTGGG - Intronic
1122975057 14:105167633-105167655 CGAGCCGCGCGCGCCCAGGCGGG - Intronic
1128457467 15:67840302-67840324 CGCCGAGCGCGCGCCAAGGTCGG - Intergenic
1132844050 16:1991915-1991937 CGAGGCGGGCTCGCAGAGGTCGG + Intronic
1141068473 16:80932556-80932578 GGCCGCGCGCGCGCACACGCCGG + Intergenic
1142271833 16:89093914-89093936 CGCCGCGCGCGCGCCGGGGTCGG - Exonic
1143247816 17:5500830-5500852 CGCTGCCCGCGGGCCCAGGTCGG - Intronic
1143583899 17:7841997-7842019 TGCTGCGCGCGCGCCGAGGTGGG - Intronic
1146439043 17:32877283-32877305 GGCGGCGCGCACGCGCGGGTGGG + Intergenic
1152708945 17:81860611-81860633 CGCGGCGCGCACGCGCCGCTGGG + Exonic
1153872729 18:9335080-9335102 CTGGGCGCGGGCGCACAGGCCGG + Intronic
1156171701 18:34493854-34493876 GCCGGCGCCGGCGCACAGGTGGG - Intronic
1156488996 18:37485430-37485452 CGCGGCGCGCGGGGAGAGGACGG - Intronic
1160909897 19:1469550-1469572 CGGCGGGCGCGCGCACAGGCAGG - Exonic
1161628732 19:5340758-5340780 CGCGGCGTGCGCGCGCCGGCCGG + Exonic
1161752826 19:6110225-6110247 CGCCGCGCGCGCGGACGGGGTGG + Intronic
1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG + Intronic
1167495813 19:49818249-49818271 CGCCGCGCGCGCGCTCGCGTCGG - Intergenic
926090110 2:10043930-10043952 CGCGACGGGCGCGCCCGGGTCGG + Intronic
928042330 2:27890747-27890769 CCCGCGGCGCGCGCGCAGGTCGG + Exonic
930847736 2:55923706-55923728 CGCAGCGCGGCCGCACAGGTAGG - Exonic
934500550 2:94857489-94857511 GGCGGCGCGCGCCGGCAGGTAGG + Intergenic
946358805 2:219206787-219206809 CGCGCCGCGCGCGCCGAGGGAGG + Exonic
1172109389 20:32536443-32536465 AGCGGCGCGCGCGGCCAGCTCGG - Intronic
1173649161 20:44651897-44651919 TGGAGCGCGCGCCCACAGGTGGG - Intronic
1175074017 20:56358867-56358889 CGCCGCGCGCGCGCGCTGGGCGG - Intergenic
1175429476 20:58891544-58891566 CGCGGGGCGCGCGGACGGGCGGG - Intronic
1178535108 21:33404020-33404042 CCCGGCGCGGGCGCGCGGGTGGG - Intronic
1178610137 21:34073179-34073201 CGCAGCGCACGCGCACTGGCGGG + Intergenic
1179979574 21:44889081-44889103 CGCGGCAGGTGCGCACAGGAGGG + Intronic
1181518904 22:23434044-23434066 CACGGAGCGGGAGCACAGGTGGG + Intergenic
1182254712 22:29030298-29030320 CGCGGCGCCATTGCACAGGTTGG - Intronic
1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG + Intronic
1184711249 22:46250646-46250668 CGCGGCGCGGGAGGGCAGGTGGG - Exonic
951558818 3:23945881-23945903 GGCGGCGCGCGGGCGCCGGTTGG + Intronic
954437503 3:50503766-50503788 AGAGGCGCGCGGGCACGGGTGGG - Intronic
961346609 3:126267475-126267497 CTGGCCGCGCGCGCACAGGCTGG + Intergenic
968186960 3:196639633-196639655 CGCGGCGCGGGCGCGGGGGTGGG - Intergenic
980969338 4:139555360-139555382 CGCGGCGCGCCTGCACAGCGTGG + Intronic
999252318 5:150190214-150190236 CGCGGCTCCCGCGCACCGGCTGG - Exonic
1002925634 6:1604544-1604566 CGCGGTGCGGGCGCCCAGGACGG + Intergenic
1004709389 6:18155491-18155513 CGCGCGCCGCGCGCACAGGACGG - Exonic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013836704 6:114342827-114342849 AGCGGGGCGCCCGCACAGCTTGG - Exonic
1019405141 7:879227-879249 AGCGGGGCGCAGGCACAGGTTGG - Intronic
1019592383 7:1842281-1842303 CACGGAGCGGGAGCACAGGTGGG - Intronic
1020169407 7:5833412-5833434 CCCGCCTCGCGGGCACAGGTGGG - Intergenic
1020192312 7:6009517-6009539 CGCCGCGCGTGCGCACTGGGCGG - Intronic
1022103988 7:27185497-27185519 CCCGGCGCGCGCGGAGAGGCTGG + Intergenic
1032525877 7:132577702-132577724 CACGGCGCGCGCTCAGAGGGAGG + Intronic
1033732908 7:144195872-144195894 CGCGGTGCGCGGGCGCAGGTCGG + Intergenic
1033743760 7:144294452-144294474 CGCGGTGCGCGGGCGCAGGTCGG + Intergenic
1033750141 7:144355145-144355167 CGCGGTGCGCGGGCGCAGGTCGG - Intergenic
1034147110 7:148883752-148883774 CGCGGCGGGAGCGCCCGGGTGGG - Intronic
1034470485 7:151251964-151251986 CGCGGCGCGCATGCCCAGGCCGG - Intronic
1034781410 7:153886223-153886245 CCAGGAGCGCGCGCAGAGGTTGG - Intergenic
1039512824 8:38105386-38105408 CCAGGCGCGCGGGCAGAGGTGGG - Exonic
1039527725 8:38231622-38231644 CGCGGCGCGCGACCGCGGGTGGG - Exonic
1039979098 8:42391685-42391707 CGCAGCGCGCGTGCGCAGGAGGG - Intronic
1052807530 9:33025723-33025745 CCCTGCGCACGCGCACAGGGAGG + Intronic
1053656619 9:40223059-40223081 GGCGGCGCGCGCCAGCAGGTGGG - Intergenic
1053906974 9:42852281-42852303 GGCGGCGCGCGCCGGCAGGTGGG - Intergenic
1054357040 9:64071506-64071528 GGCGGCGCGCGCTGGCAGGTGGG - Intergenic
1054368725 9:64369281-64369303 AGCGGCGCGCGCCAGCAGGTGGG - Intergenic
1054676352 9:67859033-67859055 GGCGGCGCGCGCCAGCAGGTGGG - Intergenic
1061242707 9:129383638-129383660 CGCCGAGCGCGCGCCCAGCTTGG + Intergenic
1061264158 9:129496061-129496083 CGCGGCGCGCGCTCATTGGCTGG - Intergenic
1062454417 9:136628970-136628992 GGAGGCGCTCGCCCACAGGTAGG - Intergenic
1062653500 9:137590334-137590356 CGCGGCGCGCCGGGACAGGACGG + Exonic
1189473631 X:41333217-41333239 GGAGGCGCGCGCGCACACGTCGG + Intergenic