ID: 1163032247

View in Genome Browser
Species Human (GRCh38)
Location 19:14552416-14552438
Sequence AAGCTGGGTGGACACTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163032239_1163032247 30 Left 1163032239 19:14552363-14552385 CCTGCTCTCTAGGATGGAGGCAT 0: 1
1: 0
2: 1
3: 19
4: 157
Right 1163032247 19:14552416-14552438 AAGCTGGGTGGACACTCACATGG 0: 1
1: 0
2: 1
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163032247 Original CRISPR AAGCTGGGTGGACACTCACA TGG Intronic
900291700 1:1926436-1926458 GAGCTGGGTGGACAAGGACACGG + Exonic
900431307 1:2604382-2604404 AAGGTGGGTGGACACGCATTAGG - Intronic
900619343 1:3579848-3579870 AAGCCGGGGGGACAGTGACACGG + Exonic
903128005 1:21260815-21260837 AAGTTGGATGGAAACTCAAAAGG + Intronic
905458039 1:38101962-38101984 AAGCAGGGTGGACAGCCCCATGG - Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
911521005 1:98930870-98930892 AAGCTGGGTGGGGACTCAGTGGG - Intronic
917501727 1:175591707-175591729 AAGCTAGGTGGCCAGTAACAGGG + Intronic
924770200 1:247073336-247073358 AAGCTTGGGGGCCACTCTCAAGG + Intronic
924770215 1:247073406-247073428 AAGCTTGGGGGCCACTCTCAAGG + Intronic
1067229590 10:44397102-44397124 AAGCTGGCTGCCCACACACAGGG - Intergenic
1067570942 10:47370377-47370399 AAGCTGGGTGGGTTCTCACTGGG - Intronic
1069416814 10:68207867-68207889 AGGTTGAGTGGAAACTCACAGGG - Intronic
1069492941 10:68877001-68877023 AAGCTGAGTGCACCCTGACACGG - Intronic
1070417373 10:76203728-76203750 GAGATGGGTGGACAGGCACATGG - Intronic
1070417442 10:76204071-76204093 GAGATGGGTGGACAGGCACATGG - Intronic
1070417467 10:76204200-76204222 GAGATGGGTGGACAGGCACATGG - Intronic
1072482387 10:95821837-95821859 AAGCTGGCTGGGCACTGAAATGG - Intronic
1078421923 11:11219538-11219560 AAACTGGGGGGACGCTCACTGGG - Intergenic
1079080231 11:17408773-17408795 AAGCTGGCTGGTTACTCACAAGG + Intronic
1083346497 11:61997052-61997074 AAGCTGGGAGGACATTGGCAGGG - Intergenic
1084534854 11:69750660-69750682 AAGGTGGCTGGACCCTCCCAGGG + Intergenic
1089592847 11:119555754-119555776 ATGCTGAGTGGACAGGCACAGGG - Intergenic
1094461355 12:30699695-30699717 AAGCTGCATATACACTCACAAGG - Intergenic
1096684634 12:53279863-53279885 AGGCTGGTTGGGCACTCACCTGG - Exonic
1097572963 12:61356345-61356367 AAGCTGGGTGTGCACACACTCGG - Intergenic
1104278840 12:127355197-127355219 AGGCTGGGCGGACACTCAATTGG + Intergenic
1108171620 13:47747946-47747968 AAGCTGGCAGGAGAATCACAGGG - Intergenic
1113486211 13:110654096-110654118 TAACAGGGTGCACACTCACAGGG + Intronic
1113729198 13:112627455-112627477 AAGCTGGGTGGGTTCTCTCAAGG - Intergenic
1118626830 14:67667117-67667139 AAACTGGGTGGATGCTGACATGG + Intronic
1121347635 14:93147861-93147883 CAGCTGGTTGGACACTTACCAGG - Intergenic
1121699282 14:95940108-95940130 CGGAGGGGTGGACACTCACATGG - Intergenic
1122034752 14:98939206-98939228 AAGATGGATGGTTACTCACATGG - Intergenic
1122059555 14:99127602-99127624 AAGCTGGGTACTCACTGACAAGG + Intergenic
1122837694 14:104438104-104438126 TGGCTGGTGGGACACTCACAAGG - Intergenic
1123203817 14:106692639-106692661 AAGCTGAGGGGGCTCTCACAGGG - Intergenic
1123208847 14:106739146-106739168 AAGCTGAGGGGGCTCTCACAGGG - Intergenic
1124141125 15:27078018-27078040 ATGCTGGCTGGACACACAGACGG + Intronic
1124454878 15:29832923-29832945 AAGCTAGGCGGCCTCTCACAGGG - Intronic
1125452709 15:39825803-39825825 AAGCTTGGTGGAGACCCAGAAGG + Intronic
1127223242 15:56902543-56902565 AAGCTGGGTGGAGTTTCAAAGGG + Intronic
1133757728 16:8775143-8775165 GAGCTGGGTGGGCACTTACTGGG + Intronic
1133805846 16:9125539-9125561 AAGCTTGGTGGACAGTCACCAGG + Intergenic
1133862753 16:9611761-9611783 AGGCAGGGTGGGGACTCACATGG + Intergenic
1137589780 16:49686552-49686574 AGGCTGGGAGGGCACTGACAGGG - Intronic
1139752645 16:69119042-69119064 GAGCTGGGTTGATACCCACAGGG + Exonic
1142230698 16:88898996-88899018 AAGCTGGGAGGACGCTTAAAGGG - Intronic
1144627024 17:16849182-16849204 TACCTGGGTGCACACTCACCGGG + Intergenic
1144879416 17:18423530-18423552 TACCTGGGTGCACACTCACTGGG - Intergenic
1145152825 17:20520857-20520879 TACCTGGGTGCACACTCACTGGG + Intergenic
1150387352 17:64772813-64772835 AGGCAGGGTGGGCACCCACAGGG + Intergenic
1152093028 17:78257351-78257373 AAGAAGGGTGGGCTCTCACACGG + Intergenic
1152527772 17:80898945-80898967 AGGCTGGGAGCACACCCACAGGG - Intronic
1158309721 18:56145035-56145057 AAGCTGGGAGCTCTCTCACATGG - Intergenic
1158761615 18:60395859-60395881 AAGCTGGGCGGAAAATCAAATGG - Intergenic
1160243105 18:77136907-77136929 AAGCAGAGGGGACACTCAGAGGG + Intergenic
1160373932 18:78396624-78396646 AAGCTGGGTGGAGACGTGCAGGG + Intergenic
1162531076 19:11236840-11236862 GCGCTGGGTGGACGGTCACAAGG - Exonic
1163032247 19:14552416-14552438 AAGCTGGGTGGACACTCACATGG + Intronic
1164452801 19:28381289-28381311 AGGCAGGGTGGACACTCAGGTGG + Intergenic
1164694338 19:30232243-30232265 AAGCTGAGAGGAGACTCTCAGGG - Intronic
1164739729 19:30567068-30567090 CAGCTGAGTGGCCACTCCCAGGG - Intronic
1165196057 19:34104401-34104423 ATGCCGTGTGGACACTCACCGGG - Intergenic
925211721 2:2054243-2054265 ACGCTGGGTGCACAGACACATGG + Intronic
926101062 2:10118319-10118341 AAGCAGGGTGGACAACCAGATGG - Intergenic
926861946 2:17319079-17319101 AGGCTGGGTGGACATTCACCAGG + Intergenic
929528166 2:42725723-42725745 TACCTGGGGGGACACTGACAGGG + Intronic
934098858 2:88632619-88632641 AAGATGGGTGGAAACTTACATGG + Intergenic
936266548 2:111014618-111014640 AAGCTGATTTGACAATCACATGG + Intronic
940150443 2:150594657-150594679 AAGCTGGATAAAAACTCACATGG + Intergenic
941312323 2:163949742-163949764 CAACAGAGTGGACACTCACAGGG - Intergenic
943919485 2:193685435-193685457 AAGCTAGGTGGAAAAACACAGGG + Intergenic
946066555 2:216992548-216992570 AAGCTGAATGGCCACACACAGGG - Intergenic
1169332753 20:4729695-4729717 AAGCTGGGTGCCCACTGAAATGG - Intergenic
1170120596 20:12907428-12907450 AAGCTGGGTAGTCACATACATGG - Intergenic
1171147359 20:22796882-22796904 AAGGAGGGTGGAGAATCACAGGG + Intergenic
1172618973 20:36307187-36307209 GGGCTGGGGGGGCACTCACATGG + Intronic
1173808301 20:45940519-45940541 AAGCTTGGTGGAAACTCCCCCGG + Exonic
1176135137 20:63519259-63519281 CAGTTGGGTTGACACTCAGAGGG - Intergenic
1176312328 21:5158787-5158809 AAGCTGCGCCGACACTCACCTGG + Intergenic
1178431836 21:32524533-32524555 GAGCTGGGTGGCAACTCACTGGG - Intergenic
1179498287 21:41789543-41789565 ATGCTGAGTGGAAAATCACAAGG + Intergenic
1179526481 21:41980251-41980273 AAGGTGGGTGGGGACTGACAAGG - Intergenic
1179844720 21:44103243-44103265 AAGCTGCGCCGACACTCACCTGG - Intronic
1182254230 22:29026718-29026740 ATGCTGGGTGGACACAGCCATGG - Intronic
1182941475 22:34281490-34281512 AAGCTGGAAGGAGACCCACAAGG - Intergenic
1183587198 22:38759750-38759772 GAGCTGGCTGTACACTCACAAGG + Intronic
1185079375 22:48701321-48701343 AAGCTGGGTGGCAGCTCCCAGGG + Intronic
950011564 3:9727795-9727817 ATGGTGGGTGGACAGTAACAGGG + Intronic
954147770 3:48642697-48642719 AAGCTGAGTGTTCCCTCACAAGG + Intronic
959737678 3:109678738-109678760 AAGCTGGCTGGAACCACACAAGG - Intergenic
959942388 3:112092958-112092980 AGGCTGGGAGCACACTCAGAGGG - Intronic
965553258 3:169992206-169992228 CATCTGGGTGTACACTTACATGG - Intronic
972019887 4:34299360-34299382 AAGCTGGGTAGAAAATAACAAGG + Intergenic
973843019 4:54881556-54881578 AAGCTGGATGAACACTTATATGG + Intergenic
975355057 4:73392583-73392605 AAGCAGGGGGGACAAGCACAGGG - Intergenic
977714061 4:100161036-100161058 AGCCTGGGGGCACACTCACATGG + Intergenic
996529048 5:124508539-124508561 AAGATGGATGGACATTCACATGG - Intergenic
997265944 5:132495713-132495735 AAGCTGGCTGGAAAATCACTAGG + Intergenic
1001226237 5:169946813-169946835 AAACTGGGTGGGCAGTGACATGG + Intronic
1001269779 5:170302565-170302587 AGGCTGGGTGGACACGGGCAAGG - Intergenic
1006092235 6:31634906-31634928 GAGCCAGGTGGACCCTCACAAGG - Exonic
1006372474 6:33653899-33653921 AGGCTGGGTTGGCACTCCCAGGG - Intronic
1006678603 6:35781033-35781055 CAGCTGGGAGGACACCCACATGG + Exonic
1007882487 6:45182911-45182933 CAGCTGGGTGGATCCTCAAAAGG + Intronic
1010151097 6:72733060-72733082 ATGCTAGTTGGACATTCACATGG + Intronic
1013036006 6:106383921-106383943 AAGCTGACTGGCCACACACAGGG - Intergenic
1019732581 7:2636048-2636070 AGGCTGGATGGCCACTCAGAGGG + Intronic
1020236530 7:6360058-6360080 AACCTGGGTGGACTGGCACAGGG + Intergenic
1020944849 7:14590532-14590554 AAGCTGGTCTGACAGTCACATGG - Intronic
1021571765 7:22073091-22073113 ATGCTGGGTGGGCACTTATATGG - Intergenic
1025941842 7:66080923-66080945 AAGCTTGGTGGAGACCCTCAAGG + Intronic
1034719758 7:153280343-153280365 AAGCTGGGTGTATATTTACAAGG + Intergenic
1035684161 8:1510749-1510771 AAGCAGTGTGGATACTCAAAAGG - Intronic
1036569127 8:9964432-9964454 ATGCTGGGTGGAAAACCACATGG + Intergenic
1040731787 8:50456519-50456541 AAGCTGGGTGGGTGCTCACATGG + Intronic
1041028114 8:53707487-53707509 AGGCTGACTGGACACTCACTGGG + Intergenic
1044843519 8:96358697-96358719 AGGCTGGGTGGACTCCCACTTGG - Intergenic
1045173799 8:99698311-99698333 GAGATGGGAGGACACACACAAGG - Intronic
1046320358 8:112566630-112566652 AAGCAAGCTGGACACTTACATGG + Intronic
1048553695 8:135456441-135456463 AAGCTGGGGGGACACAGAGAAGG + Intergenic
1049192774 8:141297960-141297982 AAGCTGGGTGAACAGTCACATGG - Intronic
1049316006 8:141968080-141968102 ACCCTGGGTGGTCATTCACACGG + Intergenic
1050539350 9:6656896-6656918 ACTCTAGCTGGACACTCACAGGG - Intergenic
1051697907 9:19788891-19788913 AAGATGGGAGGACGCGCACACGG + Intergenic
1051762949 9:20488881-20488903 AGGCTGGCTGGGCATTCACATGG - Intronic
1054456224 9:65431835-65431857 ACGCTGGGTGGACACAAACTAGG + Intergenic
1054965340 9:71019966-71019988 AAATTGGTTGGATACTCACATGG + Intronic
1056275272 9:84988607-84988629 CAGCTGTGTGCACACTTACAGGG + Intronic
1056343156 9:85659035-85659057 AATCTTGGTGGAAACACACAAGG - Intronic
1059889645 9:118787043-118787065 AAGCAGGGAGGTCACTCAGATGG - Intergenic
1061195078 9:129103091-129103113 AAGCTGCGTGGACACCCTGAGGG + Intronic
1062450042 9:136611332-136611354 AGGCTGGGTGGCCACTCATGTGG + Intergenic
1187514909 X:19960250-19960272 AAGCTGAGTTGACAGACACATGG - Intronic
1188541187 X:31252548-31252570 AAACTGGAAGGACACTCAAAGGG + Intronic
1189837158 X:45036967-45036989 AAGGTGGTTGGTCACTCAAACGG + Intronic
1190136470 X:47803956-47803978 AAGGTGGGTGGATACCCAAAAGG - Intergenic
1190328151 X:49219275-49219297 GAGCTGAGGGGACACTCCCAGGG - Intronic
1195309478 X:103616797-103616819 AAGCTGGGAGGAGACCCACTGGG + Intronic
1196139579 X:112246358-112246380 AAACTGGGTGGAGACCAACACGG - Intergenic
1200038920 X:153351890-153351912 AAGCGGGGTGGCAAATCACATGG - Exonic
1201526404 Y:14939969-14939991 AAGCTGGGTGTCCATTCACATGG + Intergenic