ID: 1163036515

View in Genome Browser
Species Human (GRCh38)
Location 19:14572221-14572243
Sequence GGCTCAGGGAAGTCCCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 233}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163036515_1163036530 16 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036530 19:14572260-14572282 CGGGGCAGAAGGGGACGGTGTGG 0: 1
1: 0
2: 2
3: 27
4: 437
1163036515_1163036519 -8 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036519 19:14572236-14572258 CCTGAGCCTGGAAATCCATCTGG 0: 1
1: 0
2: 0
3: 21
4: 183
1163036515_1163036522 -3 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036522 19:14572241-14572263 GCCTGGAAATCCATCTGGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1163036515_1163036532 24 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036532 19:14572268-14572290 AAGGGGACGGTGTGGGACTGAGG No data
1163036515_1163036524 -2 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036524 19:14572242-14572264 CCTGGAAATCCATCTGGGCGGGG 0: 1
1: 0
2: 0
3: 31
4: 572
1163036515_1163036525 5 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036525 19:14572249-14572271 ATCCATCTGGGCGGGGCAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 158
1163036515_1163036529 11 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036529 19:14572255-14572277 CTGGGCGGGGCAGAAGGGGACGG 0: 1
1: 0
2: 6
3: 71
4: 821
1163036515_1163036528 7 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036528 19:14572251-14572273 CCATCTGGGCGGGGCAGAAGGGG 0: 1
1: 0
2: 2
3: 15
4: 193
1163036515_1163036526 6 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036526 19:14572250-14572272 TCCATCTGGGCGGGGCAGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 191
1163036515_1163036520 -7 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036520 19:14572237-14572259 CTGAGCCTGGAAATCCATCTGGG 0: 1
1: 0
2: 1
3: 17
4: 165
1163036515_1163036531 17 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036531 19:14572261-14572283 GGGGCAGAAGGGGACGGTGTGGG 0: 1
1: 0
2: 3
3: 41
4: 503
1163036515_1163036521 -4 Left 1163036515 19:14572221-14572243 CCGAGAGGGGACTTCCCTGAGCC 0: 1
1: 0
2: 0
3: 26
4: 233
Right 1163036521 19:14572240-14572262 AGCCTGGAAATCCATCTGGGCGG 0: 1
1: 0
2: 2
3: 26
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163036515 Original CRISPR GGCTCAGGGAAGTCCCCTCT CGG (reversed) Intergenic
900180858 1:1310362-1310384 GGCCCAGGGCAAGCCCCTCTGGG + Intronic
901004970 1:6167134-6167156 GGGCCAGGCCAGTCCCCTCTAGG + Intronic
902371059 1:16007038-16007060 GGCTCAGGGAAGTTGGCTCCAGG + Exonic
902413184 1:16224141-16224163 TGATCAGGGAAGACCTCTCTAGG + Intergenic
902663013 1:17918477-17918499 GGCTTTCGGAAGTCTCCTCTAGG + Intergenic
902722297 1:18311991-18312013 TGGTCAGGGAAGGCCTCTCTGGG - Intronic
903774639 1:25784996-25785018 GGGTCAGGGAGGGCCTCTCTGGG + Exonic
904674628 1:32191372-32191394 GGGTCAGGGGAGCGCCCTCTAGG - Intronic
905186898 1:36203531-36203553 GGCTCAGGGCAGTGATCTCTGGG + Intergenic
905880803 1:41462709-41462731 GTCTCAGGGAAGACTCCTATTGG + Intergenic
905945553 1:41898512-41898534 GGCTCAGGCAAGGACCCTCAGGG + Intronic
907474992 1:54699715-54699737 TCCTCAGGGAAATCCCCTGTTGG + Intronic
909507404 1:76409095-76409117 GGCACAAGGAAGTGCCCTTTGGG - Intronic
911680707 1:100712115-100712137 GGCACAGGGAATTCCCTTTTTGG + Intergenic
912265202 1:108150419-108150441 GGCTCAGTTAAGTCTCCTTTAGG - Intronic
913482561 1:119302989-119303011 GGCTCAAGGAAATCTCCTCCGGG - Intergenic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
916585618 1:166147354-166147376 GGCCCAGGGATGTCCTCTCATGG + Intronic
920493508 1:206437697-206437719 GGCTCAGGGACATTCCCTATGGG - Intronic
920641026 1:207752131-207752153 CGAGCAGGGAAGTCCCTTCTGGG - Exonic
922322636 1:224502078-224502100 TCCTCAGGGAAGACCCCTCTGGG - Intronic
922744604 1:228037120-228037142 GGCTCTGGGAAGTGTCCACTGGG - Intronic
922972292 1:229752895-229752917 GACTCAGGGAGGTTACCTCTGGG + Intergenic
923425620 1:233865958-233865980 TGGTCAGGGAAGGCCTCTCTGGG - Intergenic
924122942 1:240821150-240821172 GAATCAGAAAAGTCCCCTCTTGG + Intronic
924202292 1:241672751-241672773 TGGTCAGGGAAGTCCCCACTGGG + Intronic
924941177 1:248813167-248813189 GGCTCAGTGATGTGTCCTCTGGG - Intronic
1063352087 10:5365208-5365230 TGCGGAGGGAAGTCCACTCTCGG + Exonic
1063712131 10:8489971-8489993 GGCTCAGAGCAGTGGCCTCTGGG + Intergenic
1065014237 10:21446977-21446999 TGACCAGGGAAGTCCCCACTCGG - Intergenic
1067017529 10:42769326-42769348 GCCTCAGGGAAGTCGCGTCCTGG - Intergenic
1069371278 10:67750338-67750360 GGCACTTGGAAGTCTCCTCTCGG + Intergenic
1070601204 10:77867600-77867622 GGCTCAGGGCAGGCCCTTCTGGG - Intronic
1072734277 10:97868517-97868539 GGGGCTGGGCAGTCCCCTCTGGG + Exonic
1072809320 10:98446856-98446878 GCCTCCGGGCTGTCCCCTCTGGG - Exonic
1073593992 10:104782404-104782426 TGCTCAGGGAAGCCTGCTCTAGG - Intronic
1076867840 10:133176807-133176829 GGCTGAGGGAGGTGCCATCTGGG + Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078328878 11:10402370-10402392 GGCTCAGAGAGGTAGCCTCTGGG + Intronic
1080578006 11:33617552-33617574 TGATCAGGGAAGGCCTCTCTGGG - Intronic
1081862854 11:46343862-46343884 GGATCAGGGAGGGCCTCTCTGGG - Intronic
1082848516 11:57745086-57745108 GGCTCTTGGAAGTCTCCTCCGGG + Exonic
1084504440 11:69556393-69556415 TGCTCAGGGGAGTGTCCTCTAGG - Intergenic
1084662432 11:70554031-70554053 GGCTGCAGGAAGTCCCCGCTGGG + Intronic
1085062256 11:73458513-73458535 GTGTCAGGCAAGTCCTCTCTGGG - Intronic
1088590359 11:111397579-111397601 GGCTCAGATAAGTCCTCTCTGGG - Intronic
1089615676 11:119693436-119693458 GGCTGAGGGGACTCCCCACTCGG - Intronic
1091639094 12:2221017-2221039 TGGTCAGGGAGGTCCCCTCTGGG + Intronic
1092172486 12:6382856-6382878 GGCTCAGGGATGTCTCCCTTGGG - Intronic
1092846053 12:12586285-12586307 GTCTCAGGTAAGTCCCTTCCAGG - Intergenic
1099522531 12:83681917-83681939 GGCTCAGGGAAGGTCCAACTGGG + Intergenic
1099614136 12:84913010-84913032 GGCTCTGGGAAGACGCCGCTCGG - Intronic
1101140656 12:101792277-101792299 TGCTCAGGGAACTCGCCTCTGGG - Intronic
1101828206 12:108237134-108237156 GGGACAGGAAAGTCCCATCTTGG - Intronic
1102704503 12:114869556-114869578 GACTCAGGGAAGAGACCTCTGGG - Intergenic
1103932904 12:124460022-124460044 GGGTCAGGGAAGGCCTCTGTGGG - Intronic
1104924721 12:132308246-132308268 AGCTCAGTGAAATCCACTCTGGG + Intronic
1105891978 13:24688527-24688549 GGCTCTGGGGTGTCCCCTCCTGG + Intronic
1107975910 13:45688396-45688418 GGCACCTGGAAGTCCCCTCCAGG - Intergenic
1112381299 13:98893114-98893136 GGCAGAGGGAAGTCCCCAGTGGG + Intronic
1112927003 13:104688473-104688495 TCCTCAGGGAAGTCTCCTTTAGG + Intergenic
1113648378 13:112015046-112015068 GGGTCACGGAAGTGCCCACTGGG + Intergenic
1113648565 13:112015982-112016004 GGGTCAGGGAAGTGCCCACTGGG + Intergenic
1113759431 13:112837240-112837262 GGCTGTGGGCAGTGCCCTCTGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114567209 14:23641528-23641550 GGCTGAGGTAAGACCCCTCCTGG - Intronic
1117194683 14:53327952-53327974 GGCTCTGGGAAGTAGACTCTGGG + Intergenic
1118768783 14:68928090-68928112 GGCTCAGGGCAGTGCCTGCTAGG - Intronic
1122202325 14:100130150-100130172 CGCTCAGGGCAATGCCCTCTGGG - Intronic
1122839145 14:104446291-104446313 GGCTCAGGGCAGTCACAGCTGGG + Intergenic
1202902692 14_GL000194v1_random:52568-52590 GGCTCAGGGAGGAGCCTTCTTGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1125382488 15:39102123-39102145 GTCTCAGGCAAGTCAGCTCTAGG + Intergenic
1125999158 15:44193940-44193962 GGATCAGGTGAGACCCCTCTGGG + Intronic
1126403756 15:48301732-48301754 GGCTCAGGGACATCCACTCAGGG - Intronic
1127516771 15:59702142-59702164 GGCTCAGAGAAGTCATCTCTGGG - Intergenic
1127612141 15:60647316-60647338 GGCTCAGGGAACTACCCCATGGG - Intronic
1128765843 15:70250684-70250706 GCTTCAGTGCAGTCCCCTCTCGG - Intergenic
1129488920 15:75904272-75904294 CCCTCAGGGAAGTCCCCCCGGGG - Intronic
1129826560 15:78638470-78638492 GGGTCAGGGAAGACCTCTGTCGG - Intronic
1130531560 15:84750698-84750720 GGCTCAGGGAAGCCTTCCCTGGG + Intronic
1130655284 15:85788314-85788336 GGGTCAAGGAAGGCCTCTCTGGG - Intronic
1131813533 15:96199143-96199165 TGGTCAGGGAAGGCCTCTCTGGG - Intergenic
1132565312 16:619743-619765 GGCTCAGGTGGGTCCGCTCTGGG + Intronic
1132667642 16:1089425-1089447 GGCTCTGGGCAGTGCCCACTTGG + Intergenic
1135192517 16:20366385-20366407 GGGTCAAGGAAGTCCTCCCTTGG - Intronic
1135957890 16:26971570-26971592 TGATCAGGGAAGGCCTCTCTGGG - Intergenic
1136517073 16:30774665-30774687 GGCTGAAGGAGGTACCCTCTTGG + Exonic
1137429452 16:48406739-48406761 GGCTCAGGGAACTTCCATCTGGG + Intronic
1137564439 16:49524539-49524561 GGCCCAGGGGTGTCCACTCTGGG - Intronic
1139401486 16:66685382-66685404 GGCTCAGGGAAGACTGCTGTGGG + Intronic
1139422436 16:66856913-66856935 TGCCCAGGGAGGGCCCCTCTGGG - Intronic
1140978542 16:80084269-80084291 GACTCAGGGAAGGCCTCTGTAGG - Intergenic
1141578010 16:84977286-84977308 GGCTCAGAGAAGAATCCTCTAGG + Intronic
1141842960 16:86586136-86586158 AGCCCTGGGAAGTCTCCTCTAGG - Intergenic
1144839164 17:18175026-18175048 GGCTCAGGGAGGTGGCCTCTGGG - Intronic
1148467203 17:47872411-47872433 GACGCAGGGAACTCCCCTCCCGG - Intergenic
1151569169 17:74917562-74917584 GGCTGAGGAACTTCCCCTCTGGG + Exonic
1152270639 17:79322705-79322727 GGGTCTGGGAAGCCCCCTCTGGG + Intronic
1153787212 18:8545688-8545710 GGCACCTGGAAGTCCCCTCCAGG + Intergenic
1155964806 18:32025775-32025797 GGTTCACAGAAGTCCCCTCTAGG + Intronic
1160449211 18:78950632-78950654 GGCTCAGGGGAGTCTGCTCCAGG - Intergenic
1160973408 19:1780384-1780406 GGCTCAGGGACGTGGCCTCATGG - Exonic
1161718530 19:5890994-5891016 GGCCCTGGGAAGTCACCTCCCGG + Intronic
1162028939 19:7909184-7909206 GGGTCAGGGAGGGCCCCCCTCGG - Intronic
1162419047 19:10555390-10555412 GGCTCAGGGAAGGCCCCGCCTGG - Intronic
1163036515 19:14572221-14572243 GGCTCAGGGAAGTCCCCTCTCGG - Intergenic
1163234530 19:16022958-16022980 TGCTGTGGGATGTCCCCTCTGGG - Intergenic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
1165087518 19:33361370-33361392 GGCACCTGGAAGTCCCCTCCAGG - Intergenic
1165475203 19:36026427-36026449 GGCTCAGGGACTACCACTCTAGG - Intronic
1166523249 19:43495275-43495297 GGCTCAGAGAAGTCCCCGCCAGG + Exonic
925301741 2:2820261-2820283 GGCTCAAGGAATCCACCTCTGGG - Intergenic
927010896 2:18903207-18903229 TGCTCAGTGAAGTCCTCTCCAGG - Intergenic
927386906 2:22544992-22545014 TGGTCAGGGAAGACTCCTCTAGG - Intergenic
928127262 2:28625389-28625411 GGCTCTGGGAAGCCACCTCTTGG - Intronic
929579023 2:43070137-43070159 GCCTCAGGGCTGTCCCCTGTTGG + Intergenic
931424262 2:62156823-62156845 GGGTCAGGGAAGACACCTCCAGG + Intergenic
937913598 2:127088088-127088110 GGCTCTGGGACGTGGCCTCTCGG + Intronic
938638684 2:133256803-133256825 TGCTCAGGTAAGTGCCCTTTGGG + Intronic
939061971 2:137433203-137433225 GAATCAGGGAAGACCACTCTAGG + Intronic
940859323 2:158755920-158755942 GGCACAGGGGCGCCCCCTCTTGG - Intergenic
940967468 2:159855742-159855764 GGCACAGGGAAGTTCCCCATGGG + Intronic
941742348 2:169047929-169047951 GGCTCATAGAAGTGCCATCTTGG - Intergenic
946520291 2:220457135-220457157 GGCTCAGGGAAGTCCTGACCTGG + Intergenic
947793630 2:232881119-232881141 GGCCCAGGGACCTCCCCTCGGGG - Intronic
948274100 2:236695099-236695121 CACACAGGGATGTCCCCTCTGGG + Intergenic
948371385 2:237491639-237491661 TGATCAGGGAAGTCCTCTGTGGG + Intronic
948922533 2:241072457-241072479 GGGCCAGAGAGGTCCCCTCTGGG - Intronic
1168952751 20:1813735-1813757 TGGTCAGGGAAGGCCTCTCTGGG + Intergenic
1170845580 20:19959301-19959323 GGCTCAGGGAGATCTCCACTTGG + Intronic
1171103378 20:22407863-22407885 GGCTGAGGCAAGTATCCTCTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172804111 20:37598848-37598870 TGGTCAGGGAAGGCCTCTCTAGG + Intergenic
1174245500 20:49176789-49176811 GGCTCAGGTGAGGCCCCTATTGG - Intronic
1174503535 20:51002606-51002628 TGGTCAGGGAAGGCCTCTCTGGG + Intergenic
1176133628 20:63508579-63508601 GGCTCCGGGAACTCCCCTGGGGG - Intergenic
1176143238 20:63554166-63554188 GGCTCTGGGAAGTCCGCGCGCGG + Exonic
1176622056 21:9067335-9067357 GGCTCAGGGAGGAGCCTTCTTGG - Intergenic
1178092886 21:29183184-29183206 GCTTCAGGGAAGTCTTCTCTAGG + Intergenic
1179507423 21:41851185-41851207 TGCTCAGTGACGTGCCCTCTGGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180980514 22:19876147-19876169 GGCTCTGGGGAGGCCTCTCTGGG - Intronic
1181828888 22:25542983-25543005 TGATCAGGGAAGGCCTCTCTGGG - Intergenic
1182575044 22:31267410-31267432 TGCTCAGGGAGCTCCCCTCCAGG - Intronic
1183210813 22:36450030-36450052 AGCTCCGGGAAGTCCCCACGTGG - Intergenic
1183354827 22:37352544-37352566 GGCTCAGGGAAGACACCACAGGG + Intergenic
1183896973 22:40977305-40977327 GGGGCAGGGAAGTCCTCTTTGGG + Intergenic
1184912938 22:47548181-47548203 TGGTCAGGGAAGACCCCTCGAGG - Intergenic
950530876 3:13551617-13551639 GGCTCAGGGCACTCCCCCCACGG - Intronic
954444121 3:50537464-50537486 GGCACAGGGAAGGCACCTCCTGG + Intergenic
954939015 3:54353848-54353870 GCCTCAGGAAAGGCCCCTCAGGG + Intronic
956193915 3:66633174-66633196 GGGTCAGGGAATGCCTCTCTAGG - Intergenic
956939041 3:74136014-74136036 GGCACCTGGAAGTCCCCTCCTGG + Intergenic
959527966 3:107398733-107398755 GGCCAAGGGAAGTCCTCACTGGG + Intergenic
961554978 3:127691201-127691223 GGCCCAGCCAAGTCCCCTCTCGG + Exonic
962812450 3:138971328-138971350 GGCTCAGGGAAGGCCTCCCAGGG - Intergenic
965212788 3:165816450-165816472 GGATCAGGGAAGTCAACTCAGGG - Intronic
965360576 3:167734567-167734589 GCCTCCAGGAAGTCTCCTCTAGG - Intronic
968458308 4:710187-710209 GGCTCAGGGACCTCCCATCTGGG + Intronic
968663485 4:1808744-1808766 GGCTCAGGGTGGTCTCTTCTTGG + Exonic
968779688 4:2571040-2571062 GGCTCTGCGAAGTCCCCCATAGG - Intronic
968975658 4:3820915-3820937 GCCTCCGGGAAGTTCCCTCCTGG - Intergenic
969435576 4:7187345-7187367 GGCCCAGGGGCTTCCCCTCTGGG + Intergenic
970044440 4:11835101-11835123 TACTCAGGGAAAACCCCTCTGGG + Intergenic
970240054 4:13999711-13999733 GGCTAAGGGATGGCCCCTCCTGG + Intergenic
973345123 4:49046985-49047007 GGCTCAGGGAAGTCAGTCCTAGG - Intronic
976213078 4:82691614-82691636 GGCCCATGAAAGTCACCTCTAGG - Intronic
978589733 4:110312139-110312161 TGTCCAGGGAAGTCCTCTCTGGG - Intergenic
982209211 4:153021265-153021287 GGCTCTGGGAAGCCCCCTCAGGG + Intergenic
983627693 4:169818878-169818900 GGCTCTGGGATGTCATCTCTGGG - Intergenic
985032322 4:185801832-185801854 GGCTCAGGGAAGTGCTCATTGGG - Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
986519741 5:8601979-8602001 AGCTCAGGGAGGTCAACTCTGGG - Intergenic
990339858 5:54811638-54811660 GGCACAGTGAAGTCCCCACTTGG + Intergenic
991421965 5:66451353-66451375 TGCTGAGGAAAGTCCACTCTGGG - Intergenic
998225276 5:140322074-140322096 GGGTCAGGGAGGTCACTTCTTGG - Intergenic
999072975 5:148767432-148767454 TGATCAGGGAAGTCTTCTCTGGG + Intergenic
1001080634 5:168664842-168664864 GGGGCAGGGAAGTCCCCTTCAGG + Intronic
1001408620 5:171494925-171494947 GGCCCAGGGAAGCCCCTTGTAGG - Intergenic
1003174621 6:3745609-3745631 GGCTCAGGGATCTCCCCACCTGG - Intronic
1003573120 6:7268915-7268937 GGCTCTGGGAAGTCACCGCTGGG - Intronic
1006151368 6:31991948-31991970 GGTGCAGGGAAGAGCCCTCTGGG + Intronic
1006157669 6:32024686-32024708 GGTGCAGGGAAGAGCCCTCTGGG + Intronic
1007590697 6:43018993-43019015 GGCTCAGGGAAGTCACTAATGGG + Intronic
1009957023 6:70468007-70468029 GGCTCAGACAAGTCCCCTGCAGG - Intronic
1010234569 6:73564589-73564611 GGCTCAAGTAAGTCGCCTCTTGG - Intergenic
1011652669 6:89521305-89521327 AGGTCAGGGAAGGCCTCTCTGGG + Intronic
1012261404 6:97091571-97091593 GGCACAGGTCAGTCCCCACTGGG - Intronic
1012853407 6:104473263-104473285 GGCTCAGGGAAGACCCCCGACGG - Intergenic
1013430851 6:110053671-110053693 GGCTCAGGGAGGACCCTGCTAGG + Intergenic
1015687381 6:135880270-135880292 AACTCAGGGAAGTCTCCGCTTGG + Intronic
1017978944 6:159381747-159381769 GGCACAGGGAAGCGCCATCTGGG + Intergenic
1019540804 7:1550198-1550220 GGCTCAGGGACGTCCCCCGCAGG - Exonic
1019602791 7:1893621-1893643 AGCTCAGGGAAGACCCTCCTGGG + Intronic
1019750357 7:2725301-2725323 GGCCCAGGGCAGCCCCTTCTAGG - Intronic
1027055483 7:75046611-75046633 GGCTGAGGGCAGTCTCCTCTTGG - Intronic
1028155313 7:87422716-87422738 TGCTCAGGAAAGGCCCCTCTGGG - Intronic
1028226035 7:88253920-88253942 GCCTCAGAGAAGACCCCTTTGGG + Intergenic
1032089909 7:128906308-128906330 GGCTCAGGGCAGGGTCCTCTTGG + Exonic
1032092335 7:128917226-128917248 GGCTCAGGGCAGGGTCCTCTTGG - Intergenic
1033742170 7:144284010-144284032 GGCCCAGGGAGGTCACCTGTGGG - Intergenic
1033751732 7:144365604-144365626 GGCCCAGGGAGGTCACCTGTGGG + Exonic
1034490778 7:151392147-151392169 GGGTCCGGGAGGTCCACTCTTGG - Intronic
1035272518 7:157728834-157728856 GGCTCATGGAAGTCTCTTCTGGG - Intronic
1036012629 8:4744223-4744245 GGCACAGGCAAGTCCCCACTTGG + Intronic
1040079635 8:43274345-43274367 GGCTGAGGAGGGTCCCCTCTGGG - Intergenic
1040818034 8:51529452-51529474 GGCTCTGGGAAGCCTCCCCTAGG + Intronic
1043085250 8:75823639-75823661 AGCTCAGGGAAGTCAACCCTGGG + Intergenic
1043120760 8:76320129-76320151 GCCTCAAGTTAGTCCCCTCTTGG - Intergenic
1048904488 8:139074795-139074817 TGCTGGGGGAAGTCACCTCTGGG - Intergenic
1049095269 8:140544864-140544886 CTCCCAGGGAAGTCCCCACTGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056135317 9:83624562-83624584 TGGTCAGGGATGTCTCCTCTGGG + Intronic
1056492369 9:87120261-87120283 CTCTCAGGGAAGTGCTCTCTGGG - Intergenic
1061913564 9:133737743-133737765 GGCTCTGGGCTGTCCCCGCTGGG - Intronic
1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG + Intronic
1062236920 9:135514809-135514831 GGCTCCAGGAAGCCCTCTCTGGG - Intergenic
1062239247 9:135526863-135526885 GGCTCTGCCCAGTCCCCTCTGGG - Intergenic
1062607926 9:137356340-137356362 GGCTCAAGGAGGTCACCTCAGGG + Exonic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1186561221 X:10615571-10615593 TTTTCAGGAAAGTCCCCTCTTGG + Intronic
1187708088 X:22027117-22027139 TGCCCAGGCAAGTCCCTTCTTGG + Intergenic
1189294204 X:39907433-39907455 GGCTCAGGGAAGTTACCCCACGG - Intergenic
1195405535 X:104509036-104509058 CCCTAAGGTAAGTCCCCTCTAGG - Intergenic
1201158577 Y:11152792-11152814 GGCTCAGGGAGGAGCCTTCTTGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic