ID: 1163038103

View in Genome Browser
Species Human (GRCh38)
Location 19:14583293-14583315
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 3, 1: 1, 2: 7, 3: 57, 4: 558}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163038103_1163038115 30 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038115 19:14583346-14583368 TCCCCTGGAAGGGACCATGGAGG 0: 3
1: 0
2: 1
3: 16
4: 191
1163038103_1163038112 20 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038112 19:14583336-14583358 GACTTGCCTTTCCCCTGGAAGGG 0: 3
1: 1
2: 1
3: 11
4: 159
1163038103_1163038114 27 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038114 19:14583343-14583365 CTTTCCCCTGGAAGGGACCATGG 0: 3
1: 0
2: 2
3: 17
4: 210
1163038103_1163038111 19 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038111 19:14583335-14583357 TGACTTGCCTTTCCCCTGGAAGG 0: 3
1: 0
2: 0
3: 15
4: 171
1163038103_1163038109 -7 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038109 19:14583309-14583331 GGAGGGAGGAGGGAATGGCTGGG 0: 3
1: 1
2: 15
3: 134
4: 1465
1163038103_1163038110 15 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038110 19:14583331-14583353 GCTCTGACTTGCCTTTCCCCTGG 0: 3
1: 0
2: 6
3: 27
4: 256
1163038103_1163038108 -8 Left 1163038103 19:14583293-14583315 CCAGGGCTTGAGGGATGGAGGGA 0: 3
1: 1
2: 7
3: 57
4: 558
Right 1163038108 19:14583308-14583330 TGGAGGGAGGAGGGAATGGCTGG 0: 3
1: 0
2: 13
3: 197
4: 1883

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163038103 Original CRISPR TCCCTCCATCCCTCAAGCCC TGG (reversed) Intronic
900105103 1:977923-977945 TCCCACCACCCCGCAACCCCGGG + Intronic
900504181 1:3021055-3021077 TCCCTCCATCCCATTAGTCCTGG - Intergenic
900563351 1:3319586-3319608 TCCTTCCATCCCTGAAGCCAGGG - Intronic
900581426 1:3411750-3411772 TCCCTCCATCCTTGTACCCCCGG + Exonic
900624044 1:3600121-3600143 TCCCTGCATCTCCCCAGCCCGGG + Intronic
900627751 1:3617075-3617097 TCCCTCCAACCCTCCAACCCCGG + Intergenic
900857980 1:5201207-5201229 TCCCTTGCTCTCTCAAGCCCAGG - Intergenic
901112473 1:6809504-6809526 TCTCTCCCTGCCCCAAGCCCAGG - Intronic
901135411 1:6989881-6989903 TCCCTCTATTCCTCCAGCCCAGG - Intronic
903010333 1:20325431-20325453 CCCCTCCCTCTCCCAAGCCCAGG + Intronic
903152247 1:21418404-21418426 TCCCTCCATCCTTCTAGACAAGG + Intergenic
903180761 1:21603698-21603720 CCACTCCATCCCGCACGCCCTGG + Intronic
903263017 1:22141646-22141668 CACCTCCGTCCCCCAAGCCCTGG + Intronic
903337878 1:22636889-22636911 TCTCACCCTCCCCCAAGCCCTGG - Intronic
903369222 1:22824550-22824572 TCCCTCCCTCCTTCTGGCCCTGG - Intronic
903439019 1:23373233-23373255 TTCCTCCTCCCCTCAAGCCCTGG - Intergenic
903566100 1:24266832-24266854 TCCCTCCCTCCCTCCCTCCCGGG - Intergenic
903578742 1:24355436-24355458 TCCCAGCATCCTTCAAGTCCAGG - Intronic
904272060 1:29356604-29356626 TCCACCCATCCCTGAAGCCATGG + Intergenic
905390765 1:37634303-37634325 CCCCTCCATCCCGCAGCCCCGGG - Intronic
905815748 1:40949436-40949458 TCCCTCCTTACCTCACTCCCTGG - Intergenic
906205276 1:43983306-43983328 TCCCTCCATCCCTGAAGTGCTGG - Intronic
906520510 1:46464347-46464369 TCCTTCCCTCCCTCAATCCTGGG - Intergenic
907903291 1:58761293-58761315 ACCCTCCATCCCCCAATACCTGG - Intergenic
908260281 1:62334949-62334971 TCACTGAATCCCTCAAGGCCTGG - Intergenic
908916870 1:69138251-69138273 CCCCTCCATCCCTGAACCACTGG - Intergenic
908971792 1:69844353-69844375 TCCCTCCTCCCCTCAGCCCCTGG + Intronic
910356683 1:86365398-86365420 TCCCTCCATCCATCCATACCAGG - Intronic
910677396 1:89828279-89828301 TCCCATCATCCATCCAGCCCAGG - Intronic
911047788 1:93642815-93642837 TCCCTCCATCACCCAGGCACTGG - Intronic
911368804 1:96972627-96972649 TCCCTCCCTCCCTCCCACCCAGG + Intergenic
913587005 1:120285422-120285444 TCCCTCCTCCCCACAACCCCTGG - Intergenic
913621180 1:120612948-120612970 TCCCTCCTCCCCACAACCCCTGG + Intergenic
914569019 1:148897307-148897329 TCCCTCCTCCCCACAACCCCTGG - Intronic
914603808 1:149232949-149232971 TCCCTCCTCCCCACAACCCCTGG + Intergenic
914747741 1:150512069-150512091 TCCATCCATCCGTCCAGCTCTGG + Intronic
914959265 1:152191655-152191677 TCTACCCATCCCTCAAGACCAGG - Intergenic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915299196 1:154942315-154942337 TCCCTCCTTCCCACAGGCCTTGG - Intergenic
915737525 1:158094410-158094432 GCCCACCAGCCCTCATGCCCTGG - Intronic
916059644 1:161089670-161089692 TCCCTCCTTCCCTCCCTCCCTGG - Intergenic
916213523 1:162377115-162377137 TACCCCCAGCCCTCCAGCCCTGG + Intronic
917305080 1:173616397-173616419 TTCTTCCCTCCCTCAAGCCCTGG - Intronic
918412770 1:184277438-184277460 TCCCTCCATCCCCCAACCCCTGG - Intergenic
919478150 1:198054449-198054471 GCCATCCCTCCCTCAACCCCAGG - Intergenic
919841981 1:201615969-201615991 TCCCTCCATCCCACGTACCCAGG - Intergenic
919917627 1:202148557-202148579 TGCCTACCTCCCTCAAGCCTGGG - Exonic
922180730 1:223231053-223231075 CCCCTTCATCCCACCAGCCCAGG - Intronic
922322811 1:224503035-224503057 TCCCTCCCTCCCTCCCTCCCCGG - Intronic
922791694 1:228314515-228314537 CCCCTACCTCCCTCTAGCCCTGG - Intronic
922952225 1:229568758-229568780 GCACTCCAGCCCTCCAGCCCGGG - Intergenic
923226369 1:231942069-231942091 TCCCTCTTTCCCTCATCCCCTGG - Intronic
923619586 1:235567467-235567489 TCTCTCCTTCCCCCAGGCCCTGG + Intronic
923674838 1:236071454-236071476 TCCCTCCCTCCCTCAGCCTCTGG + Intergenic
924798538 1:247310288-247310310 TCCCCCCACACCTCAAGACCAGG - Intronic
1062834567 10:627227-627249 TCCCTCCAGGCGTCATGCCCCGG + Intronic
1063412767 10:5849419-5849441 TCCTTCCATTCCTCAAGTCTTGG + Intergenic
1063586963 10:7361118-7361140 TCTCTGCTTCCCTCAAGCCTGGG + Intronic
1064128442 10:12685711-12685733 TCTCTCAATCTCTCCAGCCCAGG - Intronic
1064561542 10:16599346-16599368 GCCAACCATCCCTCAAACCCGGG + Intronic
1064810479 10:19192167-19192189 TCCTTTCTTCCCTCAGGCCCAGG - Intronic
1064956984 10:20922284-20922306 TCCCTCCATCCCCCTACCCATGG + Intronic
1065360526 10:24885044-24885066 TCCCTCCAGGCTGCAAGCCCAGG - Intronic
1067488135 10:46672010-46672032 TCCCTCCCTCCCTCAGCCCCTGG - Intergenic
1067606666 10:47670018-47670040 TCCCTCCCTCCCCCAGCCCCTGG + Intergenic
1069604580 10:69731488-69731510 TCCCTCCCTCCCTCCATCCTGGG + Intergenic
1070712169 10:78690738-78690760 ACCCTCAAGCCTTCAAGCCCAGG + Intergenic
1071499237 10:86191730-86191752 CCCATTCATCCCTCGAGCCCTGG + Intronic
1071622233 10:87131370-87131392 TCCCTCCCTCCCTCAGCCCCTGG + Intronic
1074198219 10:111207945-111207967 GCCCCCCATCCCTCCACCCCAGG + Intergenic
1074857238 10:117482429-117482451 TCCCTCCCTCCCTGGAACCCAGG - Intergenic
1075072007 10:119325952-119325974 TCCCTCCTTCCTTCCAGCCTCGG + Intronic
1075112667 10:119599981-119600003 TCTCTCCTTCCCTGATGCCCAGG - Intergenic
1075586045 10:123658973-123658995 TCCCCCCTTCCCTCCAGCCTGGG + Intergenic
1075635364 10:124026932-124026954 GCCCTCCTTCCCTCCAGCCTAGG - Intronic
1076068726 10:127469192-127469214 CCTCTCCATCCCGCAAGGCCTGG + Intergenic
1076294472 10:129373974-129373996 TGCCACCAACCCTCCAGCCCTGG - Intergenic
1076700000 10:132266672-132266694 TCCTTCCTCCCCTCCAGCCCTGG - Intronic
1077212518 11:1378426-1378448 GCCCTCCAACCCTCCAGCCTGGG + Intergenic
1077264685 11:1642819-1642841 TCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1078663923 11:13308906-13308928 TCCCTCCTCCCCGCAACCCCTGG - Intronic
1078922765 11:15845636-15845658 TCCCCCCAGCCCTCACCCCCAGG - Intergenic
1079172062 11:18105855-18105877 TCCCTACATCCCCCAGGCACCGG - Intronic
1079209720 11:18450228-18450250 TCCCTCCATTCCTGCAGCCAAGG - Intronic
1080369398 11:31617409-31617431 TCCCTCTTTCCCTCAACCCCTGG - Intronic
1080484471 11:32691018-32691040 TCTCTCCCTCCTTCAACCCCTGG + Intronic
1080528523 11:33151091-33151113 TCCCTCCAATCCCTAAGCCCTGG + Intronic
1081460841 11:43271510-43271532 CTCCTCCATTCCCCAAGCCCCGG - Intergenic
1083399073 11:62411523-62411545 CCCCTCCCTCCCTGAAACCCTGG + Intronic
1083708753 11:64534568-64534590 TCCCTCCATCCTTCCCGTCCTGG + Intergenic
1084462699 11:69304775-69304797 TCCCTCCCTCCATGAAACCCTGG + Intronic
1084872200 11:72105914-72105936 TCCCTACCTCCCTCCACCCCAGG + Exonic
1085042488 11:73334768-73334790 TCTCTCCCTCCCTCAGACCCAGG - Intronic
1085494546 11:76956030-76956052 TCTCTCAACCCCTCCAGCCCTGG - Intronic
1087636187 11:100704296-100704318 TCCCTAATTCCCTCAACCCCGGG - Intronic
1087938248 11:104061006-104061028 TTCCTCCTTCCCACAGGCCCTGG + Intronic
1087970219 11:104471765-104471787 TCCCTCCTTCCCTCAAGCCCTGG - Intergenic
1087976673 11:104557598-104557620 TCCCTCCCTCCCCCAACCTCGGG - Intergenic
1088608321 11:111552678-111552700 TCCCTCCATACTTCAATCCACGG - Intronic
1088923673 11:114280267-114280289 TCCCTCCAGCCCTCTGCCCCAGG - Intronic
1089088152 11:115841457-115841479 TCCCTCCCTTCCTCCAGCACAGG + Intergenic
1089300785 11:117497623-117497645 TCCCTCCTTCCCTCCAGCAGCGG + Intronic
1089395521 11:118134333-118134355 TCTCTCTAGCCCACAAGCCCTGG + Exonic
1089432306 11:118435125-118435147 AGCCTCCATCCCCCAAGCCGAGG - Exonic
1089679360 11:120110760-120110782 TTCCTCCGTCCCCCAAGCCCAGG + Intergenic
1089731716 11:120523448-120523470 CTCCTCCACCCCTAAAGCCCAGG - Intronic
1090496486 11:127217688-127217710 TCCCTCCATCCCAGAAGATCAGG - Intergenic
1090630565 11:128643839-128643861 TCCCTCCACCACTCAACCACAGG + Intergenic
1091180272 11:133598028-133598050 TCCCTCCCTTCCTCAACTCCAGG + Intergenic
1091396991 12:159712-159734 TTCTTCCATCCATCATGCCCAGG + Intronic
1091444229 12:534474-534496 TCCCTCCCTCCCTCTCGCCATGG + Intronic
1091688235 12:2578790-2578812 CCCCTGCCTCCCTCAACCCCTGG - Intronic
1092107381 12:5931438-5931460 TGGCTCCTTCCATCAAGCCCTGG + Intronic
1092249348 12:6883978-6884000 GCCCTGCCTCCCTCCAGCCCAGG - Intronic
1094281983 12:28750263-28750285 TCCATCCATCACTCCTGCCCAGG - Intergenic
1094352043 12:29537743-29537765 CCCCTCCATCTCCCACGCCCCGG + Intronic
1095416432 12:41982262-41982284 TCCCTCAATCCCTCAATCCCTGG + Intergenic
1096014928 12:48261962-48261984 ACCCTTCACCCTTCAAGCCCTGG + Intergenic
1096260393 12:50086359-50086381 TCCCTCCCTCCCTCTGCCCCAGG - Intronic
1096846392 12:54409402-54409424 TTCCTCCCTCCCTCCAGGCCCGG + Intronic
1097945789 12:65366243-65366265 TCCCTCCAGCCCTCAGGTCCAGG + Intronic
1098682102 12:73369408-73369430 TCCCTCCTTCCCCCAGCCCCAGG + Intergenic
1100528461 12:95442134-95442156 TTTCTCCCTCCCTCAATCCCTGG - Intergenic
1100611327 12:96194166-96194188 TCCCTCCTCACCTCAACCCCTGG - Intergenic
1102416948 12:112772133-112772155 TCCCTCTTTCCCTTATGCCCCGG + Intronic
1102438540 12:112944237-112944259 TCCCTCCATCCCAAATGGCCAGG - Intronic
1102731685 12:115116849-115116871 TCCCTCCATCCCTCAGCCCCTGG + Intergenic
1103242294 12:119423662-119423684 TCCCTTAATTCCTCCAGCCCTGG + Intronic
1103979389 12:124726707-124726729 TCCCTCCTCCCTTCCAGCCCAGG + Intergenic
1104109120 12:125689029-125689051 TCCCTGGGGCCCTCAAGCCCTGG - Intergenic
1104640381 12:130463251-130463273 TCCCTGCATCCCTGCAGCCGGGG - Intronic
1104955298 12:132461943-132461965 TCCCTCCTTCCCTCAGGTCTTGG - Intergenic
1105386165 13:19931477-19931499 TCCCTCCCTCTCCCAACCCCTGG + Intergenic
1105970578 13:25426069-25426091 TCTCTCCCTCCCCCAACCCCTGG - Intronic
1107457325 13:40566922-40566944 TGCCCCCATCCCTCAAGACTGGG + Intronic
1108005706 13:45944271-45944293 TCCTTCCATTCCTTAAGCCCAGG - Intergenic
1108361695 13:49673808-49673830 CACCTCCATCCCTTAACCCCTGG - Intronic
1108421258 13:50252154-50252176 TCCTTACATCCCTCTAGCTCTGG + Intronic
1108482308 13:50886420-50886442 TCCCTCCATCCCTGAACCACTGG - Intergenic
1108533323 13:51347276-51347298 TCTCTCCTGCCCTCAGGCCCAGG - Intronic
1110385435 13:74905481-74905503 TTCCTCCTTCCCTCCAGCTCTGG - Intergenic
1111000440 13:82172531-82172553 TCCCTCCATCCTTGCACCCCTGG - Intergenic
1111807259 13:93053136-93053158 TCCCTCCCTCCCTCTACCCCTGG - Intergenic
1112214897 13:97420015-97420037 TGCCTCCATTCCTCAAGCCCTGG - Intergenic
1112463433 13:99622700-99622722 TCCCTCCTCTCCTCAACCCCTGG + Intronic
1112464731 13:99633586-99633608 TCCCTCCTCCCCTCAACCTCTGG - Intronic
1112472932 13:99705739-99705761 TCCCTCCTTCCCCCCAGCCCCGG - Intronic
1113059884 13:106311146-106311168 TCTCCCCATCCATCATGCCCAGG - Intergenic
1113475491 13:110577808-110577830 TCCTTCCCTCCCCCAACCCCTGG + Intergenic
1113780779 13:112975935-112975957 TCCCTCCCTCCTTCCACCCCAGG + Intronic
1115030161 14:28785270-28785292 TCCCTCCTTCCCCGAAGCCTGGG - Intronic
1116429742 14:44832129-44832151 TCTCTCCTTCCCCCAACCCCTGG + Intergenic
1117032266 14:51685211-51685233 TCCATCCATCCATCTATCCCAGG - Intronic
1118268548 14:64319004-64319026 GCACTCCAGCCCTCCAGCCCTGG + Intronic
1118449953 14:65891739-65891761 TCCTTCCCTCCCCTAAGCCCTGG - Intergenic
1118542578 14:66844880-66844902 TTCCTCCCTCCCCCAACCCCTGG + Intronic
1118588212 14:67377224-67377246 TCCTTCCATCCATCCAGCCTTGG + Intronic
1119027994 14:71168967-71168989 TCCCTTTTTCCCTCCAGCCCTGG + Intergenic
1119144116 14:72294694-72294716 TCTCTCCCTCCCTCCTGCCCTGG - Intronic
1119421069 14:74508389-74508411 TCCCTCCCTCCCTGAGCCCCGGG + Intronic
1119843660 14:77812287-77812309 TCCCTCCAACCCCCAGCCCCTGG + Intronic
1120521708 14:85533198-85533220 TCCCTCCGTCCCTCGCGCTCTGG - Intronic
1120870364 14:89331206-89331228 TCCCACCTTCCCCCAGGCCCTGG + Intronic
1120995114 14:90411647-90411669 TCCCCCCATCCCCTAATCCCCGG + Intergenic
1121533297 14:94673594-94673616 TCCCTCCTTACCCCAAGCCCTGG + Intergenic
1121741160 14:96253231-96253253 TTCATCCATCACTCAAGTCCTGG - Intronic
1123457219 15:20436987-20437009 TCCCTCCTCCCCTCCATCCCAGG - Intergenic
1123660839 15:22563372-22563394 TCCCTCCTCCCCTCCATCCCAGG + Intergenic
1124231666 15:27951582-27951604 TCTCTCCCTCCCTCCTGCCCAGG + Intronic
1124314641 15:28657610-28657632 TCCCTCCTCCCCTCCATCCCAGG + Intergenic
1124712933 15:32030383-32030405 CCCCCCCATCCCTCCAGCCCGGG - Intergenic
1125680628 15:41528021-41528043 ACCCTCCTGCCCTCAGGCCCAGG - Exonic
1126572242 15:50164557-50164579 TTCATCCCTCCCTCAACCCCAGG - Intronic
1127913595 15:63437722-63437744 TCCTTCCATCTCTCCAGCCAAGG - Intergenic
1128155362 15:65388586-65388608 TCCCTGCCTCCCTCACCCCCAGG - Exonic
1128254473 15:66186593-66186615 TGTCTCCATCTCTCGAGCCCCGG + Intronic
1128812287 15:70581287-70581309 TAGCTCCATCCTTCAAACCCAGG + Intergenic
1129198617 15:73985472-73985494 TACCTCCAGCCCCCAGGCCCTGG + Exonic
1129517714 15:76166651-76166673 TCCCTCCACCCCTCACTCCTGGG + Intronic
1129605851 15:77024735-77024757 TCCCTCCCTCCCTCCCTCCCTGG + Intronic
1130128220 15:81112581-81112603 TCCCTCCCTACCTCCAGCCAAGG - Intronic
1130235880 15:82132979-82133001 TCCCTCCCTTCCTCCTGCCCAGG - Intronic
1131971289 15:97895629-97895651 TCCCCCCTCCCCTCAACCCCTGG - Intergenic
1132303692 15:100792738-100792760 TCCCTCCTCCCTTCAGGCCCTGG - Intergenic
1132410640 15:101575864-101575886 TCCCTTCCTCCCCCAACCCCAGG - Intergenic
1132851841 16:2028338-2028360 ACCCTCAATCCCTCAGGTCCAGG - Intronic
1132886974 16:2186647-2186669 TGCTTCCAGCCCCCAAGCCCAGG + Intronic
1132943369 16:2519427-2519449 TCCCTGCAGTCCTCCAGCCCTGG - Intronic
1132980845 16:2738068-2738090 GCCCTCCCTCCCACAAGCCATGG + Intergenic
1133033479 16:3022418-3022440 TCACTCCCTCCCTCCAGCTCAGG - Intergenic
1133605049 16:7378701-7378723 TCCCTGCATCCGCCAAACCCTGG + Intronic
1133742354 16:8661062-8661084 GCCCTGCTTCCCTCAAGCCGCGG - Intergenic
1133782211 16:8948205-8948227 TTCCTCCCTCCCACCAGCCCAGG + Intronic
1134118415 16:11566677-11566699 TCCCTCGATCACTTGAGCCCAGG + Intronic
1134210664 16:12273768-12273790 TCCCTCCTTCCCCCAGACCCTGG + Intronic
1135382789 16:22008266-22008288 TCCCCCCACCCCCCGAGCCCCGG - Exonic
1135776981 16:25265421-25265443 TCCCTCCATCACCCAAGCTGGGG + Intergenic
1136147783 16:28325712-28325734 TCCCTCCAGCCCCCACGCCTGGG + Intergenic
1136483796 16:30558273-30558295 TCCCTCCTTCCCTTGGGCCCGGG - Exonic
1137658119 16:50178794-50178816 TCCCTCCTCCCCACAGGCCCTGG - Intronic
1137902475 16:52283757-52283779 TCCACCCATCCTTCAAGGCCTGG + Intergenic
1138343704 16:56307244-56307266 TCCCTCCTTCCCAGAATCCCGGG + Intronic
1139283244 16:65787583-65787605 TCCCCTCATCCTTCCAGCCCTGG - Intergenic
1139358757 16:66383520-66383542 TCCCTCCATCCTCCCTGCCCTGG + Intronic
1139700410 16:68704576-68704598 TCCCTCCCTCCCTGCAGACCTGG - Intronic
1139765786 16:69228752-69228774 TGCCTACAACCCTCAAGCACAGG + Intronic
1140138771 16:72233739-72233761 TCCCTCCTTCCCTCAGCCCCTGG + Intergenic
1140289556 16:73640030-73640052 CTCCTCCATCCCTCAAAGCCAGG + Intergenic
1140394799 16:74617390-74617412 CCCCTCCATAGCTCAAGCCTGGG + Intergenic
1140461961 16:75147115-75147137 TTCATCCATCCCACAACCCCTGG - Intergenic
1140548424 16:75835549-75835571 TCCCTCCAGTCCTTAAGGCCAGG + Intergenic
1141208656 16:81956060-81956082 TCACTCCATCCCCCAGACCCCGG + Intronic
1141508855 16:84499662-84499684 TTCCTCCCTCCCACATGCCCTGG + Intronic
1141734052 16:85840489-85840511 TTCCTCCACCCCTCCACCCCTGG - Intergenic
1142175600 16:88643615-88643637 TCCCTCCCTCCCTCCCTCCCCGG + Intronic
1142290111 16:89190227-89190249 TGCTTCCTTCCCTCAGGCCCTGG + Exonic
1142642374 17:1291771-1291793 TCCCTCCATCCTTCAAGGGGTGG - Intronic
1142733584 17:1879934-1879956 CCCCTCCCTCCCTCAACTCCAGG - Intronic
1142733621 17:1880067-1880089 CCCCTCCCTCCCCCAACCCCAGG - Intronic
1143255100 17:5551190-5551212 TCCTCCCTTCCCCCAAGCCCTGG + Intronic
1143260820 17:5596977-5596999 CCCATCCATCTCTCCAGCCCTGG - Intronic
1143293938 17:5856565-5856587 TCCTCCCATCCCTAAAGCCTTGG + Intronic
1144140514 17:12342799-12342821 TCCCCCCATCCCTCCAGCAGGGG + Intergenic
1144753818 17:17667818-17667840 TGCCCCCATCCCACAGGCCCTGG + Intergenic
1144959884 17:19039022-19039044 TGCCTCCATCCGTCAAGCCATGG - Intronic
1144975276 17:19135502-19135524 TGCCTCCATCCGTCAAGCCATGG + Intronic
1145187424 17:20806972-20806994 TTCCTCCATCCCTCAGTCCTAGG + Intergenic
1145873184 17:28293725-28293747 TCACTGCATCCCTCAACTCCTGG + Intergenic
1146067180 17:29645341-29645363 TCCCTCCATGAATCAAGCCTAGG + Intronic
1146269995 17:31478625-31478647 TCCCTCCCTCCCTGGAGCCCTGG + Intronic
1146623071 17:34415294-34415316 TCCAGCCGTCCCTCAAGTCCGGG - Intergenic
1146851567 17:36226433-36226455 TTCCTCCATCCCTCAGTCCTAGG - Intronic
1147097824 17:38154415-38154437 TTCCTCCATCCCTCAGTCCTAGG - Intergenic
1147310084 17:39590568-39590590 GGCCTCCATCCCTCAGGGCCAGG - Intergenic
1147614808 17:41821637-41821659 TCCTGCCCTCCCTCCAGCCCGGG + Exonic
1147740629 17:42669456-42669478 TCTCTCCCACCCTCAAGGCCAGG + Exonic
1147747865 17:42706572-42706594 CCCCTACATCCATCAAGCCTGGG - Intronic
1147752513 17:42744930-42744952 CCTCTCCCTCCCTCAGGCCCAGG + Intronic
1148384521 17:47224534-47224556 TCCCTCCTTCCCCCAGCCCCTGG + Intergenic
1149000366 17:51751253-51751275 TTCCTCCCTCCCTCAGTCCCTGG - Intronic
1149208271 17:54274454-54274476 TCTCTCCATCACCCAGGCCCAGG + Intergenic
1149568091 17:57653472-57653494 TCCCTCAGTCCCCCCAGCCCCGG + Intronic
1150079521 17:62224536-62224558 TTCCTCCATCCCTCAGTCCTAGG - Intergenic
1151109189 17:71654849-71654871 TCCCTTAATCCCTTGAGCCCGGG - Intergenic
1151317877 17:73335096-73335118 TCTGTCCATCCCTCACCCCCCGG - Exonic
1151403510 17:73871731-73871753 TCTATGCATCCCTCAAGCCTTGG - Intergenic
1151855129 17:76715641-76715663 TGCCTCCAACGCTCCAGCCCAGG + Exonic
1152224243 17:79085401-79085423 CCCCTCCATCCCTCCAGCTCTGG - Intronic
1152259848 17:79260986-79261008 TCCCTCCCTCCCTCCCGTCCTGG + Intronic
1152298595 17:79482723-79482745 TCCCTCAATCCCTCGATCCCTGG - Intronic
1152513755 17:80808678-80808700 TCTCCTTATCCCTCAAGCCCAGG + Intronic
1152680308 17:81664451-81664473 TCCCACCTTCCCCCAAGTCCTGG - Intergenic
1152704280 17:81834717-81834739 TCCCACCACCCCACAGGCCCTGG + Intronic
1155482232 18:26301768-26301790 TCCATTCATCCCTCAAGTTCTGG + Intronic
1156451475 18:37268894-37268916 TCCCTCCCTCCCTCTTGCTCTGG + Intronic
1156610504 18:38718648-38718670 GCCCGCCAGCCCGCAAGCCCTGG - Intergenic
1157305414 18:46513566-46513588 TCACTCCAGCCTTCAAGGCCAGG - Intronic
1157332889 18:46716413-46716435 ACACTCCATCCCAGAAGCCCAGG + Intronic
1157651818 18:49340635-49340657 TCCTTTCATCCCACAAGCCCTGG - Intronic
1158725688 18:59969618-59969640 CCCCTTCATCCCTCGCGCCCGGG + Intergenic
1159131811 18:64288360-64288382 TCCTTCCATCTCTATAGCCCAGG - Intergenic
1159615876 18:70578934-70578956 AACCTCCATCCCTCTATCCCTGG + Intergenic
1159706962 18:71702626-71702648 TTCCTCCCTTCCCCAAGCCCTGG - Intergenic
1159721506 18:71897628-71897650 TCCCTCCTTCCCTCAACACATGG - Intergenic
1159900810 18:74043834-74043856 CCTCTACATCCCTCAAGCCTGGG + Intergenic
1160067596 18:75590861-75590883 TTCCTGCCTCCCTCAGGCCCTGG + Intergenic
1160370471 18:78368699-78368721 TCCCGCCCTCCCTCAGGTCCTGG + Intergenic
1160797734 19:953528-953550 TCCCTCCATCCCCAGAGCCACGG + Intronic
1161091036 19:2360195-2360217 CCCCTCCCTTCCTCCAGCCCCGG + Intergenic
1161170588 19:2810618-2810640 TCTCTCCTTCCCTCCCGCCCAGG + Exonic
1161587914 19:5115379-5115401 TCCCCCCAACCCCCAAGGCCAGG + Intronic
1161682034 19:5684913-5684935 TTTCTCCCTCCCTCAACCCCAGG - Intronic
1162577081 19:11505456-11505478 TCCCTCCCTCCCTCGGGGCCAGG + Intronic
1163020256 19:14477825-14477847 TCCCTCCCTCCCTCCTGCTCTGG + Exonic
1163038103 19:14583293-14583315 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163038792 19:14587550-14587572 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163039538 19:14592217-14592239 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163443057 19:17331266-17331288 TCCCTCCCACCCCCCAGCCCAGG + Intronic
1164683118 19:30149224-30149246 TACCTCAATCCCTCCAGCACAGG - Intergenic
1164751586 19:30659287-30659309 TCCCTCCTTTCCTCCTGCCCTGG - Intronic
1165437630 19:35805058-35805080 TCCCTCCTCCCCTCAGCCCCTGG - Intronic
1165537176 19:36458486-36458508 TTCCTCCGTCCCCCAACCCCTGG - Intronic
1165670262 19:37672376-37672398 TCCATCCCTCCCTCACTCCCAGG - Intronic
1166123932 19:40702556-40702578 TCCCTCCTTCCCTCCCTCCCAGG - Intronic
1166368676 19:42290018-42290040 TCTCCCCCTCTCTCAAGCCCGGG - Intronic
1166631149 19:44409173-44409195 TCCTTGCAACCCTCAAACCCCGG - Intergenic
1166632026 19:44415300-44415322 TCCTTGCAACCCTCAAACCCCGG - Intergenic
1166632454 19:44418985-44419007 TCCTTGCAACCCTCAAGCCCCGG - Intronic
1166637025 19:44459408-44459430 TCCTTGCAACCCTCAAACCCCGG + Intergenic
1167422450 19:49412264-49412286 TTCCTCCATCCCTAGGGCCCTGG - Intronic
1168109040 19:54181614-54181636 TCCCTCCCTCCCTCCCTCCCTGG - Intronic
1168336153 19:55599010-55599032 TCCTTCCACCCCTCAATCCAGGG + Intronic
1168352552 19:55685047-55685069 TCCATCCCTCCCTCCACCCCTGG + Intronic
925575120 2:5352170-5352192 TCTGTACATCCCTCAAACCCTGG - Intergenic
926228233 2:10983528-10983550 TCCCTCCCTCCCTCCACCCCAGG + Intergenic
926251741 2:11158873-11158895 TCCCCCCATCCCTGCAGCCTGGG - Intronic
926625402 2:15085954-15085976 TGCCTCCATCCCTGGTGCCCAGG - Intergenic
926786495 2:16523209-16523231 GTCCTCCAACACTCAAGCCCCGG - Intergenic
927946290 2:27137154-27137176 TCACTACCTCCCTGAAGCCCAGG - Exonic
927970748 2:27305060-27305082 TTCCTCCCTCCCTCCAGCCCAGG - Intronic
928750655 2:34466810-34466832 TCCCTCCCCCCACCAAGCCCAGG - Intergenic
929605723 2:43232838-43232860 TGCCTCCATCGCTCTGGCCCTGG - Exonic
929806944 2:45154295-45154317 TTCCTCCATCCCTCCTCCCCAGG + Intergenic
929903909 2:46029546-46029568 TCCCTGTATCCCTCAGTCCCAGG + Intronic
930896176 2:56449236-56449258 TCGCTCCATTCCTCCAGCTCTGG - Intergenic
931643108 2:64398676-64398698 TCCCTCCTTCCCTCAGCTCCTGG - Intergenic
931847537 2:66220103-66220125 TCCCATCATCCCTCAACACCTGG + Intergenic
932023941 2:68115071-68115093 TCCCACCATCCCTCCACCCCAGG + Intergenic
932054309 2:68429495-68429517 TCCCTCCCTCCCCCAACCTCTGG + Intergenic
932569625 2:72931736-72931758 TCACTCCATCCATCGAGGCCGGG + Intronic
932575460 2:72960152-72960174 TACTTCTATCCCTCCAGCCCAGG + Intronic
932622318 2:73272152-73272174 TCCCACCATCCCTGGAGCTCAGG + Intronic
933197879 2:79413082-79413104 TCCTTCCATCCCCCAACCTCTGG + Intronic
933686854 2:85148323-85148345 ATTCTCCATCCCTCAAGCCTTGG - Intronic
933853154 2:86386999-86387021 TCCCTCCTTCCCTCAACCCCTGG + Intergenic
934526641 2:95056224-95056246 TCCCTCTGGCCCTGAAGCCCTGG + Intergenic
935656414 2:105427519-105427541 CACCTCCATCCCCCAAGCCCCGG - Intronic
935691132 2:105733359-105733381 TGCCTTCCTCTCTCAAGCCCTGG - Intergenic
937264355 2:120606700-120606722 TCACCCCCTCCCTCATGCCCTGG - Intergenic
937754914 2:125525465-125525487 TTTCTCCTTCCCTCAATCCCTGG - Intergenic
937918356 2:127111993-127112015 TCCCTCCACCCCCCAGCCCCTGG + Intergenic
938371256 2:130769755-130769777 TCCCTCCTTTTCTCCAGCCCTGG + Intergenic
938540997 2:132283397-132283419 TCCTTGCAACCCTCAAACCCCGG + Intergenic
938722920 2:134082277-134082299 TCCCTCCGTACCCCAACCCCTGG + Intergenic
939780901 2:146446394-146446416 CCCCTCCCTACCTCAACCCCTGG + Intergenic
940216036 2:151304500-151304522 TCACTCCTTCCCTCATCCCCTGG - Intergenic
941099480 2:161280928-161280950 TCCTTGCAACCCTCAAACCCCGG - Intergenic
942500509 2:176585360-176585382 TCCCTCCACCCCTCAGCCCCTGG + Intergenic
942650668 2:178164095-178164117 TCCCTCCCTCCCTCAGCCACTGG + Intergenic
943828336 2:192425681-192425703 TCCCTACATCTCCCAAGTCCTGG + Intergenic
943935716 2:193913651-193913673 TTCCTCTATCCCCCAAGCCCTGG - Intergenic
944427389 2:199597545-199597567 TCCATTCAGCCCTCAAACCCTGG - Intergenic
944448053 2:199811669-199811691 TCATTCCATCCCTGTAGCCCTGG + Intronic
944739443 2:202597386-202597408 TCCCTCCCTCCCCTAATCCCTGG + Intergenic
946025409 2:216669081-216669103 TCTCTCCATCTCCCCAGCCCTGG - Intergenic
946199672 2:218064484-218064506 TCGCTCCATCCCACAACCCTGGG + Intronic
946879477 2:224162811-224162833 TCTTTCCATCCCTCAAGACATGG - Intergenic
947663665 2:231889292-231889314 TCTCCCCATCCCTCAACCTCTGG - Intergenic
948488869 2:238298547-238298569 TCCCTCTAGCCCACAAGCCATGG - Intergenic
948582247 2:238996451-238996473 TCCCTCCATCCCACCAGGCCAGG + Intergenic
948704393 2:239779956-239779978 TCCCTCCCTCCCTGCATCCCAGG + Intronic
948836476 2:240628540-240628562 GCCCTCCATCCCTCATGGACTGG + Intronic
948891613 2:240909537-240909559 TCCCTCCAACCCTTACGCCTCGG - Intergenic
949086316 2:242158751-242158773 TCCCTCCACCCCACCAGCTCTGG + Intergenic
1168802998 20:655396-655418 ACCTTCCACTCCTCAAGCCCCGG + Intronic
1168810207 20:700029-700051 CCCCTCCTCCCCCCAAGCCCTGG - Intergenic
1168840731 20:908466-908488 TGCCTCCCTCCCTCAAGGTCAGG + Intronic
1169500076 20:6151109-6151131 TCACTCACTCCCTCAAGCCCAGG + Intergenic
1169510173 20:6255480-6255502 TCCCTCCCTCCCTCCCTCCCAGG - Intergenic
1169593512 20:7171912-7171934 TCCCTGAATACCTCAGGCCCAGG - Intergenic
1169913814 20:10668383-10668405 TACCCCCATCCTTCAAGCCTAGG - Intronic
1171351429 20:24506068-24506090 TCCCACCAACTCTCAAGTCCTGG + Intronic
1172024444 20:31938314-31938336 TCCCTCCCTCCCTCACCCCATGG - Intronic
1172147116 20:32764452-32764474 TCCCTCCATCCCCAAATCTCAGG - Intronic
1172237927 20:33390451-33390473 TTCCTCCTTCCCTCAGCCCCTGG - Intronic
1172433729 20:34913855-34913877 ACCCCCCATACCTCAAGCCTTGG + Intronic
1173199453 20:40943932-40943954 TCCATCCAGCCCTAAAACCCTGG + Intergenic
1173396597 20:42686259-42686281 TCCCACCTACCCGCAAGCCCAGG + Intronic
1173461135 20:43244248-43244270 TTCCTCCCTCCCTCAGCCCCTGG - Intergenic
1173563828 20:44025359-44025381 TCACTCCATCCCCCAATCTCTGG - Intronic
1173663839 20:44751899-44751921 ACCCTCCCTCCCTAAAGGCCTGG + Exonic
1173827924 20:46058925-46058947 TCCAGCCCTCCCTCAGGCCCAGG - Intronic
1173858768 20:46268533-46268555 TCCCTCCCTCCCACCACCCCGGG + Intronic
1174085867 20:48006772-48006794 TCCACCCACCCCTCCAGCCCTGG - Intergenic
1174664404 20:52244434-52244456 ACCTTCAATCCCTCAATCCCTGG - Intergenic
1175495770 20:59413204-59413226 TCCCACCCTCCCTGAGGCCCTGG + Intergenic
1175774477 20:61644456-61644478 CCCCTGCACCCCTCAAGTCCTGG + Intronic
1175828759 20:61950947-61950969 ACCCTCCCTCCCACCAGCCCTGG + Intergenic
1175873418 20:62218872-62218894 TCCCTCCTGCCCCCAGGCCCAGG - Intronic
1176107308 20:63395546-63395568 CCCCTCCTTCCCTCCAGCCGGGG - Intergenic
1176188234 20:63793188-63793210 TGCCTCCAGCCCTCAAGCCCGGG - Intronic
1176238581 20:64065526-64065548 TCCCTCCCTCCCTCCCTCCCGGG - Intronic
1176884042 21:14232723-14232745 TGCTTCCACACCTCAAGCCCAGG + Intergenic
1178193989 21:30321519-30321541 TCACTCCAACCCCCAACCCCAGG + Intergenic
1178845052 21:36167705-36167727 TTCCTCCCTCCCCCCAGCCCCGG + Intronic
1179576373 21:42310785-42310807 TCCCTCCAGCCCTCAAAGGCTGG + Intergenic
1180072802 21:45445119-45445141 GCCCTCCCTCCCTCCAGTCCTGG + Intronic
1180562372 22:16629724-16629746 TGCCTCCATCTCCAAAGCCCAGG - Intergenic
1180612709 22:17108331-17108353 TCCCCCCACCGCTGAAGCCCAGG + Exonic
1180909376 22:19438171-19438193 TCCCCTCTTCCCCCAAGCCCTGG + Intronic
1180921331 22:19523070-19523092 TCCCGCCCTCTCTCAAGCTCCGG + Exonic
1181120514 22:20664759-20664781 ACCATCCCTCCCTCAACCCCAGG - Intergenic
1181694854 22:24587947-24587969 TTCATACATCCCTCAATCCCTGG - Intronic
1181925807 22:26357692-26357714 TCCTTGAATCCCCCAAGCCCAGG + Intronic
1182335279 22:29580027-29580049 TCCCTCCTGCCCTGCAGCCCAGG - Intronic
1183029098 22:35088881-35088903 TCTCTCCACCCCCCAACCCCCGG + Intergenic
1183158873 22:36097147-36097169 GTCCTCCCTCCCTCAACCCCTGG + Intergenic
1183530403 22:38350383-38350405 GCACTCCAGCCCTCCAGCCCAGG - Intronic
1184025432 22:41852162-41852184 TCCCTCCCTCCTTCACTCCCAGG - Intronic
1184411172 22:44327363-44327385 TCCCCACTTCCCACAAGCCCAGG - Intergenic
1184486480 22:44783066-44783088 TCCCTCCCTCCCTCTGGGCCAGG + Intronic
1184594165 22:45503888-45503910 CCCCTCTAACCCTCAAGGCCTGG + Intronic
1185366084 22:50437484-50437506 TCCCTCCCTCCCTCCCTCCCAGG + Exonic
949976142 3:9462242-9462264 TCCTTCCATCCACCAAGCCTTGG + Intronic
949984162 3:9526213-9526235 TTCCTCCCTCCCCCGAGCCCTGG - Intronic
950079777 3:10213108-10213130 CCCCTCCATCCCTCCATCTCTGG + Intronic
950217378 3:11169079-11169101 TTCCTGCAGACCTCAAGCCCAGG - Intronic
950223877 3:11217563-11217585 TTTCTCCCTCCCTCAACCCCTGG - Intronic
952865691 3:37853790-37853812 TCCCTCCCTCCCTCCCGCTCTGG - Intergenic
953062414 3:39438457-39438479 TCCCTCCCTCCCTCCCTCCCTGG + Intergenic
953606359 3:44415631-44415653 TTCCCACATCCCTCAAACCCAGG + Intergenic
953918409 3:46935388-46935410 TCCATCCATCCCACAAGGCAGGG + Intronic
955050097 3:55401913-55401935 TCCCCTCACCCCTCAACCCCTGG - Intergenic
956008443 3:64805202-64805224 TCCCCTCATCCCTCATGGCCGGG + Intergenic
956837651 3:73108660-73108682 TCCCTCCCTCCCCCAGTCCCTGG + Intergenic
957732687 3:84161822-84161844 TCCCCCCGGCCCCCAAGCCCTGG + Intergenic
958880287 3:99661946-99661968 TTCCTCCTTCCCTCATCCCCTGG - Intronic
959031551 3:101305317-101305339 TCCCTGTCTCCCTCAACCCCTGG - Intronic
960052964 3:113254985-113255007 TCTCTCCCTCCCTCCACCCCAGG + Intronic
961004210 3:123393779-123393801 CCCCTCCCTCCCTCCCGCCCCGG + Intronic
961365878 3:126398934-126398956 TCCATCCATTCCTGCAGCCCTGG + Intronic
961652238 3:128422369-128422391 GCCCTCCATCCCTCTGACCCCGG - Intergenic
963901283 3:150735693-150735715 TCCCTCCATTGCCCAAACCCCGG + Intergenic
968914781 4:3492626-3492648 CCCTTCCAGCCCCCAAGCCCCGG - Intronic
969321316 4:6414715-6414737 TTCCTCCCTCCATCCAGCCCAGG - Intronic
971183186 4:24349790-24349812 TCACACCATCCCTCAAGTTCTGG + Intergenic
971807390 4:31377070-31377092 TCCCTCCAACCCATGAGCCCAGG - Intergenic
971894979 4:32580556-32580578 TACCTCCATCCCTGACACCCTGG + Intergenic
973110366 4:46390231-46390253 TGCCTCGATCCCTCGATCCCTGG + Intronic
973919729 4:55673105-55673127 TCCCTCCCTGCCTCAGGGCCTGG + Intergenic
974538179 4:63196701-63196723 TCCCTCCATAAAGCAAGCCCTGG - Intergenic
975828476 4:78344021-78344043 CCCATCCATCCCTCAATGCCTGG + Intronic
975828489 4:78344076-78344098 CCCATCCATCCCTCAATGCCTGG + Intronic
975922464 4:79408339-79408361 TCACCCCACCCCTCCAGCCCAGG + Intergenic
976723389 4:88192443-88192465 TCGCTCCATCGCCCAGGCCCAGG + Intronic
979919701 4:126480821-126480843 TCCCTCCAGCCCTCTTGCTCGGG + Intergenic
981914869 4:150022880-150022902 CTCCTCCAGCCCTAAAGCCCAGG + Intergenic
982024323 4:151236264-151236286 CCCCGCCAGCCCGCAAGCCCCGG - Intronic
982092452 4:151892282-151892304 TCCTTCCACCCCTCACCCCCAGG - Intergenic
982201269 4:152963302-152963324 TCCCTTCAGCCCTATAGCCCTGG - Intronic
982484816 4:155953915-155953937 TCCTTCCGCCCCTCGAGCCCAGG - Exonic
984328393 4:178283336-178283358 TCACTCCAGCACTCCAGCCCGGG - Intergenic
984539131 4:181015508-181015530 CCCCTCCATCACTCAAGGCAAGG - Intergenic
984751930 4:183286387-183286409 TCCCACAATCGCTCAAGACCTGG - Intronic
984783133 4:183543954-183543976 TCCCTCCATCCCCCATCCCACGG - Intergenic
984844954 4:184101005-184101027 TCCCTCCCTCCTTCAGGCTCGGG - Intronic
985480601 5:107904-107926 TTCCTATATCCCTGAAGCCCAGG - Intergenic
985658717 5:1145058-1145080 TCTCTCCAGCCCTCCAGGCCCGG - Intergenic
986340425 5:6784473-6784495 TCCCTCCTCCCCTGAGGCCCAGG - Intergenic
986772626 5:10987741-10987763 TCCCTCCATTCCTAATGCACAGG + Intronic
987044851 5:14098404-14098426 TTCCTCCCTCCCTCAGCCCCAGG - Intergenic
987093057 5:14524428-14524450 CCCTTCCATCCCCCCAGCCCAGG - Intronic
987752360 5:22057519-22057541 TTCCCCCATCCCTCACCCCCGGG - Intronic
988840042 5:35074571-35074593 TTTCTCCCTTCCTCAAGCCCTGG - Intronic
989183053 5:38597405-38597427 TCCTAGCATCCCTCTAGCCCAGG + Intronic
989217751 5:38922681-38922703 TCCCTCCTTCCATGAAGCCTTGG - Intronic
991361284 5:65823407-65823429 TGCCTGCATACCTCAAGGCCAGG + Exonic
991457736 5:66822599-66822621 TTCCTCCACCCCTCCTGCCCAGG + Intronic
992020014 5:72613526-72613548 CCCCTCCACCACTCCAGCCCTGG + Intergenic
992164592 5:74036950-74036972 TCCTTCCTTCCCCCAACCCCTGG - Intergenic
992249942 5:74866493-74866515 GCCCTGCCTCCCTCCAGCCCCGG + Intronic
992378505 5:76213868-76213890 TCCCCCCATCCCTCAATTCCTGG + Intronic
992748749 5:79843035-79843057 TCCCTCCCTCCTTCCAGCCAAGG + Intergenic
993487454 5:88504171-88504193 TCCAGCTATCCCTGAAGCCCTGG - Intergenic
994171310 5:96662326-96662348 TCCCTCCCTCCCTCTCTCCCTGG + Exonic
994207657 5:97053472-97053494 TCCCTGCATCCCTGCATCCCTGG + Intergenic
995120073 5:108526612-108526634 TTCCTGCTTCCCTCAACCCCTGG + Intergenic
995219476 5:109631704-109631726 TCCCTCCCTCCCCCAATCCATGG - Intergenic
995489163 5:112671966-112671988 TTCCTCCTTCCCCCAACCCCTGG + Intergenic
995708990 5:115015668-115015690 TCCTTCCCTCCCCCAACCCCTGG - Intergenic
996677747 5:126195964-126195986 TCGCTCCACCCCTCAACCCTTGG - Intergenic
997784662 5:136698971-136698993 TGGCTTCATCCCACAAGCCCTGG - Intergenic
998491437 5:142550543-142550565 TCCCTCAAACCCTCCAGACCAGG - Intergenic
999707932 5:154291038-154291060 TCCCTCTATCCCTCCCTCCCAGG - Intronic
999813839 5:155155566-155155588 TCTCAGCATCCCTCCAGCCCAGG - Intergenic
1000207355 5:159075296-159075318 TCCCTTCCTCCTTCAAGTCCAGG + Intronic
1001591495 5:172868536-172868558 TCCCTCCCTCCCGCAACCCCTGG - Intronic
1001818816 5:174693762-174693784 TCTCTCCATCTCTCAACCCAGGG - Intergenic
1001940633 5:175737180-175737202 TCACTCCGCCCCTCAAGACCAGG + Intergenic
1001948274 5:175797691-175797713 TCCCTCTCTCCCTCACTCCCCGG + Intronic
1002191832 5:177482444-177482466 TCTCTCCATCCCTCATCCCCCGG + Intergenic
1002328784 5:178427790-178427812 TCCCTCCCTCCCCCAGCCCCTGG - Intronic
1002454704 5:179339340-179339362 GCTCTCCACCCCTCAACCCCCGG - Intronic
1003066136 6:2904566-2904588 TTCCTCCTTCCCACAACCCCTGG + Intergenic
1003086006 6:3062328-3062350 TTCCTCCTTCCCACAATCCCTGG - Intergenic
1003148909 6:3532185-3532207 TCCCTCCTTCCCCCAGGCCCTGG + Intergenic
1003303211 6:4903579-4903601 TCCCTCCGGCACCCAAGCCCTGG - Intronic
1003524207 6:6884865-6884887 CCCCTGCAGCCCTTAAGCCCAGG + Intergenic
1003684535 6:8288124-8288146 TCCCTCCCTTCCCCAACCCCTGG + Intergenic
1003829070 6:9986225-9986247 TCCTTCCATCCTTCAAGCCTAGG + Intronic
1004265076 6:14142196-14142218 TGCCAGCATCCTTCAAGCCCGGG - Intergenic
1004548050 6:16618250-16618272 TCCCTCCCTCCGACAGGCCCCGG - Intronic
1004918952 6:20358131-20358153 TCCCTTCCTCCCCCAAGCCTCGG + Intergenic
1006386711 6:33735026-33735048 TCTCTCCATCCCTCAAAGCCTGG + Intronic
1006407751 6:33855189-33855211 TCCTTCCTGCCCTCAGGCCCGGG + Intergenic
1006419384 6:33923916-33923938 TCCCTCCACACCCCCAGCCCTGG + Intergenic
1007113344 6:39326417-39326439 GCCCTCCCTCCCTCAGGTCCTGG + Intergenic
1007335202 6:41150652-41150674 CCCCTCCATCCCTCAGCCCTGGG + Intronic
1007968195 6:46023418-46023440 TCCCTCCATTGCTAAAGCCCAGG + Intronic
1007990575 6:46251179-46251201 TCCCTTCATCTCTTAAGCCTTGG + Intronic
1009326792 6:62360596-62360618 TCCTTCCTTCCCTCAGCCCCAGG - Intergenic
1009952568 6:70413757-70413779 TCCCTCCGTCCCTCTTGCCCAGG + Intronic
1010372183 6:75123333-75123355 TCCCACCATTCCACCAGCCCGGG - Exonic
1010376823 6:75180340-75180362 TCCCTCCTTCCCTCTACTCCTGG - Intronic
1011694512 6:89899958-89899980 TCCCTTCCTCCCTCAAGCCCTGG + Intergenic
1011731307 6:90266738-90266760 TCCCCTTATCCCTCAACCCCTGG - Intronic
1012860667 6:104555609-104555631 CCCCTCTATCCTTCAAGCCTAGG + Intergenic
1012932366 6:105330391-105330413 TCCCTGCAGGCATCAAGCCCTGG - Intronic
1012951199 6:105519847-105519869 TCCATGGATCCCTCAAACCCAGG + Intergenic
1014198507 6:118584300-118584322 TCCCTCCTTCCCTAATGCTCTGG - Intronic
1014516915 6:122390586-122390608 TTCCTCCTTCCCTCAGCCCCTGG - Intergenic
1016021189 6:139237473-139237495 TCACTCCATCCCCCAGGCACTGG - Intergenic
1016388886 6:143555444-143555466 TGCCTCCAACCCTCAATCCTTGG + Intronic
1016872167 6:148829137-148829159 TCCATCCATCCATCCATCCCAGG - Intronic
1017157983 6:151339743-151339765 TCCCTTCCTCCCCCAACCCCTGG + Intronic
1017228310 6:152044934-152044956 TCCCTATATCCCTAAAGCCTAGG - Intronic
1017609359 6:156168057-156168079 TTCCTCCCTCCCTCCAGCCTGGG - Intergenic
1017978983 6:159382050-159382072 CCCCACCACCCCTCAAGCCCAGG + Intergenic
1017996475 6:159535569-159535591 TCCATCCATCCCTCAATTGCAGG - Intergenic
1018570434 6:165204139-165204161 TCCCTCCCTCCCTCAACACATGG + Intergenic
1019200577 6:170311051-170311073 GCCCTGCATCCCTCTAGCCTTGG + Intronic
1019449326 7:1088669-1088691 TCTCACCAACCCTGAAGCCCTGG + Intronic
1019637047 7:2081563-2081585 TCCCTGCATCACTGCAGCCCAGG + Intronic
1019981058 7:4622537-4622559 TCCCTCCCTCCCTCAACACCTGG - Intergenic
1020408205 7:7861088-7861110 TCCCTCCTCTCCCCAAGCCCTGG - Intronic
1021110154 7:16684719-16684741 TCCCTCATTCCCTCACTCCCTGG + Intronic
1022296215 7:29056348-29056370 TCCCTCCCTCCCCCAACTCCTGG + Intronic
1023754964 7:43407804-43407826 TCCCTCCATTCATGGAGCCCTGG + Intronic
1023768886 7:43536733-43536755 TCCCTCCACCCACCAGGCCCTGG + Intronic
1023840912 7:44097022-44097044 TCCCCTCCTCCCTCCAGCCCTGG - Intergenic
1023870348 7:44260051-44260073 TCCCTCCAGTCCTCAAGTCTTGG + Intronic
1024273578 7:47659990-47660012 TCCCTCCATGCCTCCACCCAGGG + Exonic
1025257495 7:57394839-57394861 TTCCTGCCTCCCTCAACCCCTGG + Intergenic
1026581415 7:71621661-71621683 TCCATCCATCCATCTAGCCTAGG - Intronic
1026847842 7:73707565-73707587 TCCCTCGCTCCCAGAAGCCCAGG + Intronic
1026971664 7:74472300-74472322 TCCCTCCATCCAAGAAGCTCGGG - Intronic
1027036916 7:74931769-74931791 TCCCCCCTTCCCCCAAGCTCTGG - Intergenic
1027170286 7:75866879-75866901 TCCCTCCAGCCCCCAACCCCGGG - Intronic
1028939917 7:96509882-96509904 TCCTCCCCTCCCTCAATCCCTGG - Intronic
1028980067 7:96958111-96958133 TACCTCCACCACTAAAGCCCTGG - Intergenic
1029561528 7:101306162-101306184 TTCCTCCTTCCCCCAGGCCCTGG - Intergenic
1030089640 7:105846942-105846964 TCCCTCCTCCCCTCAGTCCCTGG - Intronic
1031192405 7:118570737-118570759 TCCCTTCTTCCCTCAGCCCCTGG - Intergenic
1032500844 7:132398585-132398607 TCCCTGCGTCCCTGGAGCCCAGG - Intronic
1033228641 7:139580009-139580031 TCCCTCCATCCCTCAGGTTTTGG - Intronic
1033367660 7:140683856-140683878 TTTCTCCATCCCTCCAGCCCAGG - Intronic
1034477655 7:151296077-151296099 TCCCTCCCTTCCTCCTGCCCTGG - Intergenic
1034547848 7:151800655-151800677 TCCCTCCCTCACCCAAGCCCTGG - Intronic
1034679406 7:152917172-152917194 TCCCTCCCTCCGCCAACCCCTGG + Intergenic
1034739750 7:153462845-153462867 TGACTCCATGTCTCAAGCCCGGG - Intergenic
1035021638 7:155804146-155804168 ACCCTCCTTCCCTCCCGCCCCGG + Intronic
1035148883 7:156849666-156849688 TCCTTCCTCCCCTCAACCCCTGG - Intronic
1035647962 8:1242894-1242916 TCCATCCATCCGTCAATCCATGG - Intergenic
1036661804 8:10714010-10714032 TCCCTCCACCCCTCCACCCTGGG - Intergenic
1036703257 8:11028121-11028143 TCCCTGCCTCCCTCCAACCCCGG + Intronic
1036778265 8:11628450-11628472 TCCCTGCATCCCTACTGCCCCGG - Intergenic
1038419745 8:27425780-27425802 TCCCTCCTTCCCTCTAACCCTGG + Intronic
1038625681 8:29190682-29190704 TCCCTCCTTCCCACCAGCGCAGG - Intronic
1038642313 8:29338235-29338257 TCCCACCCGCCCTCAAACCCAGG + Intronic
1038736392 8:30173653-30173675 TCCCTCCAGCCTTCAATTCCTGG - Intronic
1039800270 8:40948584-40948606 TCCCTCTCTCCCTCAGGCCCTGG - Intergenic
1040453361 8:47571137-47571159 TTTCTCCCACCCTCAAGCCCTGG - Intronic
1040687327 8:49890475-49890497 GCACTCCATCCCTCCAGCCTAGG + Intergenic
1042292172 8:67180421-67180443 TCTCCCTATCCCTCAACCCCTGG - Intronic
1042461989 8:69080440-69080462 TCCCTACATCCCTGCAGCCCAGG - Intergenic
1042843602 8:73148627-73148649 TACCACCATCCACCAAGCCCTGG - Intergenic
1043877728 8:85505397-85505419 TCGCTCCATCACTCCAGCTCAGG - Intergenic
1044567153 8:93676994-93677016 TCACTCCATCCTTGAACCCCTGG + Intergenic
1044820815 8:96154510-96154532 TCCCTCCATCCCCCACCCCAAGG - Intronic
1044856356 8:96480015-96480037 TCCCTCCTTCCCCCAACCCCTGG - Intergenic
1045322101 8:101089878-101089900 TCCCTCCCTCCCTCAAATGCTGG + Intergenic
1045491273 8:102671252-102671274 TCCCTTCCTCCATCAATCCCTGG + Intergenic
1046214746 8:111128996-111129018 TCCTTCCTCCCCTCAACCCCTGG - Intergenic
1046383121 8:113475482-113475504 CCCCTCCATTCCTCTGGCCCCGG - Intergenic
1046574787 8:116013822-116013844 ACCCTGCACCCCTCAACCCCTGG + Intergenic
1048214319 8:132481099-132481121 TCCCTCCCTCCCTCCTTCCCCGG + Intergenic
1048442852 8:134472637-134472659 TCCCTCAGTCCCTCCGGCCCTGG + Intergenic
1048534265 8:135277714-135277736 CCCCTTCATCCCTCCAGCCTGGG + Intergenic
1049465582 8:142749894-142749916 TCTCTCCATCCTTCAAGGCTTGG + Intergenic
1050161468 9:2724023-2724045 GCCCTCCACCCCCCAACCCCCGG - Intronic
1051807740 9:21014542-21014564 TCCCTCTTTCCCTCAGCCCCTGG - Intronic
1052805494 9:33009742-33009764 GCACTCCAGCCCTCCAGCCCAGG + Intronic
1053240591 9:36491612-36491634 TCCCTCCTCCCCTCAGCCCCTGG + Intergenic
1054708454 9:68486440-68486462 TCCCTCCAACCCACAGCCCCTGG + Intronic
1054837958 9:69699585-69699607 TCCCTCCTTCCCTCAAGCAGAGG + Intergenic
1055478052 9:76683099-76683121 TACCTTCATCCCTCAAACCCTGG - Intronic
1055869902 9:80863759-80863781 TCCCTCCCTCCTTGAATCCCTGG + Intergenic
1056045456 9:82711016-82711038 TCCCTCCATATCTCAATTCCTGG + Intergenic
1056067521 9:82952580-82952602 TCCTCCCATCCCTCAGTCCCAGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1056186752 9:84142603-84142625 TCCCTCCATCCCCCAGCCCTGGG + Intergenic
1056235081 9:84586442-84586464 TCCCTCTGTCCCTCCAGCCAAGG + Intergenic
1056284926 9:85078106-85078128 TCACTCCCTCCCTCCAGCCTGGG - Intergenic
1056510144 9:87296702-87296724 TCGCTTCATCCCCCAGGCCCTGG + Intergenic
1056732407 9:89177904-89177926 TCCTTCATTCCCTGAAGCCCGGG - Intronic
1057280820 9:93710329-93710351 CCCCTCCATCCCTCCAACCTGGG + Intergenic
1057300692 9:93880039-93880061 GCCCTCCGGCCCACAAGCCCAGG + Intergenic
1057773439 9:97985389-97985411 ACCCTCCATCTCGCAACCCCCGG - Intronic
1058918362 9:109589110-109589132 TCACTCCCCCCCTCAAGCCCTGG - Intergenic
1059442001 9:114313212-114313234 TCCCACCCTCCCCCAACCCCTGG + Intergenic
1059486305 9:114629689-114629711 TTCCTCCATCCCCCGATCCCTGG + Intronic
1060994838 9:127870052-127870074 TCCCTCCTTCGGTGAAGCCCTGG + Intronic
1061181476 9:129027524-129027546 TCTCTCCATCCCCCAGGCCCAGG + Intronic
1062012657 9:134275366-134275388 TCTCTCCTCCCCTCAAACCCTGG - Intergenic
1062288538 9:135784508-135784530 TCCCTCCCTCCCTCCCTCCCTGG + Intronic
1062723483 9:138057924-138057946 TCCCTTCCTCCCTCTATCCCTGG + Intronic
1186403625 X:9282461-9282483 TCTCTCCTTCCCTCAATCCCTGG - Intergenic
1186625471 X:11288661-11288683 TTCCCCCTTCCCTCAACCCCTGG + Intronic
1187263538 X:17709651-17709673 TCCTTCCATTCCTCCAGCCCTGG - Intronic
1187291363 X:17956855-17956877 TCCCTCCCACCCCCAACCCCTGG + Intergenic
1187820183 X:23278728-23278750 TACCTCAGTCCCTCAAGCACAGG + Intergenic
1187880790 X:23845504-23845526 TCTCTCCCTCCCCCAATCCCTGG + Intronic
1188645013 X:32554797-32554819 TCCCTCCCTCCCTCCCTCCCAGG - Intronic
1188807984 X:34614873-34614895 TCCCACCCTCCCTCAACACCTGG + Intergenic
1189398353 X:40643423-40643445 TCCCTCATTCCCCAAAGCCCTGG + Intronic
1189465639 X:41276067-41276089 TCCCTGCATCCATCTTGCCCAGG + Intergenic
1191105399 X:56769138-56769160 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191106392 X:56774540-56774562 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191107385 X:56779942-56779964 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191130299 X:57000779-57000801 TTCCTCCCTCCCTCAGTCCCTGG + Intergenic
1193146530 X:78082060-78082082 TTCCTCCTTCCCCCAACCCCCGG + Intronic
1194362363 X:92968725-92968747 TCTCCCCTTCCCTCAACCCCTGG + Intergenic
1196011089 X:110888706-110888728 TCCCTTCATCCCTCCAGCCTAGG + Intergenic
1197082791 X:122439777-122439799 TCCATCCTCCACTCAAGCCCAGG + Intergenic
1197223485 X:123934748-123934770 TCCCTCCCTCCCTCCCTCCCTGG + Intergenic
1197720092 X:129739177-129739199 TCCCTCCATCCACCCAGCGCCGG + Exonic
1197853737 X:130892471-130892493 TCCCCCAATTCTTCAAGCCCTGG + Intronic
1199440441 X:147862037-147862059 TTCCTCCTTCCCTCAGCCCCTGG - Intergenic
1199673574 X:150166225-150166247 TCCCTGCTTGGCTCAAGCCCTGG + Intergenic
1199679473 X:150215270-150215292 TCCCTCCCTCCCTCCTTCCCAGG - Intergenic
1199697302 X:150351876-150351898 TTGCTCCATCCCTCAGCCCCTGG + Intergenic
1200079719 X:153570177-153570199 ACCCGCCACCCCTCCAGCCCCGG - Intronic
1200127271 X:153821787-153821809 TCCTTCCCTCCCCGAAGCCCAGG + Intronic
1200670610 Y:6084950-6084972 TCTCCCCTTCCCTCAACCCCTGG + Intergenic
1202032970 Y:20597343-20597365 ACCATCCCTCCCTCAACCCCAGG + Intergenic
1202592671 Y:26503762-26503784 TGCCTCCATCTCCAAAGCCCAGG - Intergenic