ID: 1163039070

View in Genome Browser
Species Human (GRCh38)
Location 19:14589046-14589068
Sequence CTGCATGTGGATGTGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 2, 1: 1, 2: 7, 3: 41, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163039070 Original CRISPR CTGCATGTGGATGTGGGGAC AGG (reversed) Intronic
900211211 1:1456670-1456692 CTGCAGGTGGGCGTGGGCACTGG + Intronic
900217036 1:1486989-1487011 CTGCAGGTGGGCGTGGGCACTGG + Intronic
900224117 1:1524718-1524740 CTGCAGGTGGGCGTGGGCACTGG + Intronic
901238965 1:7681982-7682004 CGGCAGGTGGGGGTGGGGACAGG - Intronic
901379326 1:8862520-8862542 CTGTTTGTGGATGTGGAGCCAGG - Intronic
901414243 1:9105847-9105869 CTCCATGTGGAGGTGGGGACTGG - Intronic
901419637 1:9142356-9142378 CTGGGTGTGAATGTGGGGCCAGG - Intergenic
903575089 1:24334738-24334760 CTCCAGGTGGAGGTGGGGAAGGG - Intronic
903858642 1:26352142-26352164 CTGCATGTGGGCCTGTGGACTGG - Intronic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
904415689 1:30359953-30359975 GTGGGTGTGGATCTGGGGACTGG - Intergenic
904878805 1:33678575-33678597 CTGCATTCTCATGTGGGGACAGG - Intronic
905179621 1:36157627-36157649 CTCCATGGGGGTGTGGGGATGGG - Intronic
905520041 1:38590464-38590486 CTGGGTGTGTATGTGGGGGCGGG - Intergenic
906050081 1:42863629-42863651 CTGCCTGGGGATCTGAGGACTGG + Intergenic
907429076 1:54400826-54400848 CTGCATGTGGAGGTGGAAATTGG - Intronic
907520343 1:55019699-55019721 GGGCAAGTGGAGGTGGGGACCGG - Intergenic
907847623 1:58223655-58223677 CTGCAAGAGGAGGTGGGGATCGG + Intronic
911373484 1:97023453-97023475 CTGCCAGGGGATGTGGGGAGGGG - Intergenic
915578143 1:156795010-156795032 CTGCAGCTGGATGGGGGGTCTGG + Intronic
915864906 1:159489048-159489070 CTGTATGTGGGAGTGGGGAGAGG - Intergenic
916216312 1:162397998-162398020 CTTCATGGGGATGGGGGGACAGG + Intronic
916247112 1:162699135-162699157 ATGCCTGTGAATGTGGGGAGAGG + Intronic
917536902 1:175880975-175880997 AGGCAAGTGTATGTGGGGACAGG - Intergenic
920048645 1:203150157-203150179 CTGCATGTTGTTCTGGGGAGGGG + Intronic
920313175 1:205060417-205060439 AAGCATGTGGAAGTGGGGCCAGG + Intronic
922247727 1:223817193-223817215 CTGCATGTGGAGGAGGGGGAGGG + Intronic
922372268 1:224923368-224923390 CTGACTGGGTATGTGGGGACAGG + Intronic
922668938 1:227494591-227494613 GTGCTTGTGGATGTGGAGCCGGG - Intergenic
922670660 1:227506711-227506733 GTGCTTGTGGATGTGGAGCCGGG + Intergenic
923361888 1:233219711-233219733 GTGCATGTGTCTGTGGGGAGGGG - Intronic
1062933464 10:1368120-1368142 CTGCATGGAGCTGTGGGGAACGG + Intronic
1064823049 10:19361296-19361318 CAGCATGTGAATGTGAGGGCAGG + Intronic
1065945046 10:30598585-30598607 CTGCATGTGGATCTAGGGGCTGG - Intergenic
1066235199 10:33479156-33479178 ATGCATGTGGATTTGAGGAAGGG + Intergenic
1067686993 10:48471667-48471689 CTGGCTGTGGATGTGAGGAAGGG - Intronic
1067972933 10:50992180-50992202 CTGCTGGCGGATGCGGGGACAGG + Intronic
1069693658 10:70371550-70371572 CAGCCTGTGGTTGTGGGGCCAGG - Intronic
1069861823 10:71476231-71476253 CTGCATGAAGGGGTGGGGACGGG - Intronic
1070334221 10:75440037-75440059 GTGCATGTGGATCATGGGACTGG + Intronic
1071177283 10:82941097-82941119 CTGCACTTGGATGGTGGGACTGG + Intronic
1071920259 10:90341843-90341865 GTGCATGTGGAGTCGGGGACTGG + Intergenic
1071971845 10:90915843-90915865 CTGCATGTGGCGGTGAGGACTGG - Exonic
1072447529 10:95512564-95512586 CTGAAATTGGATGTGGGGGCTGG - Intronic
1072705105 10:97675436-97675458 CTGCATGTGATTGTCGGGGCTGG - Exonic
1073092397 10:100953162-100953184 CTGGGTGTGGATGTGGTGGCAGG - Intronic
1073643478 10:105276260-105276282 CTTCAGGTGGAAGTGGGGGCAGG - Intergenic
1073866681 10:107812670-107812692 CTGAATGTGGGTGTGGTGAGGGG + Intergenic
1074867585 10:117553861-117553883 CTGCAGGTGGAGGTGGGGGCAGG - Intergenic
1075832115 10:125420131-125420153 CTGCATGTGGGTGTGGGGACAGG + Intergenic
1076605183 10:131684762-131684784 CTGCATGTGGATCTGGTGGGGGG - Intergenic
1076761099 10:132606143-132606165 CTGCAGCTGGATGTGGGGCTGGG + Intronic
1077115689 11:883639-883661 CTGCCTGTGGCTGTGGGGTGGGG - Intronic
1077374366 11:2198601-2198623 CTGCCAGTGGCTGTGAGGACAGG - Intergenic
1077533505 11:3108110-3108132 CTGCAGCTGGATGTGGGGGCAGG - Intronic
1078771950 11:14359210-14359232 CTGCATATGCATGAGGGGGCGGG + Intronic
1079098572 11:17526865-17526887 GTGGATCTGGATGTGGGGCCTGG - Intronic
1079375359 11:19887235-19887257 TTGAATCTGGATGTGGGGAGGGG + Intronic
1080159907 11:29161101-29161123 CTGCAGGTGGTTGTGGGGGGAGG + Intergenic
1081769698 11:45642045-45642067 CTGGGTGTGGCTTTGGGGACAGG - Intergenic
1082607410 11:55258169-55258191 CTGCAAGTGGATATTTGGACCGG - Intergenic
1082711492 11:56558869-56558891 CTGCAAGTGGAGCTGTGGACTGG + Intergenic
1082802122 11:57422752-57422774 CTGAATGTGGAGGTGGTGGCTGG - Intronic
1083727922 11:64637956-64637978 CTGTGTGTGGGTGTGGGGCCTGG - Intronic
1084496390 11:69506168-69506190 CTGCGTGTGGCTTTGGTGACTGG + Intergenic
1084504281 11:69555328-69555350 CTGAAGGAGGATCTGGGGACAGG - Intergenic
1087024018 11:93632102-93632124 CAGCATGTGCAGGTGGGGCCTGG - Intergenic
1091116712 11:133019925-133019947 CAGCATGTGCATGTGTGCACTGG - Intronic
1091150838 11:133326778-133326800 GTGGATGTGGATGTGGGGTGTGG + Intronic
1091390883 12:125563-125585 GTGCGTGTGGATGTGGGGGTCGG - Intronic
1091988944 12:4938800-4938822 CTGGATGTGGAGGTGGGAAGGGG + Intergenic
1092945797 12:13452930-13452952 CTTTATGTGGATGGGGGGAAGGG - Intergenic
1094169518 12:27478319-27478341 CTGCATGGGGACCTGAGGACAGG - Intronic
1095057007 12:37620874-37620896 CTGCAAGTGGATGTTTGGAACGG + Intergenic
1095057085 12:37622415-37622437 CTGCAAGTGGATGTTTGGAAAGG + Intergenic
1095059641 12:37667011-37667033 CTGCAAGTGGATATGTGGAACGG + Intergenic
1095830947 12:46586047-46586069 CTGCAGCTGGATGGGGGGAGGGG - Intergenic
1096131975 12:49166697-49166719 CTGTATGTGAGTGTGTGGACTGG - Intergenic
1096574444 12:52544062-52544084 CTAGATGTGGGGGTGGGGACTGG + Exonic
1096633551 12:52944821-52944843 CTGCCTGTGGAGGTGGGAACGGG - Intronic
1099968736 12:89478412-89478434 ATAAATGTGGATGTGGGGCCAGG - Intronic
1100809562 12:98325041-98325063 CCACATGTGGGTCTGGGGACTGG - Intergenic
1101777593 12:107807974-107807996 CTCAGTGTGGATGTGGGGAAGGG + Intergenic
1102797985 12:115705963-115705985 CTGCATGTGCATGTTGGGCAAGG - Intergenic
1103968071 12:124652739-124652761 CTGCAAGTGGAGGTGGCCACGGG + Intergenic
1104084491 12:125461500-125461522 CTGCAGAGGGATGTGGGGCCGGG + Intronic
1105745317 13:23372817-23372839 ATGGATGTGGATGTGGGGGATGG - Intronic
1107299909 13:38954910-38954932 CTCCATGTGGTTGTGGGGACAGG - Intergenic
1108116468 13:47134210-47134232 CTTCATGTGGTTGTTGGCACTGG + Intergenic
1108635024 13:52324840-52324862 CTGCATGTTGGAGTGGGAACTGG - Intergenic
1108652780 13:52498352-52498374 CTGCATGTTGGAGTGGGAACTGG + Intergenic
1109155689 13:58906396-58906418 ATGAGTGGGGATGTGGGGACAGG + Intergenic
1111313843 13:86525538-86525560 CTGCATCTTGATTTGGGTACTGG + Intergenic
1113560523 13:111275965-111275987 CTCCATGCGGATGTGTGCACAGG - Intronic
1113863916 13:113508994-113509016 CTGCCGGTGTATGTTGGGACTGG + Intronic
1113863931 13:113509044-113509066 CTGCCTGTGTATGTTGGGGCTGG + Intronic
1113863946 13:113509094-113509116 CTGCCTGTGTATGTTGGGGCTGG + Intronic
1113863981 13:113509198-113509220 CTGCCTGTGTATGTTGGGACTGG + Intronic
1113863997 13:113509249-113509271 CTGCCTGTCTATGTTGGGACTGG + Intronic
1113864043 13:113509394-113509416 CTGCCTGTCTATGTTGGGACTGG + Intronic
1113865654 13:113521085-113521107 ATGCATGTGTATGTGTGCACGGG + Intronic
1115445609 14:33485976-33485998 CTGGATGTGGATGTGAGCAGGGG + Intronic
1118450064 14:65892455-65892477 CTGCAGCTGGATATGGGGAGGGG + Intergenic
1119628915 14:76208925-76208947 CAGCATGGGGAGGTGGGGATGGG + Exonic
1119653288 14:76398702-76398724 CAGCATGTGTATCTGGGAACTGG - Intronic
1119704494 14:76775445-76775467 TTGCATGTGGATATGGGGAGAGG + Intronic
1119857190 14:77909454-77909476 CTGCCTGTGGACATGGGGAGTGG - Intronic
1121964153 14:98288883-98288905 CTTCATGCGGAGGTGGGGAGGGG + Intergenic
1122071414 14:99207874-99207896 TTCCAGGTGGATCTGGGGACAGG - Intronic
1122776299 14:104118353-104118375 CTGGGTGAGGAGGTGGGGACTGG - Intergenic
1122975401 14:105168810-105168832 CTGCATATGCATGAGGGGGCGGG + Exonic
1123385238 15:19790352-19790374 CTGCAGGTGGATGTTTGGATAGG - Intergenic
1126420235 15:48464804-48464826 CTTCATTTGGAAGTGGGGAGAGG - Intronic
1126905734 15:53362708-53362730 CTGTGTGTGGATGTGGGGGCGGG - Intergenic
1126940255 15:53759084-53759106 CAGCTTGGGGCTGTGGGGACGGG - Intronic
1128370126 15:67034173-67034195 GTGCATGTGGAGCTGGGGAAAGG + Intergenic
1128733399 15:70035543-70035565 CTCCAAATGGATGTGGGGAGAGG - Intergenic
1129697793 15:77750445-77750467 CTCCATGTGGAGCTGGGGACTGG - Intronic
1129707428 15:77802761-77802783 GTGAGTGTGGAGGTGGGGACAGG - Intronic
1130868358 15:87951145-87951167 CTACTAGTGGAAGTGGGGACGGG - Intronic
1131437419 15:92434555-92434577 CAGCCTGTGTATGTGGCGACTGG + Intronic
1132283521 15:100641940-100641962 CTGCAAGTGGTGGTGGGGCCAGG + Intronic
1132706368 16:1245118-1245140 CTGCTGCCGGATGTGGGGACAGG + Intergenic
1133269164 16:4602231-4602253 CTGACCGTGGATGAGGGGACTGG + Intergenic
1135842917 16:25893083-25893105 CCGTGTGTGGATGTGGGGAATGG + Intronic
1137546152 16:49405115-49405137 CAGGGTGTGGCTGTGGGGACAGG - Intergenic
1137581942 16:49638988-49639010 CTGCAGGGGGCTGTGGGGAGGGG + Intronic
1137606930 16:49793252-49793274 CTGCAACTGGAGCTGGGGACAGG + Intronic
1138073656 16:54019101-54019123 CTACATCTGGATGTGGTGCCTGG - Intronic
1139647334 16:68341076-68341098 CTGCATCTGGGAATGGGGACTGG + Intronic
1140717585 16:77740434-77740456 CTGAGTGAGGATGTGGGAACTGG - Intronic
1140900079 16:79359060-79359082 ATGCCTGTGGATCTGGGCACTGG - Intergenic
1141067771 16:80927707-80927729 ATGCATGTGGAGGTGAGGAAGGG + Intergenic
1141395753 16:83702920-83702942 ATGCATGTGGAGGTGGGGCAGGG + Intronic
1141628592 16:85274871-85274893 CTGCAGATGCATGTGGGGCCTGG + Intergenic
1142005029 16:87685548-87685570 GTGCACGTGCATGTGGGGAGTGG + Intronic
1142112261 16:88339183-88339205 TGGCAGGGGGATGTGGGGACAGG + Intergenic
1142687007 17:1583187-1583209 CTCCAGGTGGGTGTGGGGAGTGG - Exonic
1143098966 17:4494433-4494455 CTGGAGGGGGATGTGGGAACAGG + Intergenic
1143099469 17:4497569-4497591 CTGCCTGTGGACGTGGGGTCCGG + Intergenic
1143978101 17:10845071-10845093 GTGTATGGGGAGGTGGGGACGGG + Intergenic
1143981813 17:10876489-10876511 CTGGATTGGGGTGTGGGGACAGG + Intergenic
1146128386 17:30248288-30248310 CTGCCTGTGGAACTGGGGATTGG - Exonic
1146601281 17:34218936-34218958 CTGCCTGTGCATCTGAGGACTGG + Intergenic
1147043244 17:37733953-37733975 CTGCATGTGGAGCTGGAGATGGG + Intronic
1147050008 17:37787186-37787208 CTGCATGTGGGTGTGGGGGCTGG + Intergenic
1147237074 17:39065871-39065893 CTGCATGTGCCTGTGGGGTGGGG - Exonic
1147438743 17:40433841-40433863 CTGCCTCTGGAGGTGGGGAGCGG + Intergenic
1147691723 17:42319839-42319861 CTCCATGTGAGTGTGGTGACGGG - Intronic
1149347009 17:55749107-55749129 CTGCATGGGGAGGTGGGGAGAGG + Intergenic
1150661267 17:67081786-67081808 CTGTATGTGTATGTGGGGCGGGG + Intronic
1152735782 17:81996207-81996229 CTGCCTGTGGGCGTGGGGGCTGG + Intronic
1152839699 17:82559229-82559251 CTGTATGTGGATGTGGAGTGCGG + Intronic
1153187226 18:2499286-2499308 CTGAAGGGGGAGGTGGGGACTGG + Intergenic
1153953996 18:10080708-10080730 CTGTGTTTGGAGGTGGGGACTGG + Intergenic
1158151215 18:54373548-54373570 TAGAATCTGGATGTGGGGACGGG - Intronic
1158886996 18:61838050-61838072 CTACCTTTGTATGTGGGGACGGG - Intronic
1160059661 18:75517572-75517594 CAGCCTGTGGATGTGGGCACAGG + Intergenic
1160424252 18:78769455-78769477 CTGGATGTGGGTGGGGGGACTGG - Intergenic
1160516159 18:79480319-79480341 CTGCCTGTGGGTGGGGGGACAGG + Intronic
1160578661 18:79871365-79871387 CTGCCTGCGGCTGTAGGGACAGG - Intronic
1160833916 19:1115907-1115929 CTGCATTTGGCTGAGTGGACGGG + Intronic
1160939179 19:1612148-1612170 CTGCACCTGGGTGTGGGGAAGGG + Intronic
1161971326 19:7582524-7582546 CTGCATGCTGAGATGGGGACAGG - Intergenic
1162185884 19:8904462-8904484 CTGCCTGTTGAGGTGGGGAATGG + Intronic
1162935629 19:13980194-13980216 CTGGGTGTGGATTTGGGGGCTGG + Intronic
1163038375 19:14584785-14584807 CTGCATGTGGATGTGGGGACAGG - Intronic
1163039070 19:14589046-14589068 CTGCATGTGGATGTGGGGACAGG - Intronic
1163654506 19:18537999-18538021 ATGCAAGTGGATATGGGGATGGG - Intronic
1164348522 19:27300061-27300083 CTGCATGTGGATATTTGGAATGG + Intergenic
1164829151 19:31307367-31307389 CTGCATATGGCTGGGGAGACGGG + Intronic
1164857295 19:31534970-31534992 CCGCATGTGGACATGGGGCCTGG - Intergenic
1166193560 19:41192323-41192345 CTGCATGTGGATATGAGCTCAGG + Intergenic
1167731826 19:51263949-51263971 CTGAAAGAGGATGTGGGGATGGG - Exonic
925091625 2:1161117-1161139 CTGCAGGTGGAAATGGGGAGAGG + Intronic
925103020 2:1265682-1265704 GTTCATGTGGATTTTGGGACTGG + Intronic
926495568 2:13582522-13582544 CTGCATGTTGTTGTGGGGTGGGG + Intergenic
926846448 2:17146505-17146527 GTGCATATGCATGTGGGGAATGG + Intergenic
926847937 2:17162401-17162423 CTGCATTTGGGAGTGTGGACAGG + Intergenic
927093487 2:19729878-19729900 CCACATGTGGATGGGAGGACAGG - Intergenic
928400908 2:30978101-30978123 CTGCAAGGGAATGTGGGGGCAGG - Intronic
929576561 2:43056189-43056211 CTGCAGGTGAGTGTGTGGACTGG - Intergenic
930691877 2:54373021-54373043 CTGCCTGTGGATGAGGGGAGTGG - Intronic
931606472 2:64058107-64058129 TTTCATGGGGATGTAGGGACAGG - Intergenic
932603075 2:73143489-73143511 CTGCATGTGGGAGTGGGGGGTGG - Intronic
932868699 2:75374615-75374637 CTGCAGCTGGATGGGGGGAGGGG - Intergenic
932881574 2:75507006-75507028 CTACTTTTGGATGTGTGGACAGG - Intronic
935090048 2:99886350-99886372 GGGCATGTGTATGTTGGGACAGG - Intronic
935102935 2:100014071-100014093 CTGCATGTGGATGAGTGCAGTGG - Intronic
935131543 2:100264756-100264778 AAGCCTGGGGATGTGGGGACTGG - Intergenic
935510990 2:103973708-103973730 CTGCATGTGAATGTGTGTGCAGG - Intergenic
935807707 2:106765343-106765365 CTGCATGTCAATTTGGGAACAGG + Intergenic
937095429 2:119232377-119232399 GTGCCTGTGGATGTGGGCACAGG - Intronic
937245257 2:120488361-120488383 CTGTGTGTGTATGTGGGGATGGG + Intergenic
937334399 2:121052618-121052640 CTGCATGGGCCAGTGGGGACAGG - Intergenic
937543625 2:122989015-122989037 CTCCATGTGCTTTTGGGGACTGG + Intergenic
939046893 2:137260352-137260374 CTGCATGTGTATGTGGGCATGGG + Intronic
943491630 2:188561392-188561414 CTGTATGTTGATGTGGGCAGTGG + Intronic
944546590 2:200805003-200805025 GTGTATGTGTATGTTGGGACAGG - Intergenic
945347100 2:208731619-208731641 ATGCATGTGGCTGTGGAAACAGG + Intronic
947472035 2:230409608-230409630 GTGCATGAGGAAGTGGGGCCGGG - Intergenic
947508512 2:230728906-230728928 CTGTATGTGCATCTGGGGCCGGG - Intronic
948507137 2:238435862-238435884 CTGTATGTGGCTGTGGTGAACGG + Exonic
1168773446 20:430458-430480 CAGAATGTGGATGTGGGGCTGGG - Exonic
1169444912 20:5663490-5663512 TTGCATGTGGATGTAATGACTGG - Intergenic
1169550610 20:6697748-6697770 CTGCATGCAGAGGTGTGGACAGG - Intergenic
1170093773 20:12621987-12622009 CTGTATGAGGAGGTGGGGATGGG - Intergenic
1171446436 20:25207638-25207660 CTGCTGGTGAATGTGGGGAGGGG - Intronic
1171451711 20:25240283-25240305 CAGTATGTGGATGGGGGCACAGG - Intergenic
1171933947 20:31256094-31256116 CTGCATGTGGGTCTGTGCACTGG - Intergenic
1172039687 20:32035091-32035113 CTGCCAGTGGAAGTGGGGAGTGG - Intergenic
1172447455 20:35000678-35000700 CTGCATTCGCAGGTGGGGACAGG + Exonic
1173181421 20:40809179-40809201 CAGCAAGTGGATGCGGGGATGGG + Intergenic
1173497693 20:43531121-43531143 CTCCAAGGGGATGTGAGGACAGG - Intronic
1173871287 20:46343723-46343745 CTGCAGGGGGAGGTGGGAACTGG - Intergenic
1175795330 20:61767177-61767199 CTGCATGCTCATGTGGGGGCGGG - Intronic
1178581578 21:33842948-33842970 GTGCATGAGTGTGTGGGGACAGG - Intronic
1179255061 21:39708753-39708775 CTGCAGGTGGATGTGTGGTAGGG - Intergenic
1179276689 21:39898260-39898282 GTGGATGTGGATGAGGGGGCCGG + Intronic
1179946707 21:44683028-44683050 CTGGATGTCGACGTGGGGACTGG - Intronic
1182620530 22:31616186-31616208 CTGAAAGGGGATGAGGGGACAGG + Intronic
1183857170 22:40642663-40642685 TTGCATGTGTATATGGAGACAGG + Intergenic
1184320451 22:43738818-43738840 CTGCAAGTGGGTGTGGGGAATGG - Intronic
1184771945 22:46602313-46602335 CAGCATGTGGGTGTGGGGTCAGG - Intronic
1184791205 22:46701264-46701286 CTGCCTGTGGCAGTGGGCACGGG - Intronic
1185027975 22:48426341-48426363 CTGCAAGTGATTGTGGGCACAGG + Intergenic
1185258520 22:49849332-49849354 CTGCAGGTGGAGACGGGGACCGG + Intergenic
949523443 3:4878756-4878778 CAGCCTCTGGATCTGGGGACGGG - Intronic
950150203 3:10680880-10680902 CTCCATGTGGAGGTGGGGCCTGG + Intronic
950150541 3:10683446-10683468 CTTCATGTGGAACTGGGGAAAGG + Intronic
950436575 3:12983882-12983904 AGGCATGTGGATTTGGGGACAGG - Intronic
950527012 3:13530134-13530156 CTGACTGTGGAAGTTGGGACTGG - Intergenic
950797102 3:15519229-15519251 GTGCCTGTGGATGTGCGCACTGG + Intronic
952336018 3:32403627-32403649 CTGAAGGTGGATTTGGGGCCAGG + Intronic
952898257 3:38093511-38093533 CTGCATGTGGATGGCGGCATGGG + Intronic
952952278 3:38534364-38534386 CTGTATGTGTCTGTGGGGAAGGG + Intronic
953882733 3:46700059-46700081 CAGCATGAGGAAGTGGGGATTGG + Intergenic
954638528 3:52084724-52084746 CAGGATGTGGATATGGGGAAGGG - Intronic
954699902 3:52445700-52445722 GGGCATGTAGATGTGGGGAGAGG - Intergenic
956172782 3:66445810-66445832 CTGCATGTGTGTGTGGGGATGGG - Intronic
959037926 3:101387147-101387169 CTGATTGTGCATGTGGGCACCGG - Intronic
960121367 3:113951175-113951197 CTGCTTGGAGCTGTGGGGACAGG - Intronic
962852570 3:139318948-139318970 CCACATGTGGATGTGGGCCCGGG + Intronic
963975719 3:151478089-151478111 CTGCCTGAGGGTGTGGGGGCAGG - Intergenic
964004775 3:151813585-151813607 ATGCATTGGGAAGTGGGGACGGG - Intergenic
964246530 3:154660195-154660217 CTGCATGTGTGTTTGGGGATGGG - Intergenic
964346863 3:155762557-155762579 TTGCTTGTGAATTTGGGGACAGG - Intergenic
967090364 3:186129841-186129863 CTGCATGTGGAAGTGGGGGATGG - Intronic
967557528 3:190876626-190876648 CTGCCTGTGGACGTTGTGACTGG + Intronic
967562000 3:190926924-190926946 GTGCATGTGTTGGTGGGGACAGG + Intergenic
968006510 3:195246839-195246861 CTGGCTGTGGCTGTGGGGGCTGG - Intronic
968460358 4:721681-721703 CTGCGTGTGGGTGTGGAGAGAGG + Intronic
968460404 4:721835-721857 CTGCATGTGGGTGTGGAAAGAGG + Intronic
968460429 4:721937-721959 CTGCATGTGGGTGTGGGGAGAGG + Intronic
969244684 4:5924715-5924737 TTCCACGTGGATGTGGGGAGAGG + Intronic
969251744 4:5972831-5972853 CTGCATGTATATGTGTGGGCAGG + Intronic
969495916 4:7526058-7526080 CTGCAGTTGCAGGTGGGGACAGG - Intronic
969549249 4:7853407-7853429 CTGCAGGTGGACGCGGGGACAGG + Intronic
973237867 4:47925286-47925308 GTTTATGTGGATGTGGGGAAAGG + Intronic
973437027 4:50249649-50249671 CTGCAGGTGGATATGTGGATAGG + Intergenic
973522694 4:51662908-51662930 CTGCAGGTGGATATGTGGATAGG + Intergenic
973553893 4:52062531-52062553 GTGTCTGTGGATTTGGGGACAGG + Intronic
973621182 4:52727694-52727716 CTGAATGTGAATGTGGTGGCTGG + Intronic
975719540 4:77236477-77236499 CTGCATTGGGATGAGGGGTCTGG + Intronic
975804666 4:78099416-78099438 CTGCAAGTGGAGGGGAGGACTGG - Intronic
976953095 4:90858052-90858074 CTGCATTTAGATGTGGGAAATGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
979151545 4:117322759-117322781 CTGCTTGTAGAAGTGGGCACTGG + Intergenic
979192988 4:117885978-117886000 GTCCATGTGGAGATGGGGACAGG - Intergenic
981744594 4:148040246-148040268 CTTCATGTGGAAATAGGGACTGG - Intronic
982209572 4:153023481-153023503 CTGCGTGTGGGGGTGGGGAGGGG + Intergenic
983230413 4:165124497-165124519 CTGCCTGTGAGTGTGTGGACCGG - Intronic
983379863 4:166979225-166979247 CTGCATATGGATGTGTGTATAGG - Intronic
984981080 4:185282185-185282207 CAGCATGTGCATGTCCGGACAGG + Intronic
985892735 5:2728550-2728572 TTCCATGTGGATGTGGCTACAGG + Intergenic
986051610 5:4095086-4095108 CAGCCTGTTGATGTGGGGAGGGG + Intergenic
986910659 5:12551245-12551267 CTGCATATGAATGTGGCAACTGG - Intergenic
988617582 5:32790351-32790373 CTGAATGTGGATGTGGGTGGAGG - Exonic
989859541 5:46351151-46351173 CTGCAAGTGGATATTTGGACAGG - Intergenic
989859732 5:46354898-46354920 CTGCAAGTGGATATTCGGACCGG - Intergenic
989859740 5:46355069-46355091 CTGCAAGTGGATATGTAGACCGG - Intergenic
989860118 5:46362178-46362200 CTGCAAGTGGATATTTGGACTGG - Intergenic
989860250 5:46364746-46364768 CTGCAAGTGGATATTGGGACCGG - Intergenic
989862857 5:46403411-46403433 CTGCAGGTGGATATTTGGACCGG + Intergenic
989863064 5:46407680-46407702 CTGCAAGTGGATATTTGGACTGG + Intergenic
989915612 5:49723278-49723300 CTGCATGTGGATATCTGGAGTGG + Intergenic
989915901 5:49727708-49727730 CTGCATGTGGATATCTGGAGCGG + Intergenic
989916651 5:49738777-49738799 CTGCATGTGGATATCTGGAGCGG + Intergenic
989917530 5:49752068-49752090 CTGCATGTGGATATCTGGAGCGG + Intergenic
989917680 5:49754282-49754304 CTGCATGTGGATATCTGGAGCGG + Intergenic
989918236 5:49762631-49762653 CTGCATGTGGATATCTGGAGCGG + Intergenic
989918397 5:49764848-49764870 CTGCATGTGGATATCTGGAGCGG + Intergenic
989919130 5:49775926-49775948 CTGCATGTGGATATCTGGAGCGG + Intergenic
989919289 5:49778140-49778162 CTGCATGTGGATATCTGGAGCGG + Intergenic
989919591 5:49782571-49782593 CTGCATGTGGATATCTGGAGCGG + Intergenic
989919745 5:49784787-49784809 CTGCATGTGGATATCTGGAGCGG + Intergenic
989920185 5:49791429-49791451 CTGCATGTGGATATCTGGAGCGG + Intergenic
989920495 5:49795858-49795880 CTGCATGTGGATATCTGGAGCGG + Intergenic
989922020 5:49818012-49818034 CTGCATGTGGATATCTGGAGCGG + Intergenic
989922309 5:49822272-49822294 CTGCATGTGGATATCTGGAGCGG + Intergenic
989922455 5:49824488-49824510 CTGCATGTGGATATCTGGAGCGG + Intergenic
989922606 5:49826700-49826722 CTGCATGTGGATATCTGGAGCGG + Intergenic
989922899 5:49831128-49831150 CTGCATGTGGATATCTGGAGCGG + Intergenic
989923039 5:49833348-49833370 CTGCATGTGGATATCTGGAGCGG + Intergenic
989923334 5:49837771-49837793 CTGCATGTGGATATCTGGAGCGG + Intergenic
989923478 5:49839984-49840006 CTGCATGTGGATATCTGGAGCGG + Intergenic
989923617 5:49842198-49842220 CTGCATGTGGATATCTGGAGCGG + Intergenic
989924238 5:49851058-49851080 CTGCATGTGGATATCTGGAGCGG + Intergenic
989924389 5:49853271-49853293 CTGCATGTGGATATCTGGAGCGG + Intergenic
989924541 5:49855486-49855508 CTGCATGTGGATATCTGGAGCGG + Intergenic
989924696 5:49857702-49857724 CTGCATGTGGATATCTGGAGCGG + Intergenic
989925002 5:49862129-49862151 CTGCATGTGGATATCTGGAGCGG + Intergenic
989925876 5:49875247-49875269 CTGCATGTGGATATCTGGAGCGG + Intergenic
989926029 5:49877461-49877483 CTGCATGTGGATATCTGGAGCGG + Intergenic
989926626 5:49886318-49886340 CTGCATGTGGATATCTGGAGCGG + Intergenic
989926770 5:49888532-49888554 CTGCATGTGGATATCTGGAGCGG + Intergenic
989926923 5:49890747-49890769 CTGCATGTGGATATCTGGAGCGG + Intergenic
989927077 5:49892962-49892984 CTGCATGTGGATATCTGGAGCGG + Intergenic
989927535 5:49899604-49899626 CTGCATGTGGATATCTGGAGCGG + Intergenic
989929023 5:49921573-49921595 CTGCATGTGGATATCTGGAGCGG + Intergenic
989929166 5:49923786-49923808 CTGCATGTGGATATCTGGAGCGG + Intergenic
989929884 5:49934685-49934707 CTGCATGTGGATATCTGGAGCGG + Intergenic
989930027 5:49936899-49936921 CTGCATGTGGATATCTGGAGCGG + Intergenic
989930184 5:49939113-49939135 CTGCATGTGGATATCTGGAGCGG + Intergenic
989930473 5:49943543-49943565 CTGCATGTGGATATCTGGAGCGG + Intergenic
989930630 5:49945761-49945783 CTGCATGTGGATATATGGAGCGG + Intergenic
989931213 5:49954614-49954636 CTGCATGTGGATATCTGGAGCGG + Intergenic
989931661 5:49961258-49961280 CTGCATGTGGATATCTGGAGCGG + Intergenic
989931812 5:49963472-49963494 CTGCATGTGGATATCTGGAGCGG + Intergenic
989931961 5:49965688-49965710 CTGCATGTGGATATCTGGAGCGG + Intergenic
989932114 5:49967901-49967923 CTGCATGTGGATATCTGGAGCGG + Intergenic
989932262 5:49970115-49970137 CTGCATGTGGATATCTGGAGCGG + Intergenic
989932711 5:49976756-49976778 CTGCATGTGGATATCTGGAGCGG + Intergenic
989933154 5:49983403-49983425 CTGCATGTGGATATCTGGAGCGG + Intergenic
989933318 5:49985617-49985639 CTGCATGTGGATATCTGGAGCGG + Intergenic
989933616 5:49990043-49990065 CTGCATGTGGATATCTGGAGCGG + Intergenic
989933758 5:49992258-49992280 CTGCATGTGGATATCTGGAGCGG + Intergenic
989934510 5:50003336-50003358 CTGCATGTGGATATCTGGAGCGG + Intergenic
989934659 5:50005552-50005574 CTGCATGTGGATATCTGGAGCGG + Intergenic
989935106 5:50012199-50012221 CTGCATGTGGATATCTGGAGCGG + Intergenic
989935248 5:50014413-50014435 CTGCATGTGGATATCTGGAGCGG + Intergenic
989935697 5:50021058-50021080 CTGCATGTGGATATCTGGAGTGG + Intergenic
989935849 5:50023271-50023293 CTGCATGTGGATATCTGGAGCGG + Intergenic
989936304 5:50029918-50029940 CTGCATGTGGATATCTGGAGCGG + Intergenic
989936455 5:50032133-50032155 CTGCATGTGGATATCTGGAGCGG + Intergenic
989936607 5:50034347-50034369 CTGCATGTGGATATCTGGAGCGG + Intergenic
989937072 5:50040995-50041017 CTGCATGTGGATATCTGGAGCGG + Intergenic
989938117 5:50056502-50056524 CTGCATGTGGATATCTGGAGCGG + Intergenic
989938273 5:50058715-50058737 CTGCATGTGGATATCTGGAGCGG + Intergenic
990719003 5:58672176-58672198 CAGCATTTGGATGAGGGGTCAGG + Intronic
992465425 5:76999555-76999577 CTGCCTTAGGCTGTGGGGACAGG - Intergenic
992552007 5:77868094-77868116 CTGCTGGTGGCTGTGGGCACAGG - Intronic
992715894 5:79510956-79510978 CTGCATGGGGCTGTGGGGCTGGG + Intronic
992950150 5:81850686-81850708 CTGCATTGCGATGTGGTGACAGG + Intergenic
994355112 5:98785974-98785996 TTCCAAGTGGATGTGGGGAAAGG + Intronic
995012369 5:107271776-107271798 GTGTATGTGGATTTAGGGACAGG - Intergenic
995740522 5:115351112-115351134 CTGACTCTGGAGGTGGGGACTGG - Intergenic
996722847 5:126647128-126647150 CTGCAGGTGGATGTGGGGGTGGG - Intergenic
997203208 5:132025384-132025406 CTGCTGGTGGATGTCAGGACTGG + Intergenic
997297117 5:132775353-132775375 GTCCACGTGGATGTGAGGACTGG - Intronic
997336951 5:133115179-133115201 CTGCTTGTGGCTCTGGGGCCTGG + Intergenic
997338441 5:133123904-133123926 CTGCATGTATGGGTGGGGACAGG + Intergenic
998590451 5:143472253-143472275 CTGTATGTGGATGAGTGGAACGG + Intergenic
999389658 5:151180863-151180885 CTAATTGTGGATGTGGGGCCTGG - Intergenic
999720918 5:154398648-154398670 CTCCATGTGGTTGTGGGGATTGG - Intronic
1000610155 5:163365171-163365193 CGGCCTGTGGCTCTGGGGACTGG - Intergenic
1000852355 5:166356043-166356065 GAGCATATGGGTGTGGGGACAGG - Intergenic
1001351790 5:170974845-170974867 CTGCATGAGAATGTGGGGAGTGG + Intronic
1001420714 5:171584915-171584937 GTGCATGTGGATATGGGGAGAGG + Intergenic
1002076881 5:176713545-176713567 CTGCATGTGGGTGGAGGAACTGG + Intergenic
1002339321 5:178504588-178504610 CTGGAAGTGGGTGTGGGGAAAGG + Intronic
1002374739 5:178780680-178780702 CGGCATGTGGAAGTGGTGTCTGG - Intergenic
1002435982 5:179231104-179231126 ATGCGTGTGCATGTGGGGAGGGG - Intronic
1002467212 5:179413612-179413634 CAGAGTGAGGATGTGGGGACAGG - Intergenic
1002634331 5:180599640-180599662 CTGCATGTGGATTCAGGGAGGGG - Intergenic
1202776957 5_GL000208v1_random:89137-89159 CTGCATGTGGATATCTGGAGCGG - Intergenic
1202777106 5_GL000208v1_random:91351-91373 CTGCATGTGGATATCTGGAGCGG - Intergenic
1002831245 6:823330-823352 CTGCCTGTGCATTTTGGGACTGG - Intergenic
1003213388 6:4088045-4088067 CAACATGGGGATGTGGGGAGCGG - Intronic
1003291977 6:4787724-4787746 ATGCAGGTGGAGGTGCGGACAGG + Intronic
1006160676 6:32039071-32039093 CTGCAGGAGGAGGTGGGGGCTGG - Intronic
1007269018 6:40621414-40621436 CTGGATTTGGGAGTGGGGACAGG + Intergenic
1007274446 6:40663057-40663079 GTGGATGTGGAGGTGGGGTCTGG - Intergenic
1007400463 6:41599786-41599808 CTGGATGTGGGTGTGGAGCCGGG - Exonic
1007451207 6:41941355-41941377 CTGCAGATTGCTGTGGGGACCGG + Intronic
1009073589 6:58669281-58669303 CTGCAAGTGGATATATGGACCGG + Intergenic
1009108421 6:59154149-59154171 CTGCAAGTGGATATATGGACCGG + Intergenic
1009116699 6:59269437-59269459 CTGCAAGTGGATATATGGACCGG + Intergenic
1009143536 6:59642474-59642496 CTGCAAGTGGATATATGGACCGG + Intergenic
1009143754 6:59645530-59645552 CTGCAAGTGGATATATGGACCGG + Intergenic
1009146177 6:59679138-59679160 CTGCAAGTGGATATATGGACCGG + Intergenic
1009153416 6:59780021-59780043 CTGCAAGTGGATATATGGACCGG + Intergenic
1009197330 6:60702739-60702761 CTACATGTTGATGTGGGAAGGGG + Intergenic
1010905756 6:81486111-81486133 CAGCATGGGGAGCTGGGGACCGG - Intergenic
1012932396 6:105330593-105330615 CAGCAAGTGGAAGTGAGGACAGG + Intronic
1013316571 6:108948822-108948844 CTGCATGTGACAGTGGGGAGAGG + Intronic
1013535669 6:111061051-111061073 GTGCATGTGCATGTGGGGAGGGG - Intergenic
1013616670 6:111849840-111849862 CTGCATGGGGGTGTGGGCAAAGG - Intronic
1013726997 6:113110926-113110948 ATGGAGGTGGAAGTGGGGACAGG + Intergenic
1015133045 6:129835834-129835856 CTGCATCTTGATGTGGAGATGGG + Intronic
1015532305 6:134232706-134232728 CTGGGTGTGGTTGTGGGGGCCGG + Intronic
1017623148 6:156319191-156319213 CTGTGTGTGTATATGGGGACAGG - Intergenic
1017712195 6:157180932-157180954 CAGCATGTGGAGGTGGGGCATGG - Intronic
1018704558 6:166454010-166454032 CTGCATGTGGATGTCGAGTGTGG + Intronic
1018996894 6:168716936-168716958 GGGCATGGGGATGTGGGCACGGG + Intergenic
1019211236 6:170407106-170407128 CAGCATGTGGATGTGGGGAAGGG + Intergenic
1019636500 7:2078837-2078859 GTCCTTGGGGATGTGGGGACTGG - Intronic
1019752759 7:2742651-2742673 CTGCAGGTGTTTGCGGGGACAGG - Intronic
1019780480 7:2936946-2936968 CTCCACGGGGAGGTGGGGACTGG + Intronic
1019870950 7:3760674-3760696 CTGCATTTGGATGTGGTGTTTGG + Intronic
1020770109 7:12379947-12379969 CTGCGTGTGGGTGTGGTGGCGGG + Intronic
1020893195 7:13905632-13905654 CTCCATTTGTATGTGGGGAGTGG + Intronic
1023058238 7:36306730-36306752 CTGGAGGTGGATGTTGGGGCGGG - Intergenic
1023145324 7:37145291-37145313 CTGCATGGGGATTTGAGGAATGG - Intronic
1023845296 7:44116926-44116948 CTGCTGGTGGATGTGGTGACGGG - Exonic
1025392836 7:59406263-59406285 CTGCAAGTGGATATATGGACCGG + Intergenic
1026355379 7:69552802-69552824 CTGCCTGTGGCTGTGGGGCTTGG - Intergenic
1026875460 7:73876827-73876849 CTGCAGGTGCATTTGGTGACGGG + Intergenic
1026948673 7:74332940-74332962 CTGCCTGTGGAGGTGGGGACTGG - Intronic
1027934858 7:84589346-84589368 CTGCATGAGAAAGTTGGGACAGG - Intergenic
1028103906 7:86854892-86854914 CTGCATGTGGATGTGGCCACTGG - Intronic
1028696762 7:93722928-93722950 CAGCATGAGGAAGTGTGGACTGG - Intronic
1029274156 7:99394228-99394250 CTGCATGGGGATGAGGGGTGGGG + Intronic
1029902752 7:104059217-104059239 CTGCAGCTTGATGTGGGGAGGGG + Intergenic
1033039244 7:137903292-137903314 CTTCATGTGGATCTGGGGAAAGG - Intronic
1033466683 7:141597317-141597339 CTGTATGTGGGGGTGGGGAGTGG + Intronic
1034548769 7:151807062-151807084 CTGAAGGTGGAGGTGGGGAAGGG + Intronic
1034784259 7:153910814-153910836 CTGCTTGTTGATGTGGGGATTGG - Intronic
1036127440 8:6075859-6075881 CTGCTTGTGGATGTCGGGCCTGG - Intergenic
1036532171 8:9601953-9601975 GTGTATGAGGAGGTGGGGACGGG + Intronic
1038239888 8:25798630-25798652 CTGCATGTAGAAGCGGGGGCAGG + Intergenic
1038862661 8:31404222-31404244 CAGCATGTGTATGTAGGGAGAGG - Intergenic
1040667123 8:49647565-49647587 CTGGTTCTGGATGTGGGAACTGG + Intergenic
1041148013 8:54898928-54898950 GAGAATGTGCATGTGGGGACAGG + Intergenic
1044861167 8:96525350-96525372 CTGCAGGTGGAAGTGAGCACAGG - Intronic
1045658978 8:104416526-104416548 ATGCTTGTGGGTGTGGGGAGTGG + Intronic
1048071362 8:131024944-131024966 ATGAATGTGCATGTGGGGATTGG - Intronic
1049004220 8:139844681-139844703 CTGCTGGTGGGAGTGGGGACTGG + Intronic
1049996937 9:1043183-1043205 CTCCACGGGGATGTGGGGGCGGG - Intergenic
1050192852 9:3046596-3046618 CTGCATCTGCCTGTGGGAACTGG + Intergenic
1050312702 9:4369640-4369662 CTCCATGTGCATGTGAGGAATGG - Intergenic
1052572886 9:30251035-30251057 GTGCATGTGGATGGGGAGACAGG - Intergenic
1053687170 9:40544438-40544460 CTGCATGTGGATATCTGGAGCGG + Intergenic
1054421501 9:64936480-64936502 CTGCATGTGGATATTTGGATCGG + Intergenic
1055662655 9:78520387-78520409 CCACATGTGGGTCTGGGGACTGG + Intergenic
1055885086 9:81052735-81052757 GTGCCTTTGGATGTGGGGAGTGG - Intergenic
1057030157 9:91769243-91769265 GTGGATGTGGATGTGGACACTGG + Intronic
1057260589 9:93580911-93580933 TTGCATGTTGCTGTGGGGAGAGG + Intronic
1057335802 9:94154139-94154161 CTTCCTGTTAATGTGGGGACAGG - Intergenic
1057431199 9:94996004-94996026 CTGCATGTGGAGGTGGAGAGTGG - Intronic
1057574215 9:96228629-96228651 TTGAATGTGGATGTGCTGACTGG + Intergenic
1060029011 9:120198043-120198065 ATGCTTGTGGCTGTGGGCACAGG + Intergenic
1060694654 9:125698012-125698034 CTGGATTTGGATATTGGGACTGG - Intronic
1061580810 9:131534736-131534758 CTGCATGTGTTTGAGGGGGCAGG - Intergenic
1062624449 9:137436478-137436500 GTGCATGGGGCTGTGGGAACAGG - Intronic
1185455638 X:309322-309344 GTGGATGTGGATTTGGGGGCGGG - Intronic
1185763173 X:2703905-2703927 CTGCCTGTGGAAGGGGTGACAGG + Intronic
1187064084 X:15815897-15815919 ATGCGTGTGGAGGAGGGGACTGG + Intronic
1187454149 X:19426480-19426502 CTGCATGTGGCTGTTGGTAAAGG - Intronic
1187481932 X:19664694-19664716 CTGCATGTTGATATTGTGACAGG + Intronic
1193396995 X:80996793-80996815 CTGGATGAGGATGTGGAGAAAGG + Intergenic
1195356821 X:104047232-104047254 CTGCCAGTGGATGTGAGGAACGG + Intergenic
1195603346 X:106773597-106773619 CTGTATTTGCATGTGGGGATGGG + Intronic
1195800587 X:108704709-108704731 CTGCCAGTGGCTGTGGGGACTGG - Intergenic
1197025266 X:121740290-121740312 CTGCATCTGGATTTGGAGACAGG + Intergenic
1200214746 X:154362768-154362790 CTGCAGGTGAATGTGGGAGCTGG - Exonic
1200835339 Y:7726639-7726661 CTGCATGTGGAAGCAGGGGCAGG - Intergenic
1201226867 Y:11826999-11827021 CTGCATCTGGAGGTGGGTCCTGG + Intergenic