ID: 1163042114

View in Genome Browser
Species Human (GRCh38)
Location 19:14610293-14610315
Sequence CACACAGATGTGCCTCAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163042110_1163042114 12 Left 1163042110 19:14610258-14610280 CCTTTCGTGGACGGCCTTGCCTC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1163042112_1163042114 -2 Left 1163042112 19:14610272-14610294 CCTTGCCTCTTCGTGAGTGGACA 0: 1
1: 0
2: 2
3: 5
4: 87
Right 1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1163042113_1163042114 -7 Left 1163042113 19:14610277-14610299 CCTCTTCGTGAGTGGACACACAG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1163042108_1163042114 17 Left 1163042108 19:14610253-14610275 CCTGCCCTTTCGTGGACGGCCTT 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 157
1163042109_1163042114 13 Left 1163042109 19:14610257-14610279 CCCTTTCGTGGACGGCCTTGCCT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG 0: 1
1: 0
2: 0
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163042114 Original CRISPR CACACAGATGTGCCTCAAAC AGG Exonic
900040558 1:459202-459224 CACACAGAGCTGCATAAAACAGG + Intergenic
900061988 1:694173-694195 CACACAGAGCTGCATAAAACAGG + Intergenic
901455070 1:9358500-9358522 CAGCCAAATTTGCCTCAAACTGG + Intronic
902779470 1:18695243-18695265 CACACAGAAGTGCCATAAATGGG + Intronic
909179817 1:72408807-72408829 GATACAGATGTGGGTCAAACAGG - Intergenic
911661369 1:100505498-100505520 CACTCAGATTTTCATCAAACTGG - Intronic
911797064 1:102088961-102088983 TACACAGAAATGCCTCCAACTGG - Intergenic
912529449 1:110309752-110309774 CACTCAGAAGTGCCTCATGCAGG - Intergenic
913663797 1:121029488-121029510 CACACCAATGTGCTTTAAACCGG + Intergenic
914015194 1:143812768-143812790 CACACCAATGTGCTTTAAACCGG + Intergenic
914162625 1:145148457-145148479 CACACCAATGTGCTTTAAACCGG - Intergenic
914653810 1:149721308-149721330 CACACCAATGTGCTTTAAACCGG + Intergenic
915481468 1:156188796-156188818 TACACAGAAGAGCCTCAAAAGGG - Intergenic
917694323 1:177505831-177505853 CACAGAAATGTGCCTCAAAATGG - Intergenic
919574874 1:199295213-199295235 CAAACAGGTGTGCCTTCAACTGG - Intergenic
919972913 1:202592263-202592285 CAGGCAGATGTGCAGCAAACAGG + Exonic
922153566 1:223024390-223024412 CACACGGATGTGCATGAAAAAGG - Intergenic
1067074136 10:43163653-43163675 CACCAACATGTGCCTCAAATTGG + Intronic
1067368334 10:45657682-45657704 CACCCAGATGTCCCTCAACTTGG + Intronic
1068568300 10:58599752-58599774 CATAGAGATGTGCCTTGAACAGG - Intronic
1076614320 10:131746205-131746227 CATACAGAGGTGGCTCCAACAGG + Intergenic
1076966831 11:95425-95447 CACACAGAGCTGCATAAAACAGG + Intergenic
1082152274 11:48755480-48755502 CACAAAGATGTTCCTCAGAAAGG + Intergenic
1084424672 11:69077969-69077991 CACACAGACGTGTCTCAAGGAGG + Intronic
1084899313 11:72297961-72297983 AATAAAGATGTGTCTCAAACAGG + Intronic
1087943443 11:104129145-104129167 TACAGAGCTCTGCCTCAAACTGG + Intronic
1088421486 11:109652869-109652891 CACACAGCTATGCCTCATATCGG - Intergenic
1089107598 11:116026104-116026126 AACATAGATGTGCCTAACACTGG + Intergenic
1090969998 11:131633114-131633136 CATTAAGATGTGCTTCAAACAGG - Intronic
1097823169 12:64147849-64147871 CACAGAGATGCACATCAAACTGG - Exonic
1098185970 12:67896693-67896715 CTCCCAGATTTTCCTCAAACAGG - Intergenic
1101889427 12:108699255-108699277 CACACAGGTCTCCCTCAAATGGG + Intronic
1102399616 12:112617119-112617141 AGCAGAGATGTGCTTCAAACAGG - Intronic
1104045838 12:125162209-125162231 GACACAGGTGTGCATCAAATGGG + Intergenic
1105864429 13:24446749-24446771 CACACAGAGTTGCCTGAAATGGG + Exonic
1106514181 13:30438771-30438793 CTCACAGATGTACCCCAAAGAGG - Intergenic
1111592400 13:90367140-90367162 CACACAGACATGGCCCAAACAGG + Intergenic
1112658176 13:101474701-101474723 CACACTGATCTGCCTGGAACTGG - Intronic
1119693500 14:76694897-76694919 CACACAGATGTACCACAGTCGGG + Intergenic
1120585838 14:86311462-86311484 CACACAGATGGCCCTGAAACCGG + Intergenic
1120918269 14:89729731-89729753 GATACAGCTGTGCCTGAAACTGG + Intergenic
1122000367 14:98645879-98645901 CGCACATATGTTCCCCAAACGGG - Intergenic
1123114812 14:105889892-105889914 CACACAGATCAACCCCAAACCGG - Intergenic
1123404001 15:20009834-20009856 CACACAGATCAACCCCAAACCGG - Intergenic
1123513340 15:21016480-21016502 CACACAGATCAACCCCAAACCGG - Intergenic
1132441348 15:101868421-101868443 CACACAGAGCTGCATAAAACAGG - Intergenic
1133670741 16:8017278-8017300 CACACAAATGTACATAAAACTGG + Intergenic
1133960790 16:10491640-10491662 TACACAGAGATGCCTCCAACTGG + Intergenic
1134648041 16:15886524-15886546 CACACAGGACAGCCTCAAACTGG + Intronic
1136009148 16:27351427-27351449 CACAAAGATGTGATTCAAAGTGG + Intronic
1137231569 16:46571814-46571836 CATACAGATGTTACCCAAACAGG + Intergenic
1140303765 16:73783238-73783260 CATACAGATTTGTCTCTAACTGG - Intergenic
1144053060 17:11514610-11514632 CACAAAGATGTGCTTCACAGGGG - Intronic
1146293799 17:31632440-31632462 CACACAGATGCGCATGACACAGG + Intergenic
1147301353 17:39530861-39530883 AACACTGATGGGCCTGAAACAGG + Exonic
1150606134 17:66692609-66692631 CTCAAAGAGGTGCCTCAAATTGG - Intronic
1151053861 17:71009611-71009633 CACATAAATATGCCTAAAACTGG - Intergenic
1152147345 17:78576434-78576456 TTCACAGATGTGCCTGAATCGGG - Intronic
1156361246 18:36386535-36386557 CACACACAGGTGACTCACACTGG - Intronic
1157720039 18:49916581-49916603 CACACAGCTGTACCACAGACAGG + Intronic
1160208920 18:76859927-76859949 CCCACAGATGTGCCCCACTCAGG - Intronic
1160643634 19:165048-165070 CACACAGAGCTGCATAAAACAGG + Intergenic
1163042114 19:14610293-14610315 CACACAGATGTGCCTCAAACAGG + Exonic
1164055970 19:21622507-21622529 TACACAGAAGTGCCTAAAAAGGG + Intergenic
1166326027 19:42051670-42051692 GATTCAGATGTGACTCAAACTGG - Intronic
1166423974 19:42659618-42659640 GACACAGATGTGTGTGAAACAGG - Intronic
1166473186 19:43097744-43097766 TACACAGGTGTGCATGAAACAGG + Intronic
1166493971 19:43284730-43284752 TACACAGGTGTGCATGAAACAGG + Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
926636322 2:15183656-15183678 CACACAGATGTGGCCCATTCTGG + Intronic
931189091 2:59982425-59982447 CACACAGGTGTGACTCACATGGG + Intergenic
931218942 2:60271714-60271736 CACACAGTTCAGCCTCACACTGG + Intergenic
931862378 2:66369569-66369591 CAGACAGTGGTGCCTCAAGCTGG - Intergenic
933476238 2:82794414-82794436 CACACAGATGCGCCAAACACAGG + Intergenic
933650974 2:84850086-84850108 AACACTGATGTACCTCCAACGGG + Intronic
935198116 2:100832510-100832532 CAAACAGATGTGGCGCACACTGG - Intronic
935856411 2:107279295-107279317 GACACAGATGTGCCTCATCATGG + Intergenic
937295153 2:120805682-120805704 GACACAGCTGTCCCTCAACCTGG + Intronic
937690652 2:124751084-124751106 AGCACAGATGTGCCTGAACCTGG + Intronic
937825453 2:126364234-126364256 GACACAGATGTGCCCCACAATGG + Intergenic
940258670 2:151758695-151758717 CACACAGATGTGGAAAAAACTGG + Intergenic
940352687 2:152706656-152706678 TACACAGAGATGCCTCCAACAGG + Intronic
943325053 2:186487114-186487136 CACACACATATATCTCAAACTGG - Intronic
943388875 2:187236411-187236433 AACAAAGATGTCCCTCAAAAGGG - Intergenic
943417976 2:187631860-187631882 TACCCAGAGGTCCCTCAAACTGG + Intergenic
943950706 2:194129913-194129935 TTTACAGATGTGCCTCAAATTGG + Intergenic
946091218 2:217225668-217225690 AACATAGAGGTGCCTCAAATGGG + Intergenic
946245825 2:218386904-218386926 CACACAGATGTGAGTCATGCAGG + Intronic
946525934 2:220520378-220520400 CACGCACATGTGCTTCAAATAGG + Intergenic
947556309 2:231096389-231096411 TACACAGAAGTGCCTAAAAAGGG - Intronic
1169533035 20:6505910-6505932 CACATACATGTGCCTAAAGCAGG - Intergenic
1174042993 20:47713148-47713170 CACACAGATGTGCTTCAGGTTGG - Intronic
1177037001 21:16056771-16056793 CACTGAGATTTGCCTAAAACAGG - Intergenic
1177720386 21:24899053-24899075 TACACAGAGCTGCCTGAAACTGG + Intergenic
1178218463 21:30627251-30627273 CACACACATGTGCATGCAACAGG - Intergenic
1179463710 21:41556565-41556587 CACAGAGCTGTGCCTAAACCAGG + Intergenic
1183347193 22:37314387-37314409 CAGACAGATGGGACTCAAGCAGG + Exonic
1184460407 22:44634600-44634622 AAGACAGATATGCCTCAAAGTGG + Intergenic
1185102339 22:48848078-48848100 CCCACAGGTGTGCCTCCCACAGG - Intronic
950637731 3:14327177-14327199 CACACATATGAGCCCCAAACTGG + Intergenic
951104831 3:18730576-18730598 CACACAGATATGGCTCCACCTGG + Intergenic
959521328 3:107326041-107326063 CACACAGACATTCCTCAAATAGG + Intergenic
959779760 3:110215788-110215810 CACAAAGAATTGCCTCAGACTGG - Intergenic
959970285 3:112401531-112401553 CACACGGATGTGCATTAAAGTGG - Intergenic
960072432 3:113446280-113446302 CACACAGGTGTGCCTTGAATGGG - Intronic
962260597 3:133901065-133901087 CACACAAATGTAACTCAAAATGG - Intergenic
964384435 3:156132093-156132115 CACAGAGCTGTGCTTGAAACAGG + Intronic
968519135 4:1027877-1027899 CAAACAGATGTTCCCCAGACAGG + Intergenic
968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG + Intergenic
969456160 4:7300852-7300874 GACACAGATGGCTCTCAAACAGG - Intronic
969498838 4:7540994-7541016 CACACAGCTGGGGCTCAGACAGG + Intronic
970215019 4:13749925-13749947 CACACAGATTTACCACCAACAGG - Intergenic
971516290 4:27490773-27490795 CGCTCAGATGTGCCTCAGAGTGG + Intergenic
973070643 4:45854325-45854347 AACATATATGTGCCTAAAACTGG - Intergenic
974315022 4:60268509-60268531 TACCCAGATGTCCCTGAAACAGG + Intergenic
982163117 4:152589716-152589738 CACATAAATGTTCCTCAAATTGG + Intergenic
983453036 4:167930451-167930473 CCCACAGATGTGACTCAGACGGG + Intergenic
985970341 5:3373236-3373258 CACACAGATGTGTCTCCCAGTGG + Intergenic
986343552 5:6813412-6813434 CATTGAGATGTGCCCCAAACAGG + Intergenic
991547785 5:67802688-67802710 CACACATATGTGCCTAAGCCAGG - Intergenic
997065399 5:130553740-130553762 AACACAGGTGAGCCCCAAACTGG - Intergenic
1001270489 5:170307706-170307728 CACACAGCTGTGACTCATACTGG + Intergenic
1002733289 5:181359743-181359765 CACACAGAGCTGCATAAAACAGG - Intergenic
1002751251 6:114375-114397 CACACAGAGCTGCATAAAACAGG + Intergenic
1003129754 6:3385765-3385787 CAAACACATGTGCCTGCAACTGG + Intronic
1004037911 6:11942184-11942206 CACACAGGTGCGCATTAAACAGG + Intergenic
1006163473 6:32050910-32050932 CCCACAGATGAGCTTCACACAGG + Intronic
1009288667 6:61856024-61856046 ATCACAGATGTGACTCAAATAGG - Intronic
1010844765 6:80691589-80691611 CACAAAGATGTGCATTACACTGG + Intergenic
1012726558 6:102819820-102819842 CACCCAGATGTGCATTAAAATGG + Intergenic
1018042146 6:159934243-159934265 GAAACAGAAATGCCTCAAACTGG + Intergenic
1018442543 6:163826296-163826318 CACACAGATGCCCCTGAAAACGG - Intergenic
1019237539 6:170632065-170632087 CACACAGAGCTGCATAAAACAGG - Intergenic
1020517705 7:9144311-9144333 TACACTGATGTGCCTCATAATGG - Intergenic
1022566249 7:31405678-31405700 GAAAAAGATGTGCCTCAAATCGG - Intergenic
1022999856 7:35797584-35797606 CAGAGATATGTGCCTCAGACAGG + Intergenic
1024381849 7:48705396-48705418 CACATAGCTGTGCATTAAACAGG - Intergenic
1028862789 7:95672442-95672464 CACAGATCTGTGCCTCAAATAGG + Intergenic
1035510228 8:174546-174568 CACACAGAGCTGCATAAAACAGG + Intergenic
1038419848 8:27426631-27426653 CACTCAGATGTGCCACAATCTGG - Intronic
1039162151 8:34634264-34634286 AACACAGATGTCCCTACAACAGG + Intergenic
1041272088 8:56118784-56118806 CATACAAATGTGTTTCAAACTGG + Intergenic
1041403813 8:57473909-57473931 CACCCAGCTGTGGCTCAAACAGG - Intergenic
1046358940 8:113125277-113125299 TACACAGATGTGGCATAAACAGG - Intronic
1049016013 8:139920568-139920590 CACACAGCTGGGGCTCCAACAGG + Intronic
1049563214 8:143323757-143323779 CACACAGACATGCCACACACAGG + Intronic
1050890072 9:10813559-10813581 AACTCACAGGTGCCTCAAACAGG - Intergenic
1051746957 9:20304162-20304184 CACACAGGATTGCCTCAAGCTGG + Intergenic
1052131365 9:24852155-24852177 AACACAGTTTTGCCTCACACAGG - Intergenic
1052986218 9:34490101-34490123 CAAACAGATGTGCCTGCAGCTGG + Exonic
1055693880 9:78862053-78862075 CCCAGTGATGTGCCTAAAACAGG + Intergenic
1060475782 9:123985494-123985516 CACACAGAGGTGCCCCAAGTAGG - Intergenic
1061339291 9:129966308-129966330 CATCCAGCTGTTCCTCAAACAGG - Intronic
1062757693 9:138312055-138312077 CACACAGAGCTGCATAAAACAGG - Intergenic
1187493097 X:19771218-19771240 ATCACAGATGTGCTTCAAAGAGG + Intronic
1188233621 X:27698497-27698519 CACACTGAAATGTCTCAAACTGG - Intronic
1188641746 X:32514181-32514203 CCCAGAGATGAGCCTCAACCAGG + Intronic
1188722491 X:33540478-33540500 CACACAGATGTTTTTCAAAATGG + Intergenic
1192249662 X:69401343-69401365 TCCACAGATCTGCCTCAAATGGG + Intergenic
1194401301 X:93440340-93440362 CACCCACATGTGCCACAAGCAGG + Intergenic
1194618370 X:96136284-96136306 TACACAGATGGGACTCAAAGAGG + Intergenic
1196272994 X:113734486-113734508 CACAAAGATACGCCTCAAAAAGG - Intergenic
1199212731 X:145232987-145233009 CACACAGATCTGCATCTCACAGG + Intergenic
1199714661 X:150498176-150498198 TACACAGATTAGCCTAAAACTGG - Intronic
1200928825 Y:8678698-8678720 CACACAGATGTGCCATAAAATGG + Intergenic
1202604597 Y:26628010-26628032 CACACAGAGTTGCCTGAAATGGG + Intergenic