ID: 1163042299

View in Genome Browser
Species Human (GRCh38)
Location 19:14611546-14611568
Sequence ATGCCTTTCTAGAAGTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163042299_1163042306 20 Left 1163042299 19:14611546-14611568 CCATGGAACTTCTAGAAAGGCAT No data
Right 1163042306 19:14611589-14611611 CCTACATAGTGTGGCCAGGCAGG No data
1163042299_1163042301 11 Left 1163042299 19:14611546-14611568 CCATGGAACTTCTAGAAAGGCAT No data
Right 1163042301 19:14611580-14611602 AGCAAGACCCCTACATAGTGTGG No data
1163042299_1163042302 16 Left 1163042299 19:14611546-14611568 CCATGGAACTTCTAGAAAGGCAT No data
Right 1163042302 19:14611585-14611607 GACCCCTACATAGTGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163042299 Original CRISPR ATGCCTTTCTAGAAGTTCCA TGG (reversed) Intergenic
No off target data available for this crispr