ID: 1163050843

View in Genome Browser
Species Human (GRCh38)
Location 19:14682565-14682587
Sequence GGTTGGGATTCTTGAGGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163050843 Original CRISPR GGTTGGGATTCTTGAGGTTT TGG Intronic
902126892 1:14221963-14221985 GCTTGTGATTCGTGATGTTTGGG + Intergenic
903417580 1:23194492-23194514 TCTTGGGATTCCTGTGGTTTAGG - Exonic
903533003 1:24046420-24046442 GCTTGGGAGACTTGAGATTTTGG + Intergenic
904337526 1:29807823-29807845 GGATGGGCTTCCTGAGGTGTAGG - Intergenic
907710354 1:56875201-56875223 GGTTGCCATTCTCTAGGTTTGGG + Intronic
908317125 1:62943754-62943776 GATTGGGAGTCTAGAGTTTTAGG - Intergenic
908870520 1:68605905-68605927 GGTATGGATGCTTGAGGATTGGG - Intergenic
912723050 1:112036034-112036056 TGCTGGGCTTCTTGAAGTTTGGG - Intergenic
915146788 1:153800281-153800303 GGTGTGGATTTTTGAGATTTAGG - Intergenic
917299223 1:173555515-173555537 GGTTGTGATTCTGTAGGTCTAGG + Intronic
919321872 1:196052461-196052483 AGTTGGTATTCATGAGGTTGAGG + Intergenic
919747328 1:201016999-201017021 GCTTGGGATGCTTGGGGTTCAGG + Intronic
920052734 1:203173361-203173383 GGTTGGGAGGCTTGGGTTTTGGG + Intronic
923747068 1:236711174-236711196 GGTTGCAATTCTTTATGTTTAGG + Intronic
924410669 1:243801884-243801906 GGTTGGCCTTCTTCAGTTTTTGG - Intronic
1065546304 10:26825076-26825098 GGGTGGGATTTTTGAAGGTTGGG + Intronic
1066003690 10:31128084-31128106 GGTTGGTCTCCTTGAGGTATAGG + Intergenic
1067838140 10:49654276-49654298 GGCTGGGCTCCTGGAGGTTTGGG - Intronic
1069995231 10:72337746-72337768 GGTTGGGCTTCCTGAGGCTGTGG - Intronic
1072437091 10:95423865-95423887 GGTTTGGATTCTGGAGACTTGGG - Intronic
1073214469 10:101828974-101828996 GGCTTGGATGCTTGAGGTGTGGG - Intronic
1074111120 10:110423441-110423463 GGCTGGGGTTCTTCAGGTTTGGG + Intergenic
1075445917 10:122512767-122512789 GGTGGTGATTTGTGAGGTTTTGG + Intronic
1076504072 10:130960405-130960427 GGTTGTGATTGTTGAGGTGGGGG + Intergenic
1077059252 11:610532-610554 GGGTGGGATGCTTGAGGGCTGGG - Exonic
1078694884 11:13620875-13620897 AGTTAGGATTCTGGAGGTTTGGG + Intergenic
1080593746 11:33748992-33749014 GGTTGGGTTTCTTAATTTTTTGG - Intronic
1081223589 11:40493740-40493762 GGTTGGTATTGCTGAGGATTAGG - Intronic
1082705784 11:56493009-56493031 GGTTGACATTCTTAAGTTTTAGG + Intergenic
1082706954 11:56503860-56503882 GGTTGACATTCTTAAGTTTTAGG + Intergenic
1086321995 11:85659926-85659948 TGTATGGATTCTTGAGGTTTTGG - Intronic
1086788205 11:90999375-90999397 AGTTGGTATTCCTGAGTTTTTGG - Intergenic
1088901055 11:114117560-114117582 GGTTGAGACTCCTGAGGTTTTGG + Intronic
1093312967 12:17614671-17614693 GTTTGTGATTCTTTAGGTCTTGG + Intergenic
1093513469 12:19956774-19956796 AGTGGGGATTTGTGAGGTTTTGG + Intergenic
1094437044 12:30432084-30432106 GGTTTGGCTTCTTGAGATATAGG + Intergenic
1094602050 12:31917656-31917678 TGGTGTGACTCTTGAGGTTTTGG + Intergenic
1097202792 12:57293797-57293819 GGTTGATATTCTTGAAGTTATGG - Intronic
1098574471 12:72025304-72025326 GATTGGGTTGCTGGAGGTTTTGG + Intronic
1099754216 12:86821736-86821758 GGTTTGGATACTTGACATTTAGG + Intronic
1101531417 12:105576751-105576773 ATTTGGGATTCTAGAGATTTTGG - Intergenic
1103175592 12:118860606-118860628 GATTGGGATTCTGCACGTTTGGG + Intergenic
1104209721 12:126677069-126677091 GGTTGAGAGACTTGAGGGTTGGG + Intergenic
1104696984 12:130871597-130871619 GGTGGGGGTTCTTGAGGTCCTGG - Intergenic
1106102776 13:26708803-26708825 AGTTGTGATTTCTGAGGTTTTGG - Intergenic
1106335583 13:28779634-28779656 AGTTGTGATTTCTGAGGTTTTGG + Intergenic
1106377783 13:29205475-29205497 CGTTGTGATTTCTGAGGTTTTGG + Intronic
1107450716 13:40506709-40506731 GGTTAGGATTGTTGATGATTAGG + Intergenic
1108143975 13:47457310-47457332 GGTGGTGATTTTTGAGATTTTGG + Intergenic
1108537383 13:51398670-51398692 AGTTGGCATTGTTGAGTTTTAGG - Intronic
1111334977 13:86808847-86808869 AGTGGGGATTTCTGAGGTTTTGG - Intergenic
1111901735 13:94207731-94207753 GGCTGGGAATCTGGTGGTTTGGG + Intronic
1117228599 14:53691033-53691055 TGTTTGGATTCTTGAGTTTTAGG - Intergenic
1121497339 14:94402950-94402972 AGTTGGGATCCTTGAAGTTCCGG - Intergenic
1122924004 14:104891552-104891574 TCTTGGGATGCTTGAGGTATTGG + Intronic
1124211636 15:27769567-27769589 GGTGGTGATTCCTGAGATTTTGG - Intronic
1126189277 15:45862790-45862812 TCTTGGGATTCTTGAGTCTTGGG - Intergenic
1127310838 15:57750891-57750913 AGTTGGGCTTTTTGGGGTTTTGG + Intronic
1127382334 15:58440874-58440896 GTTGGGAATTCTTGAGATTTTGG + Intronic
1128447948 15:67781392-67781414 GATTGTGAGTCTTGTGGTTTCGG + Intronic
1131891659 15:96978617-96978639 TGTTGGAATCCTTAAGGTTTGGG - Intergenic
1132845197 16:1998005-1998027 GGTTTGCATTCTTGTGCTTTTGG - Exonic
1133496224 16:6320416-6320438 AGTGGCGATTTTTGAGGTTTTGG - Intronic
1134288702 16:12885535-12885557 GGGTGGGATTTTTAAAGTTTTGG - Intergenic
1134415956 16:14043566-14043588 GGCCTAGATTCTTGAGGTTTGGG - Intergenic
1135243970 16:20838430-20838452 TGTTGGTATTGTTGAGGCTTGGG + Intronic
1135290056 16:21228585-21228607 GGTTGAGGTTCTAGAGTTTTAGG + Intergenic
1136242295 16:28951660-28951682 AGCTGGGATTCCTGAGATTTTGG + Intronic
1136990965 16:35151172-35151194 GCTTGGGATTCATGGGGGTTTGG + Intergenic
1137959860 16:52871666-52871688 GATTGGCACTATTGAGGTTTTGG + Intergenic
1138589007 16:57989312-57989334 GGTTGCCATTCATGGGGTTTGGG - Intergenic
1141720841 16:85754411-85754433 GGCTGGGATTCTTCAGGTGCGGG + Intergenic
1143579970 17:7819707-7819729 GGTTGGGATTCTGCAGGTCTGGG + Intronic
1148754565 17:49966024-49966046 GCTTGAGACTCTTGAGGCTTGGG - Intergenic
1148895324 17:50836075-50836097 GGTTGGGATTCATGTCGTTGGGG - Exonic
1150441913 17:65198078-65198100 GGTTGGAATCCTTGAAGTTTTGG + Intronic
1151498617 17:74474568-74474590 AGTTGTGATTGTTGAGGTCTTGG - Exonic
1153172697 18:2334120-2334142 GGTGGGGATTCTAGAGAATTGGG - Intergenic
1153813105 18:8769288-8769310 AGTTGGGATTCTTGCAGTTTGGG + Intronic
1154182864 18:12152258-12152280 GGTTGTGTTTCTGCAGGTTTCGG - Intergenic
1155146134 18:23085135-23085157 AGAAGGGATTATTGAGGTTTGGG - Intergenic
1155487539 18:26362204-26362226 GGTGGGGATAATTGAGGTATGGG - Intronic
1157624483 18:49039415-49039437 GGGAGGGATTCTTGAATTTTTGG + Intergenic
1158643531 18:59222351-59222373 GGTTGGTATTCTTTTGGGTTAGG - Intronic
1161397483 19:4052353-4052375 GGTTGGGGTACTGGAGGTCTTGG - Intronic
1163050821 19:14682430-14682452 GGTTGGGATGCTTGTGATTTTGG + Intronic
1163050843 19:14682565-14682587 GGTTGGGATTCTTGAGGTTTTGG + Intronic
1163493239 19:17629666-17629688 GGTTGGGATCATTGGGGTTGAGG - Intronic
1163628295 19:18403525-18403547 GTCTGGGAGTCTTGGGGTTTGGG + Intergenic
1163628329 19:18403621-18403643 GTCTGGGAGTCTTGGGGTTTGGG + Intergenic
1167449206 19:49557059-49557081 GGTTGGGCTTCTTGTGGGTTGGG - Intronic
1167663504 19:50810350-50810372 GGATGGGATGGTTGTGGTTTGGG + Intergenic
1167875579 19:52409589-52409611 GGTTGGGTTTGTGGAGATTTGGG + Intronic
930280079 2:49359513-49359535 GGTAAGGGTTCTTGAGGTTCTGG - Intergenic
930446122 2:51474489-51474511 GGTGGTGATTTTTGAGATTTTGG - Intergenic
932093625 2:68827996-68828018 TATTGGGATTCCTGAGTTTTAGG + Intergenic
933076435 2:77933468-77933490 GCATGAGATTCTTGTGGTTTTGG - Intergenic
937591706 2:123621132-123621154 GGTGGTGATTTGTGAGGTTTTGG - Intergenic
937828464 2:126393721-126393743 AGTGGTGATTCGTGAGGTTTTGG + Intergenic
938037219 2:128045237-128045259 GGTGGTGATTTGTGAGGTTTTGG + Intergenic
943667860 2:190628972-190628994 GTTTGAGATTCTTGAGATTTTGG - Intergenic
943793599 2:191964467-191964489 GGTTGAGATTCATGAGGGATTGG - Intronic
944671623 2:201999081-201999103 GGGTGTTATTGTTGAGGTTTGGG - Intergenic
947774773 2:232698849-232698871 ATTTGAGACTCTTGAGGTTTGGG + Intronic
1169484478 20:6016159-6016181 AGTTTGCATTTTTGAGGTTTAGG + Intronic
1170373683 20:15677646-15677668 GGTTGGTTTTCCTGAGGGTTGGG - Intronic
1171444318 20:25193026-25193048 GGTTAGGAATCTTGTGGCTTCGG - Intergenic
1174094167 20:48074651-48074673 GGTGGGGATTTGTGAGATTTTGG + Intergenic
1174729893 20:52905517-52905539 GGTTGGGCTTGGTGATGTTTGGG + Intergenic
1178487172 21:33026499-33026521 GGGTGGCATTCTAGAGGCTTCGG - Exonic
1178561849 21:33645287-33645309 GGTTGGGTTTCTTAAAGTGTGGG + Intronic
1182056042 22:27355420-27355442 GGTTGAGAGGCTTGGGGTTTGGG - Intergenic
1182575968 22:31273058-31273080 GGTTGGGATTCTTGAAATCAGGG + Intronic
949199990 3:1365247-1365269 GGGTGAAATTATTGAGGTTTGGG - Intronic
950825622 3:15817045-15817067 GTTTGGGTTTCTTTTGGTTTTGG - Intronic
951593816 3:24295717-24295739 GCTTGGGGTTCCTGAGGCTTGGG + Intronic
953774900 3:45808345-45808367 GGTTCTGATTCTAGAGGTCTGGG - Intergenic
954272782 3:49522644-49522666 GGTTTTGATTCTTAATGTTTTGG + Intronic
955726926 3:61943198-61943220 GGTTGGAGTTCTGGAGTTTTTGG + Intronic
960125150 3:113990531-113990553 GGTGGGGATTTGTGAGGTTTAGG - Intronic
960397818 3:117158765-117158787 GGATGTGATTCATGCGGTTTCGG + Intergenic
961407093 3:126687287-126687309 AGTGGTGATTCATGAGGTTTTGG + Intergenic
966952689 3:184837074-184837096 GCTCGGGATTCTGTAGGTTTGGG - Intronic
971344650 4:25801038-25801060 GGTTAGGATTGTTGAATTTTAGG - Intronic
973103671 4:46303888-46303910 GGTTTGGATTTTTCAGATTTTGG + Intronic
974074097 4:57153167-57153189 GGTTTGGGTTTTGGAGGTTTTGG - Intergenic
975535064 4:75441505-75441527 AGTGGGGATTTCTGAGGTTTTGG - Intergenic
979930606 4:126625255-126625277 GGTTGGGATCCTGGAGACTTCGG + Intergenic
980312222 4:131145863-131145885 AGTGGTGATTTTTGAGGTTTTGG - Intergenic
983331929 4:166340777-166340799 TGTTGGGATTCTTGTGATATTGG + Intergenic
983777937 4:171631642-171631664 GGTGGGGATTTGTGAGATTTTGG + Intergenic
984831167 4:183975667-183975689 GGTTTTGATTTTTGAGTTTTTGG - Intronic
986798834 5:11239414-11239436 GCTTGGGATTCCAGAGGTTTTGG - Intronic
988693887 5:33599452-33599474 GGATGACCTTCTTGAGGTTTAGG - Intronic
988734091 5:34003260-34003282 AGGTGGGATACTTGAGGTTAGGG - Intronic
988892175 5:35629970-35629992 TGTTGGTATTCTTGGGGTATTGG + Intronic
989818631 5:45766261-45766283 GGTAGGGATGCTTGTGTTTTTGG + Intergenic
992145923 5:73847848-73847870 GGTTGGCCTTCTTGACGTCTAGG + Intronic
992161267 5:74005584-74005606 TGTTGGGCTTCTTGAAATTTGGG + Intergenic
992375508 5:76184412-76184434 GATTGGGATTATTGAAGATTAGG + Intronic
992594214 5:78329131-78329153 AGGTGGTTTTCTTGAGGTTTAGG + Intergenic
992788326 5:80190968-80190990 GGTTTGGATTGTTAAAGTTTAGG + Intronic
993606188 5:89993159-89993181 GGCTAGGATGCTGGAGGTTTTGG - Intergenic
994999787 5:107112770-107112792 GGCTGGGATGCTGCAGGTTTGGG - Intergenic
995646755 5:114321307-114321329 GCTTGGGAGTCTTGGAGTTTGGG - Intergenic
995806758 5:116061358-116061380 GGTTCTGATTCCTGAGGTTGGGG - Intergenic
1000907216 5:166977965-166977987 GGTTTAGATTCTTGATGTATTGG + Intergenic
1001226666 5:169950487-169950509 GGTTGAGAGGCTTGAGTTTTGGG + Intronic
1002124418 5:177031596-177031618 GTTTGGGTTCCTTGAGATTTTGG + Intronic
1004695624 6:18030155-18030177 GGTTGGGAAAGTTGAAGTTTTGG - Intergenic
1005530978 6:26705476-26705498 GGTTTGGATACTTGAGTGTTTGG - Intergenic
1005539818 6:26796160-26796182 GGTTTGGATACTTGAGTGTTTGG + Intergenic
1005958207 6:30679262-30679284 GGTTGGGCTGCTGGAGGGTTGGG + Exonic
1007491016 6:42221918-42221940 GGTTGGGTGTCTGGAAGTTTAGG - Intergenic
1009010635 6:57838301-57838323 GGTTTGGATACTTGAGTGTTTGG + Intergenic
1013042690 6:106451625-106451647 CTTTGGGTTTCTTGAGATTTTGG + Intergenic
1013381347 6:109574775-109574797 GGTGGTGATTTCTGAGGTTTTGG + Intronic
1013650991 6:112194255-112194277 GGCTGGGAATCTTAAGGTCTGGG + Intronic
1013830445 6:114266055-114266077 GTTTGGGATCCTTGAGTTTTAGG - Intronic
1016044545 6:139467561-139467583 GGTGGTGATTTTTGAGATTTTGG - Intergenic
1016920504 6:149288542-149288564 AGTTGGGGTTGGTGAGGTTTTGG - Intronic
1018166902 6:161106479-161106501 GATTGGGACTAATGAGGTTTTGG + Intronic
1018357099 6:163029203-163029225 GGTTCTGGTTCTGGAGGTTTAGG - Intronic
1019356787 7:584383-584405 TGTTGGTATTATGGAGGTTTGGG - Intronic
1019894769 7:3975285-3975307 GGTTGGGATTCTTTATTTTCAGG - Intronic
1019986473 7:4659975-4659997 GGTTGGAATTATTGAAATTTAGG - Intergenic
1020471663 7:8543515-8543537 GTCTGGGATTTTTGAGGATTTGG - Intronic
1022661785 7:32374582-32374604 GGTTGGGTGACTTTAGGTTTGGG - Intergenic
1022899577 7:34792178-34792200 GGTTTTGTTTCTTGAGTTTTTGG - Intronic
1024610768 7:51062363-51062385 GCTTGGGATTATGGAGGCTTTGG - Intronic
1029346874 7:99984936-99984958 GGTTGGGACTTTAGAGATTTGGG + Intergenic
1030456435 7:109780394-109780416 TGTTGTGGTTGTTGAGGTTTGGG - Intergenic
1032544115 7:132727693-132727715 GGTTGGAATTCTTGGGTCTTTGG + Exonic
1033285105 7:140034811-140034833 GTATGGGATTCTTGAGGGTGGGG - Intronic
1036763641 8:11531585-11531607 GGTTGATATTCTTGAGTCTTCGG + Intronic
1043536134 8:81206632-81206654 GGTTGGGCTTCTTCAGATTTTGG + Intergenic
1046432944 8:114152472-114152494 GTTTTGGACTCTTCAGGTTTTGG + Intergenic
1048835436 8:138514515-138514537 GGTTCGGAGTCTTTAGGGTTCGG - Intergenic
1051505623 9:17824608-17824630 AGATGGTATTCTAGAGGTTTGGG + Intergenic
1051933908 9:22421278-22421300 GGTTTGTATTTTTGTGGTTTTGG + Intergenic
1052406864 9:28072415-28072437 GGTTTGGATTTTGAAGGTTTTGG - Intronic
1052857343 9:33415527-33415549 GGTTGGGAGTCTGGGGGTTAAGG - Intergenic
1055052594 9:71995281-71995303 GGTTGGGATTCTTTATCTTGTGG - Intergenic
1056588322 9:87944044-87944066 GGTTTGCATTCTTGTGCTTTTGG - Intergenic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057321077 9:94013381-94013403 GGTTGGGATCCCTGAATTTTGGG + Intergenic
1059330776 9:113534094-113534116 GGGTGGCATTCCTGAGGGTTGGG + Intronic
1060136021 9:121154913-121154935 GGTTTGTCTTCTTGTGGTTTGGG + Exonic
1060236789 9:121869770-121869792 GGATGGATTTATTGAGGTTTAGG + Intronic
1062481680 9:136755287-136755309 GGCTGGGGTTCTGGAAGTTTCGG - Exonic
1062527049 9:136982130-136982152 TGTTGGGTATCTTGAGGTGTGGG + Intronic
1186713628 X:12227201-12227223 GGTGGTGATTCTGGAGGTTATGG + Intronic
1186736420 X:12469617-12469639 GGTTGTGATTTTTCAGGTTGAGG + Intronic
1186779223 X:12896445-12896467 AGTTGGAATGCTTGATGTTTAGG + Intergenic
1189076908 X:37925672-37925694 AGTGGTGATTTTTGAGGTTTTGG + Intronic
1191194293 X:57704978-57705000 GTTTCTGATTCTTGAGGTTTAGG + Intergenic
1192220563 X:69195017-69195039 GGCTGGGAGTCTGGAGGTCTGGG - Intergenic
1192313387 X:70034218-70034240 GGTTGGGATTTTTGTGGGATGGG + Intronic
1192313852 X:70037013-70037035 TGTTGGGAAGCTTGGGGTTTAGG - Exonic
1192367047 X:70482623-70482645 GCTTTGGATTCATCAGGTTTGGG + Intronic
1194470289 X:94285543-94285565 AGTTGGGAGGCTTGTGGTTTGGG - Intergenic
1195228592 X:102823383-102823405 GGTGGGGCTTCTTGAGGCCTTGG - Intergenic
1196195686 X:112836623-112836645 TGATGGAATTCTTGAAGTTTTGG + Intronic
1197717635 X:129720777-129720799 GGTGTGGATTCTTGAGGCTGTGG + Intergenic
1198042059 X:132863030-132863052 TGTTTGGATTCTTCAGGATTGGG + Intronic
1201495208 Y:14585370-14585392 GATTGGGATTTTTGATGTTAGGG + Intronic