ID: 1163052100

View in Genome Browser
Species Human (GRCh38)
Location 19:14692191-14692213
Sequence CCAAAGGCAATATGAGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163052096_1163052100 24 Left 1163052096 19:14692144-14692166 CCTGTGGAGGCTTTATTCTAGCT 0: 1
1: 0
2: 1
3: 2
4: 141
Right 1163052100 19:14692191-14692213 CCAAAGGCAATATGAGAACGTGG 0: 1
1: 0
2: 0
3: 7
4: 124
1163052095_1163052100 25 Left 1163052095 19:14692143-14692165 CCCTGTGGAGGCTTTATTCTAGC 0: 1
1: 0
2: 0
3: 10
4: 212
Right 1163052100 19:14692191-14692213 CCAAAGGCAATATGAGAACGTGG 0: 1
1: 0
2: 0
3: 7
4: 124
1163052094_1163052100 26 Left 1163052094 19:14692142-14692164 CCCCTGTGGAGGCTTTATTCTAG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1163052100 19:14692191-14692213 CCAAAGGCAATATGAGAACGTGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163052100 Original CRISPR CCAAAGGCAATATGAGAACG TGG Intronic
902148714 1:14425187-14425209 GCAAATGCAATGTGAGAACATGG - Intergenic
905446510 1:38031237-38031259 CCAGAGGGAACATGAGAAAGAGG + Intergenic
908521572 1:64948610-64948632 CCAAAAGCAATTTCAGAACATGG - Intronic
910631349 1:89358187-89358209 CCAAAGGCAGTAGAAGAAAGAGG - Intergenic
910640917 1:89461036-89461058 CCAAAGGCAGTAGAAGAAAGAGG + Intergenic
910921743 1:92355946-92355968 TCAAATGCAAAAGGAGAACGTGG + Intronic
911730302 1:101285643-101285665 CTAAATGCAATATGAGATCCTGG + Intergenic
912658103 1:111505597-111505619 CAAAAGGCAATCTGGGAAAGAGG + Intronic
913431661 1:118800846-118800868 TGAAAGGGAATATGAGAAGGGGG + Intergenic
914373625 1:147052325-147052347 CCAAAGGCCAGATGAAAATGAGG + Intergenic
917100056 1:171436104-171436126 AATAAGGCAATATGGGAACGAGG - Intergenic
921219447 1:212962725-212962747 CCTAAGGCAATATTAGGAGGAGG + Intronic
922356860 1:224784545-224784567 CCAAAGGAATTTTGAGAAGGAGG + Intergenic
924013480 1:239693383-239693405 GCAAAGACCATATGAGAAGGTGG + Intronic
924865469 1:247974828-247974850 CCAATAGCAAAATGAGAACAAGG - Intronic
1072556264 10:96516204-96516226 GGAAAGGCAAAATGAGAAAGTGG - Intergenic
1074051135 10:109882365-109882387 CCAAAGACAATACCAGAACTGGG + Intronic
1074699684 10:116082319-116082341 CCAAAGGCAATAAAAGGACTAGG - Intronic
1081709880 11:45209772-45209794 TCAAATGCAAAATGAAAACGTGG - Intronic
1088291341 11:108241569-108241591 CAAATGGCAATATGAAAAGGTGG - Intronic
1089841362 11:121420911-121420933 CCAAAGGCAATATGGAAAAATGG + Intergenic
1090943753 11:131411425-131411447 TCAAAGGTAAGATGAGAAAGAGG + Intronic
1093625309 12:21339681-21339703 CCAAAGGCTATATCAGAAAAGGG + Intronic
1100464707 12:94834729-94834751 GCAAAGCCAATATGAGATCATGG + Intergenic
1100957313 12:99923337-99923359 GCAAAGGCATTCTGAGAACCAGG + Intronic
1101035732 12:100704014-100704036 CCAAAGTCAAGTTGAGAAGGAGG + Intergenic
1102427382 12:112854829-112854851 CCAAAAGCAATAGGATAAAGTGG - Intronic
1103668160 12:122587949-122587971 ACAAAGACAATAGGAAAACGTGG - Intronic
1104070790 12:125343530-125343552 CCTCAGGTAATATGAGAAAGTGG + Intronic
1106052354 13:26203595-26203617 ATAAAGGCAATATTAGAACTGGG + Intronic
1107310059 13:39067342-39067364 GAAAAGGAAATATGAGAATGTGG + Intergenic
1109910433 13:68904403-68904425 CAAAAGGCAAAATGAGAGTGAGG - Intergenic
1114955147 14:27808088-27808110 GAAAAGGCAATGTGAGAACACGG - Intergenic
1115956764 14:38789828-38789850 CCAAAGGCATTATGCTAACATGG - Intergenic
1118563379 14:67112126-67112148 TCAAAAGCAAGATGAGAAAGAGG + Intronic
1122057632 14:99115488-99115510 CCCAGAGCAAAATGAGAACGCGG + Intergenic
1122324701 14:100875245-100875267 CCAATGGCAACATGAGCAGGGGG + Intergenic
1124857937 15:33409033-33409055 CCTAATGCATTATGAGAAAGCGG - Intronic
1128426793 15:67549946-67549968 CTACAGGAAATATGAGAACCTGG - Intronic
1129230705 15:74195706-74195728 GCAAGGGCAAAATGAGAAGGTGG + Intronic
1129788044 15:78322234-78322256 CCAAACGCAAGGTGAAAACGTGG + Intergenic
1131864748 15:96695755-96695777 CCAAATGAAATATGAGAACAAGG + Intergenic
1132792581 16:1700343-1700365 CCAAGGGCAGCATGAGAACTGGG - Exonic
1134044772 16:11093122-11093144 CCAAAAGCACCATGAGAAGGGGG - Intronic
1138825616 16:60315713-60315735 CCAAAGTCAAAATGGGAACAGGG - Intergenic
1140897124 16:79334566-79334588 CCCAATGCAAAATGAAAACGAGG + Intergenic
1140949778 16:79805856-79805878 CCAATGGCCATGTGAGAACCAGG - Intergenic
1142954335 17:3511032-3511054 CCAAAGGCACTATCTGAACCTGG + Intronic
1144364210 17:14526367-14526389 CCAAAGGCAGTTTGGGAAAGGGG - Intergenic
1149205138 17:54235103-54235125 TCAAAGGTATTATGAGAACAGGG + Intergenic
1150716292 17:67575240-67575262 CCAAAGCAGACATGAGAACGTGG - Intronic
1151171622 17:72251269-72251291 CCACAGGTAATATGAGATTGAGG - Intergenic
1155341635 18:24819451-24819473 CCTGAGGCCATATGAGAAGGGGG - Intergenic
1156787770 18:40936482-40936504 CCTAAGGCAATAATAGAACTGGG + Intergenic
1158120339 18:54041924-54041946 CCAAAGAAAATATGATACCGTGG - Intergenic
1159147817 18:64477630-64477652 GCAAACGCTATATGAGAATGAGG + Intergenic
1159680189 18:71340517-71340539 CCATTAGCAATATGATAACGTGG - Intergenic
1163052100 19:14692191-14692213 CCAAAGGCAATATGAGAACGTGG + Intronic
1166288137 19:41845040-41845062 CCAAAGACACTGTGAGAAAGTGG - Exonic
928335816 2:30397091-30397113 GCCAAGCCAATATGAGAACATGG - Intergenic
930247345 2:48997936-48997958 CAGAAGGCAATTAGAGAACGAGG - Intronic
933576821 2:84079111-84079133 CCAAAGGCAATTTTAAAAAGGGG + Intergenic
934617893 2:95786336-95786358 TCAAAGACAATTTGAGAACAGGG - Intergenic
934643000 2:96038223-96038245 TCAAAGACAATTTGAGAACAGGG + Intronic
937545798 2:123018772-123018794 CCTAATGCAGTATGAGAAAGAGG - Intergenic
938169409 2:129061555-129061577 TCACAGGCACAATGAGAACGTGG + Intergenic
939319055 2:140592040-140592062 TCAAAGGAAACATGAGAAAGTGG - Intronic
939363129 2:141199522-141199544 GCAAAGACAATATTAGAACAGGG - Intronic
941177508 2:162216885-162216907 CTCAAGGAAATATGAGAATGTGG + Intronic
941744801 2:169075620-169075642 CCAAATGCAATATGTGATCCTGG - Intronic
942228530 2:173837924-173837946 CCAAAGTAAAAATGAGAAGGTGG + Intergenic
943039960 2:182792706-182792728 CCAAAGGAAAGATGACAAGGAGG - Exonic
945076189 2:206042392-206042414 CCAAAAGCAATATTAAAAGGTGG + Intronic
949810780 3:8003957-8003979 AGAAAGGTAATATGAGAACGGGG + Intergenic
956006929 3:64789779-64789801 GCAAAGGCTATATGAGAGCTAGG - Intergenic
957439710 3:80228616-80228638 CAAAAAGAAATATGAGAACTGGG + Intergenic
957996843 3:87701043-87701065 CCAAAAACAATATGAGAAAGTGG - Intergenic
958585897 3:96087216-96087238 CCAAAGGAAATATGTAAACATGG + Intergenic
960172820 3:114482358-114482380 CCAAATGCAATATGAAAGTGAGG - Intronic
963190322 3:142463713-142463735 TCAAAAGCAATATGAAAAGGAGG - Intronic
963831397 3:150013238-150013260 CCAAAGGCAGGATGAGAAATAGG + Intronic
965612206 3:170556334-170556356 CCAGAGGCAATATGGCAAAGTGG + Intronic
966179358 3:177173631-177173653 CTAAATGCAACATGAGAACCTGG + Intronic
966937655 3:184723594-184723616 CCCAAGGAAATATGAGAATTTGG - Intergenic
973205299 4:47553166-47553188 CCAAAGTCAATAGAAGAAAGTGG - Intronic
979682901 4:123481121-123481143 CAACAGGCAACATGAGAACAAGG - Intergenic
982445761 4:155489165-155489187 ACAAAGGGAAAATGAGAACAAGG - Intergenic
983081120 4:163386836-163386858 CCAAATGCAAAATGAAAACATGG + Intergenic
984140757 4:176001871-176001893 CCAAAGAGAACATGAAAACGTGG + Intronic
987950279 5:24665591-24665613 CCCAATGCAAAATGAAAACGTGG - Intergenic
990780814 5:59360521-59360543 CAAAAGGCAGTTTGATAACGGGG + Intronic
994108417 5:95972737-95972759 CCAAAAGCACTATCAGAACAAGG - Intergenic
994232786 5:97328055-97328077 CAAAAGGCAAGGTGAGAAGGGGG - Intergenic
997358480 5:133279572-133279594 CCAAGGGGAATGTGAGCACGGGG + Intronic
997747547 5:136312234-136312256 CCAAAGGCGTTATGAGGACATGG - Intronic
999823361 5:155250601-155250623 CCAATGGCAATATGAAACCTGGG + Intergenic
1002636753 5:180612467-180612489 CCAAAGGCCATAGTAGAACAGGG + Intronic
1002654076 5:180728535-180728557 CTAAAGCCAATATGAGAAATAGG + Intergenic
1003028085 6:2576516-2576538 CCAATGACACTATGAGAATGGGG + Intergenic
1003140911 6:3470468-3470490 CCAAATGCAATATCAGGAAGAGG - Intergenic
1003182464 6:3803876-3803898 CTAAAGGCAATTTCAGAAGGAGG + Intergenic
1005661291 6:28001690-28001712 CCAAAGGCCATCTGTGAACTTGG + Intergenic
1005696368 6:28356116-28356138 CCAAAGGCAATATGTGGACTCGG - Exonic
1007963431 6:45982082-45982104 GCAAAGACAATATGAGAAACGGG + Intronic
1010256414 6:73763434-73763456 TCAAAGTCAATATGGGAATGAGG + Intronic
1011735886 6:90310414-90310436 TCCAAGGCACTATGAGAAAGAGG + Intergenic
1012396669 6:98805954-98805976 CCAAAGGCAATTGGACAATGAGG - Intergenic
1013031354 6:106336250-106336272 CCCAGGGCAAAATGAAAACGAGG + Intergenic
1013384683 6:109614436-109614458 TCAAAGGCAATATGAAAAAATGG - Exonic
1013624853 6:111926865-111926887 CCAAAGGTAATGTGAGGACTGGG - Intergenic
1017506527 6:155073578-155073600 CCAAAGCCACTATGAGAAGCAGG - Intronic
1022147040 7:27554710-27554732 CAAAAGGCAAGATGATAACCCGG + Intronic
1023796751 7:43799860-43799882 CCAAAGGCAAGATGAGATCAGGG - Intronic
1031515301 7:122692001-122692023 CCAAAGGCCATATGCGGACTTGG - Intronic
1039896833 8:41722806-41722828 CCACAGGCAATATGCAAACTAGG - Intronic
1040535701 8:48307719-48307741 CCAAAGGCAAAATGAGCAAGAGG - Intergenic
1042755292 8:72203776-72203798 CCAAAGGCCACATCAGAACAGGG - Intergenic
1046510768 8:115199543-115199565 CCGAAGGCAATTTGAGGATGAGG + Intergenic
1047925515 8:129679088-129679110 GTAAAGGCAAGATGAGAACATGG - Intergenic
1048283918 8:133126856-133126878 CCAAAGGAAATTAGGGAACGGGG - Intronic
1048859975 8:138717064-138717086 CAAAAGACTATATGAGAAAGTGG - Intronic
1049003455 8:139840441-139840463 GCAAAGGCACCATGTGAACGGGG + Intronic
1052308102 9:27033867-27033889 CCAAAAGCAGTATGTGAAGGTGG + Intronic
1055433412 9:76268194-76268216 TCAAAGGCAATCTGAGAGCTAGG - Intronic
1055878021 9:80966367-80966389 CCAAAGGTAAAAAGAGAAAGAGG + Intergenic
1056043040 9:82687461-82687483 CCAAAGGGACCATGAGAAGGAGG - Intergenic
1059908067 9:119010500-119010522 CCAAAGGCAATAGGATTAGGAGG - Intergenic
1061902257 9:133678931-133678953 ACAAGGGCAAGATGAGAACCTGG + Intronic
1189596929 X:42577580-42577602 CTAAAGGAAATATGAGAATGAGG - Intergenic
1189890475 X:45596909-45596931 TCAAATGCAATATGAGATCCTGG - Intergenic
1194472345 X:94312414-94312436 CCAAAGCAAATATGTGAATGAGG + Intergenic
1198266087 X:135010241-135010263 CCAAAGGTACTGTGAGAAAGGGG + Intergenic