ID: 1163054599

View in Genome Browser
Species Human (GRCh38)
Location 19:14708849-14708871
Sequence GTGAAGATATAGAGAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1748
Summary {0: 1, 1: 2, 2: 44, 3: 329, 4: 1372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163054599_1163054604 30 Left 1163054599 19:14708849-14708871 CCATCTTCTCTCTATATCTTCAC 0: 1
1: 2
2: 44
3: 329
4: 1372
Right 1163054604 19:14708902-14708924 AAATGTCGTCTTCTTGTGATAGG 0: 1
1: 0
2: 0
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163054599 Original CRISPR GTGAAGATATAGAGAGAAGA TGG (reversed) Intronic
900086920 1:903105-903127 ATGAGGATTTAGGGAGAAGACGG - Intergenic
900710114 1:4108214-4108236 GAGAAGATGCAGGGAGAAGACGG - Intergenic
900773679 1:4565550-4565572 GTGAGGACCCAGAGAGAAGATGG - Intergenic
900826257 1:4929578-4929600 GTGAGGACACAGGGAGAAGATGG - Intergenic
900837039 1:5012990-5013012 GTGAGGACACAGTGAGAAGAAGG + Intergenic
900874167 1:5329785-5329807 GTGAGGATACAGTGAGAAGGTGG - Intergenic
901260954 1:7870292-7870314 GTGAGGACACAGGGAGAAGAAGG + Intergenic
901315893 1:8308035-8308057 GTGAGGACACACAGAGAAGATGG - Intergenic
901327678 1:8378593-8378615 GGGAAGACACAGGGAGAAGATGG + Intronic
901416334 1:9119413-9119435 GTGAAGACGCAGGGAGAAGATGG + Intronic
901692633 1:10983432-10983454 GTGAGGACACAGGGAGAAGATGG + Intergenic
902089242 1:13890152-13890174 GTGAGGACATAGAGAGAAGCTGG - Intergenic
902096171 1:13947761-13947783 GTGAAGATACAGGGAGAAGACGG - Intergenic
902987645 1:20164867-20164889 CCAAAGACATAGAGAGAAGAGGG - Intronic
903075235 1:20759522-20759544 GTGAGGATACAATGAGAAGAAGG + Intronic
903441525 1:23391529-23391551 GTGAGGTTACAGTGAGAAGATGG + Intronic
903577061 1:24345573-24345595 GTGCAGATTCAGAGAGAAGAGGG + Intronic
904610228 1:31721784-31721806 GTGAAAAAAAAGAGAAAAGAGGG - Intergenic
904941772 1:34168692-34168714 GTGAGGACACAGGGAGAAGAAGG - Intronic
905017677 1:34788706-34788728 GTGAGGATACAAAGAGAAAATGG + Intronic
905115537 1:35636105-35636127 GTGAAGACACAGGGAGAAGATGG + Intronic
905250562 1:36645621-36645643 GTAAAGACACAGGGAGAAGATGG + Intergenic
905765095 1:40593856-40593878 GAGAAGAAAAAGAAAGAAGAGGG - Intergenic
905949827 1:41940813-41940835 GAGAGGATAAAGAGAGAAGCTGG + Intronic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
906823297 1:48951611-48951633 GTGAGGATATAACAAGAAGATGG + Intronic
907458380 1:54590512-54590534 GGGAAGGTAGAGAGAGAAGGAGG + Intronic
907764143 1:57391816-57391838 GAGAGGAGAGAGAGAGAAGAGGG + Intronic
907788379 1:57636207-57636229 GTGAAGCTACAGTGAGAAGGCGG + Intronic
907928341 1:58975559-58975581 GTGAGGATACAGCAAGAAGATGG - Intergenic
907966752 1:59338781-59338803 GTAAAGTTATATATAGAAGAAGG - Intronic
908053879 1:60261847-60261869 GTGAAGACACAGCAAGAAGATGG - Intergenic
908125329 1:61024692-61024714 GTGAAGACATAGCAAGAAGAAGG - Intronic
908168653 1:61483556-61483578 ATGAAGATGTAGCGAGAAGGTGG - Intergenic
908564719 1:65342425-65342447 GGGAGGATACAGGGAGAAGATGG + Intronic
908869589 1:68593628-68593650 GTGAAGTTAGAGTAAGAAGATGG + Intergenic
908973624 1:69868839-69868861 GTAAAGACATGGGGAGAAGATGG - Intronic
909096364 1:71293180-71293202 GAGAAGAGAGAGAAAGAAGAGGG - Intergenic
909540785 1:76789229-76789251 GAGAAGAGAAAGAGGGAAGATGG + Intergenic
909619885 1:77655442-77655464 GTGAAGACACAGTGAGAAGATGG + Intronic
909884619 1:80925368-80925390 GTGGAGATCTAGAGAGAAGATGG + Intergenic
910111633 1:83689774-83689796 GTGAGGACATAGCAAGAAGATGG + Intergenic
910132205 1:83921593-83921615 CTGAAGATACAGAGACAAAATGG + Intronic
911145368 1:94547249-94547271 GTGAGGACATAGCAAGAAGACGG + Intergenic
911381907 1:97125749-97125771 GTGAAGTTATAGTGAAAAGATGG + Intronic
911461975 1:98202759-98202781 GTGAGGACACAGTGAGAAGATGG + Intergenic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
911737503 1:101353871-101353893 AAGGAGAGATAGAGAGAAGAAGG - Intergenic
913284927 1:117217507-117217529 GAAGAGATATAAAGAGAAGATGG - Intergenic
913425934 1:118729517-118729539 GCGAAGTTAGAGTGAGAAGATGG + Intergenic
914949209 1:152097220-152097242 GTGAGGGTACAGGGAGAAGATGG - Intergenic
914949969 1:152104652-152104674 GTTAAGATACAGGGAGAAGATGG - Intergenic
915017015 1:152743803-152743825 GTGAAAAGAGAGACAGAAGAAGG + Intronic
915762714 1:158331088-158331110 GTGAAGATAAAGAGAGAAGCAGG + Intronic
915879333 1:159649764-159649786 GTGAAGACACAGGGAAAAGATGG - Intergenic
915926127 1:160020969-160020991 GTGAAGACAAAAACAGAAGATGG + Intergenic
916016000 1:160750402-160750424 CTGAAGAGAGAGAGACAAGAAGG + Exonic
916023175 1:160812175-160812197 GTGAAGACATGGAGAGAAAGTGG - Intronic
916086142 1:161270927-161270949 GTGAGGATATAGCAAAAAGATGG + Intronic
916158124 1:161878469-161878491 GAGAGTATATAGAGAGAGGAGGG + Intronic
916350809 1:163847846-163847868 GTGAAGATAGAAGAAGAAGATGG - Intergenic
916441086 1:164825293-164825315 GTGATAAAGTAGAGAGAAGAGGG - Intronic
916689424 1:167176396-167176418 GTGAAGATAGAACAAGAAGATGG - Intergenic
916741561 1:167651011-167651033 GTGAAGACACAGGGAGAAGATGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
916875469 1:168964020-168964042 GTGCAGAGAAAGAGAGAAAATGG - Intergenic
916930005 1:169567127-169567149 GTGAGGATACAAGGAGAAGATGG - Intronic
917103222 1:171466620-171466642 GTGAGGATACAGCAAGAAGACGG + Intergenic
917225373 1:172775943-172775965 GTGAAGATAGAGAAACAAGATGG + Intergenic
917426589 1:174920768-174920790 GTGAGGATACAGGGAGAAGATGG + Intronic
917472226 1:175335497-175335519 GGGAAGAGACAGAGAAAAGAGGG + Intronic
917737192 1:177932196-177932218 GTGAAGACGTGGAAAGAAGATGG + Intronic
917835248 1:178936846-178936868 GTGAGGATACAGTGAGAAGGTGG - Intergenic
918373704 1:183887203-183887225 ATAAAGAGAAAGAGAGAAGAAGG - Intronic
918448677 1:184639011-184639033 GTGAAGACACAGTGAGAAGATGG + Intergenic
918923308 1:190744768-190744790 GTGAAGACACAGGGAGAAGATGG - Intergenic
919413610 1:197278267-197278289 GTGAGGACATATGGAGAAGATGG + Intronic
919468039 1:197945811-197945833 GTGAGGAGAAAGAGACAAGAAGG + Intergenic
919504362 1:198379556-198379578 CTGAGGATATAAAGTGAAGAAGG + Intergenic
919590022 1:199490157-199490179 GTGAAGACACAGCGAGAAGATGG - Intergenic
919846094 1:201643143-201643165 GGGAAGAAAGAGAGAGAGGAAGG - Intronic
920161616 1:204002835-204002857 GTGAGGACATAGTGAGAAGGTGG + Intergenic
920253756 1:204640212-204640234 GTGAGGACACAGTGAGAAGATGG - Intronic
920396131 1:205647495-205647517 GTGAGGACACAGCGAGAAGATGG - Intergenic
920655447 1:207870876-207870898 GGGAGGATACAGTGAGAAGATGG + Intergenic
920834362 1:209495156-209495178 GTGACGTTACAGTGAGAAGAAGG - Intergenic
921214673 1:212926967-212926989 GTGAGGACATAGTGAGAAGGTGG - Intergenic
921301359 1:213754236-213754258 GTGAGGACGTAGAGAGAAGACGG - Intergenic
921350894 1:214233355-214233377 GTGATGACATAGCGAGAAGGTGG + Intergenic
921367704 1:214389442-214389464 GCCAAAATATAGACAGAAGAGGG + Intronic
921458717 1:215403760-215403782 GTGAAGATACAGGAAGAAGATGG - Intergenic
921770250 1:219028243-219028265 GTGAACACACAGGGAGAAGATGG - Intergenic
921830243 1:219720187-219720209 ATTAAGTTATAAAGAGAAGAGGG + Intronic
921964711 1:221076036-221076058 GCGAAGTTATGAAGAGAAGAAGG - Intergenic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
922285621 1:224168226-224168248 GTGAGGTTATAGCCAGAAGACGG + Intergenic
922348565 1:224717289-224717311 GTGAGGATACAGTGAGAAGGTGG - Intronic
922411509 1:225380423-225380445 GTGAAAATACTGAGATAAGATGG + Intronic
922476461 1:225910206-225910228 GGGAGGATAGAGAGAGAAGCTGG - Intronic
922818465 1:228468140-228468162 GTGAGGACACAGGGAGAAGATGG + Intergenic
922930792 1:229387730-229387752 GTGAGGATACAATGAGAAGATGG - Intergenic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923064199 1:230503268-230503290 GTGAAGACACAGGGAGAAGACGG + Intergenic
923071587 1:230570111-230570133 GTGAGGATATGGAGAGAAATTGG - Intergenic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923283309 1:232465893-232465915 GTGAAGACACAAGGAGAAGACGG + Intronic
923436291 1:233970726-233970748 ATGAAGAGACAGAGAGAAGACGG + Intronic
923744196 1:236686033-236686055 GAGATGAGAGAGAGAGAAGAGGG + Intergenic
924047540 1:240047285-240047307 GTGAAGACACAGTGAGAAGATGG + Intronic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924287141 1:242499427-242499449 ATGAAGATATAGATAGAGAAAGG - Intronic
924548038 1:245048673-245048695 GTGCATATATAGAGAGAAACGGG - Intronic
1062892356 10:1073754-1073776 GTGAGGACACAGGGAGAAGATGG - Intronic
1063251743 10:4281688-4281710 GTGAAGTTAAAGACAAAAGAAGG - Intergenic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1063802229 10:9593380-9593402 GAGAAGAAATAGCGAGAAGAGGG + Intergenic
1064069376 10:12213163-12213185 GTGAAGATACTTAGAAAAGATGG - Intronic
1064312776 10:14226583-14226605 GTAAAGACACAGGGAGAAGATGG - Intronic
1064490383 10:15849729-15849751 TTGAAGATAAAGAGAGGAGATGG - Intronic
1064574904 10:16734949-16734971 GTGAAGACACAGGGAGAAAAGGG + Intronic
1064973394 10:21088974-21088996 GTGAAGCTCTAGAGGGGAGATGG + Intronic
1064980104 10:21157913-21157935 GTGAAGACACAGGGAGAAGACGG + Intronic
1065236150 10:23654621-23654643 GGGAAGATGTGGAGAGAATACGG + Intergenic
1065394013 10:25214782-25214804 GTGAAGACACAAGGAGAAGATGG + Intronic
1065402496 10:25321904-25321926 GTGAGGATATTTAGAGAATATGG + Intronic
1065436595 10:25709315-25709337 GTGATGACACAGGGAGAAGACGG - Intergenic
1065492502 10:26296126-26296148 GTGAGGATACAGGGAGAAAAAGG - Intronic
1065545233 10:26812724-26812746 GTGAAGACGCAAAGAGAAGATGG - Intronic
1065772071 10:29086987-29087009 GTGAACACACAGAGAGAAGAAGG - Intergenic
1065871381 10:29959150-29959172 GTGAAGATACAGCAAGAAAACGG + Intergenic
1065884186 10:30062417-30062439 GAAAAGATGGAGAGAGAAGATGG + Intronic
1066592984 10:37016115-37016137 GTGAAGACAGAGAGAGAAAGGGG - Intergenic
1066646735 10:37618134-37618156 ATGTAGATATACAGAGCAGAGGG - Intergenic
1067244056 10:44521511-44521533 GTGAAGACATAGGGAGAAGGTGG + Intergenic
1067278027 10:44851683-44851705 TTGAAGACACAGGGAGAAGATGG - Intergenic
1067352627 10:45490432-45490454 GTGAACACAGAGGGAGAAGATGG + Intronic
1067380803 10:45771416-45771438 GAGAAGAAATAGGGAGTAGAGGG + Intronic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067535406 10:47106062-47106084 GTGAAAAAAGAGAGAGAAGGGGG - Intergenic
1067543393 10:47174279-47174301 GTGAGGACATAGAGAGAGGGTGG + Intergenic
1067578499 10:47423481-47423503 GTAAAGGAATAGAGAGAAGGGGG + Intergenic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1067769104 10:49110726-49110748 GTGAAGACACAGGGAGAAGGTGG + Intronic
1067795423 10:49317927-49317949 GTGAAGACACAGGGAGAAGACGG + Intronic
1067906950 10:50302041-50302063 TTGAAGATAGAGAGAAAAAATGG + Intergenic
1068640167 10:59395539-59395561 TTGAAGATATAAAGACAACATGG - Intergenic
1068939079 10:62663257-62663279 GTGAAGATACAGACAGCAGCAGG + Intronic
1069093815 10:64234041-64234063 GTGAAGATACAGGGAGAAGATGG + Intergenic
1069211288 10:65762683-65762705 CTGAAGATATTAAGAAAAGAAGG - Intergenic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069596123 10:69672022-69672044 GTGAAGGCACAGTGAGAAGACGG - Intergenic
1070548784 10:77474414-77474436 GTGAAGATACAGGGAAAACAAGG + Intronic
1070555453 10:77524174-77524196 GTGAAGTTATTGTGAGAATAGGG + Intronic
1071284402 10:84131359-84131381 GTGAAGACACAGTGAGAAGTTGG - Intergenic
1071337679 10:84614171-84614193 GCGAAGATACAGGGTGAAGACGG - Intergenic
1071409980 10:85379629-85379651 GTGAAGATGTATAGAGGAGATGG - Intergenic
1071415894 10:85441126-85441148 GTGAAGACACAGGGAGAAGGTGG + Intergenic
1071770613 10:88725769-88725791 CTGCAGATATACAAAGAAGAGGG - Intronic
1071969709 10:90891319-90891341 GTGAAGACATAGAGACAAACAGG - Intronic
1072001568 10:91200396-91200418 GTGAGGGTATAGAAAGAACAGGG + Intronic
1072260488 10:93665863-93665885 GTGAAGACACAGGGAGAAGATGG - Exonic
1072512248 10:96139464-96139486 GTGAGGACACAGTGAGAAGATGG + Intronic
1072771339 10:98141771-98141793 GTGAACATCTAGAGAGAACCAGG + Intronic
1073081261 10:100862501-100862523 GAGAAGCTTTAGAGAGAAGGGGG - Intergenic
1073421743 10:103429539-103429561 GTGAAGACATGGGGAGAAGATGG - Intronic
1073615556 10:104991401-104991423 ATGAAGATGCAGAGAGAAGCTGG - Intronic
1073722460 10:106188587-106188609 GTGAGGACACAGTGAGAAGATGG + Intergenic
1073806754 10:107106878-107106900 GTGAGGATACAAAGAGAAAATGG + Intronic
1073814976 10:107196495-107196517 GTGAAGCTACAGTGAGAAGGTGG + Intergenic
1074005618 10:109420141-109420163 GTGGAGACACAGTGAGAAGAAGG - Intergenic
1074010370 10:109472730-109472752 GTAAAGATTTAGAGAGGGGAGGG + Intergenic
1074031333 10:109691607-109691629 GTTAAGATATAGAAAGAGGAAGG + Intergenic
1074033175 10:109709546-109709568 GAGAAGATGGAGAGAGACGAGGG + Intergenic
1074236864 10:111593501-111593523 GTGAAGACACAGTGAGAAGGTGG + Intergenic
1074620071 10:115109439-115109461 GTGAAGAGAGAAAGAGAGGAGGG + Intronic
1074670457 10:115784742-115784764 GTGAAAACATACAGGGAAGAAGG - Intronic
1074735337 10:116425429-116425451 GTGTAGATATATATAGAAAAAGG + Intergenic
1075678257 10:124312815-124312837 GTGAAGACACAGGGAGAAGATGG - Intergenic
1076201748 10:128564427-128564449 GTGAAGACACAGGGACAAGATGG + Intergenic
1076556639 10:131327129-131327151 GTGAAGATAAAGGGAGAAGATGG - Intergenic
1076917002 10:133428330-133428352 GTGAAGACATAGGGAGAAGATGG + Intergenic
1076937101 10:133573135-133573157 GTGAAGACATAGGGAGAAGATGG + Intergenic
1077548965 11:3191173-3191195 GTGAAAAGATAGAGAGAGGGCGG + Intergenic
1078159906 11:8831449-8831471 GAGAAGATCTGGAGAGACGATGG - Intronic
1078371168 11:10746691-10746713 GGGAAGCCACAGAGAGAAGACGG + Intergenic
1078695977 11:13632153-13632175 GGGAAGATATGTAGAGAAGGAGG + Intergenic
1078747736 11:14131472-14131494 GTAAAGAAATAGATAGAAAAGGG - Intronic
1078910327 11:15725090-15725112 GTGAGGATATAGCAAGAAGGTGG - Intergenic
1079016242 11:16871183-16871205 CTAAAGAGAAAGAGAGAAGATGG + Intronic
1079020948 11:16908378-16908400 GTGAGGATACAGTGAGAAGGTGG + Intronic
1079056703 11:17212345-17212367 GAGAAAAGATAGAGGGAAGATGG + Intronic
1079072242 11:17357285-17357307 GTGAAGACACAGGGAGAAGATGG - Intronic
1079284109 11:19113940-19113962 GTGAAGACACAGGGAGAAGATGG + Intergenic
1079592905 11:22202612-22202634 GTGAAGACACAGTAAGAAGATGG - Intronic
1079816087 11:25060307-25060329 GTGAAATTACAGTGAGAAGATGG - Intronic
1079897983 11:26146747-26146769 GTGATGATATAGAATGAAGTAGG - Intergenic
1079907142 11:26262776-26262798 GTGAGGATACAATGAGAAGATGG + Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1079960177 11:26914118-26914140 GTGAAGGTGCAGGGAGAAGATGG + Intergenic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1080252140 11:30245448-30245470 GTGAAGACACAGAGAGAAGGTGG - Intergenic
1080688265 11:34533987-34534009 GTGAAGACACAGGGAGAAGATGG + Intergenic
1080694323 11:34588129-34588151 GTGAAGATGTAGACAAATGACGG + Intergenic
1080797232 11:35576049-35576071 GTGAAGACACAGCGAGAAGATGG - Intergenic
1080825957 11:35849643-35849665 GTGAAGATGCAGGGAGAAGATGG - Intergenic
1080881131 11:36321849-36321871 GTGAAGACACAGGGAGAAGATGG - Intronic
1080939445 11:36898831-36898853 AAGAAGATACAGAGAGAAAAGGG + Intergenic
1081164747 11:39793788-39793810 GTGAAGACACAAAGAGAAGAAGG + Intergenic
1081183026 11:40007248-40007270 ATGAAGAGACAGAGAGAAGATGG - Intergenic
1081296336 11:41394295-41394317 AGGAAGGTATAGAGAGAAGCTGG - Intronic
1081373892 11:42337025-42337047 GTGGGGATACAGTGAGAAGATGG + Intergenic
1081417739 11:42835990-42836012 GTGAAGACATAGAGGAAATATGG - Intergenic
1081686050 11:45043683-45043705 GTGAGGTCATAGTGAGAAGATGG + Intergenic
1081803977 11:45879886-45879908 GTGAAGACATAGGGAGAAGATGG - Intronic
1082011305 11:47451310-47451332 GTGAAGACACAGGGAGAAGATGG + Intergenic
1082114309 11:48311575-48311597 GTGAGGACACAGAAAGAAGACGG - Intergenic
1082230599 11:49761250-49761272 GTGAAGATGCAAGGAGAAGATGG - Intergenic
1082682198 11:56188505-56188527 GTGAACATACATAAAGAAGAAGG + Intergenic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1083396195 11:62393892-62393914 GTGAGGACACAGTGAGAAGATGG - Intergenic
1083546411 11:63552235-63552257 GTGAGGATCTAGTGAGAAGGTGG - Intergenic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084113990 11:67031223-67031245 GGGAAGATTTAGAGAGCTGATGG + Intronic
1084547880 11:69823417-69823439 GTGAGGACACAGGGAGAAGATGG - Intergenic
1084721680 11:70910018-70910040 GTGAGGACACAGAGAGAAGGCGG - Intronic
1084732260 11:71081162-71081184 GTGAAGATGCAGAGAAAAGGCGG + Intronic
1084747502 11:71182551-71182573 GTGAAGACACAGGGAGAAGATGG - Intronic
1084998035 11:73002690-73002712 GAGAAGGGATAAAGAGAAGAGGG - Intronic
1085026815 11:73241088-73241110 GTGAGGATATAATGAGAAGTTGG + Intergenic
1085074569 11:73579042-73579064 GTGAGGATACAGTGAGAAGAGGG - Intronic
1085185815 11:74575313-74575335 GTGAAGACATAGGGAGAAGATGG - Intronic
1085196043 11:74672392-74672414 GTGAGGACACAGGGAGAAGATGG + Intergenic
1085337301 11:75705991-75706013 GGGCAAATAAAGAGAGAAGAAGG + Intergenic
1085446489 11:76604291-76604313 GTGAAAAGAGAGAGAGAACATGG - Intergenic
1085895329 11:80632447-80632469 GTGAAGACAGAGAGAGAAAGCGG + Intergenic
1085908095 11:80788809-80788831 GTGAGGATATGGAAAGAAGGTGG - Intergenic
1086021509 11:82236284-82236306 GGGCAGATAGAGAGGGAAGAAGG + Intergenic
1086211875 11:84330619-84330641 GTGAAGATGTAGAGAAATGAAGG - Intronic
1086619454 11:88867721-88867743 GTGAAGATGCAAGGAGAAGATGG + Intronic
1086648151 11:89250651-89250673 ATGAAGACATAGCAAGAAGATGG - Intronic
1086649775 11:89273846-89273868 GTGAAGACATAGGAAAAAGATGG - Intronic
1086724086 11:90159998-90160020 GTAAAGATGAAGAGAGAAGGGGG + Intronic
1086888929 11:92234384-92234406 GGGAAAATAAAGGGAGAAGATGG + Intergenic
1086903995 11:92398165-92398187 GTGAAGACAGGGGGAGAAGATGG - Intronic
1087005442 11:93466464-93466486 GTGAAGGTAAAGCTAGAAGAAGG - Intergenic
1087612112 11:100447131-100447153 GTGAACATATAGTGAGAAAGTGG + Intergenic
1087881997 11:103427641-103427663 GTGAAGATACAAGGAAAAGATGG - Intronic
1087942704 11:104118327-104118349 GTGAGGATACAATGAGAAGATGG + Intronic
1087969394 11:104460885-104460907 ATGAAGATGTAGAAAGAAAAGGG + Intergenic
1087978320 11:104578349-104578371 GTGAGGTTACAGAGAGAAGATGG + Intergenic
1088115866 11:106312273-106312295 GTGAAGACACAGGGCGAAGACGG + Intergenic
1088130924 11:106489805-106489827 GTGAAGACACAGTGAGAAGAAGG - Intergenic
1088219310 11:107550830-107550852 GTGAGGACATTGAGAGAAGGTGG + Intronic
1088556934 11:111071306-111071328 ATGGACATACAGAGAGAAGATGG + Intergenic
1088592953 11:111418995-111419017 ATGAAGACAAAGAGAGAAGGCGG - Intronic
1088745688 11:112802091-112802113 CTGAAAATGTAGAGAGGAGATGG - Intergenic
1088799309 11:113290765-113290787 GTGAGGACACAGTGAGAAGAAGG + Intergenic
1088872263 11:113900861-113900883 GTGGAGAGAGAGAGAGAAGGGGG + Intergenic
1088961607 11:114672047-114672069 GGAAAGACATAGAGAGAAGGAGG + Intergenic
1088976872 11:114823514-114823536 GTGAAGGAACAAAGAGAAGAGGG - Intergenic
1089130872 11:116210988-116211010 GTGAAGGTGGAGAGAGAACAGGG - Intergenic
1089282617 11:117384991-117385013 GTGAGGATTTCCAGAGAAGAGGG + Intronic
1089370912 11:117956340-117956362 GTGAAGACGGAGGGAGAAGATGG + Intergenic
1089668847 11:120038117-120038139 GTGAGGATACAGGGAGAAGGTGG + Intergenic
1090122751 11:124049953-124049975 GTGAAGAATAAGAGAGATGATGG - Intergenic
1090172468 11:124616994-124617016 GAGAAGAGAGAGAGAGAATAAGG - Intronic
1090218956 11:124998470-124998492 ATGAAGAGATAGAGACAAAAAGG - Intronic
1090237774 11:125162038-125162060 GTGCAGGTAGAGTGAGAAGAGGG + Intergenic
1090285890 11:125498607-125498629 CTGAAGATCTAGACAAAAGATGG - Exonic
1090405198 11:126472390-126472412 GTGAGGACACAGTGAGAAGAGGG - Intronic
1090760976 11:129836673-129836695 GTGAGGACACTGAGAGAAGATGG + Intronic
1090769229 11:129904873-129904895 GTGAAGATAAAAACAGAAGAAGG + Intronic
1090918556 11:131188086-131188108 GTGAGGACACAGTGAGAAGAAGG - Intergenic
1091164885 11:133466774-133466796 GTGAAGAGGAAGAAAGAAGAAGG + Intronic
1091298838 11:134492134-134492156 GTGAGGACACAGTGAGAAGATGG + Intergenic
1091336752 11:134775533-134775555 GTTAAGACACAGTGAGAAGATGG - Intergenic
1091496741 12:979599-979621 GTGAGGACACAGTGAGAAGATGG + Intronic
1091619818 12:2078194-2078216 GTGAGGACACAGAGAGAAGGTGG + Intronic
1091634284 12:2185610-2185632 GTGAAGACATGGGGAGAAGAGGG + Intronic
1091642388 12:2247213-2247235 GTGACCATATAGAGAGAGCAAGG - Intronic
1091755064 12:3045982-3046004 CTGAAGATTTGGAGAGATGAAGG - Intergenic
1091772235 12:3159768-3159790 GTGAAGACGTAGGGAGAAGACGG + Intronic
1092286313 12:7130866-7130888 GGGAAGAGAAAGAGAGGAGACGG - Intronic
1092286631 12:7132428-7132450 GTGAAGATATATAGGACAGAGGG - Intronic
1092318731 12:7447914-7447936 GTGAGGACACAGAGAGAAGGTGG + Intronic
1093093525 12:14947064-14947086 GTGCAAATAGAGAGAGCAGATGG + Intronic
1093215422 12:16355985-16356007 GTGAGGATACAATGAGAAGATGG - Intronic
1093282350 12:17210057-17210079 ATGAAGATACAGGGAGAAGCTGG - Intergenic
1093308377 12:17546790-17546812 AAGAAAAGATAGAGAGAAGAGGG - Intergenic
1093429906 12:19072579-19072601 GTGAAGATGTAGTGAGAAGGTGG - Intergenic
1093587068 12:20851172-20851194 TTGAATATATACACAGAAGAAGG + Intronic
1093610861 12:21154362-21154384 GTGAGGTTACAGTGAGAAGATGG + Intronic
1094214759 12:27929066-27929088 GTGAGGACACAGTGAGAAGACGG - Intergenic
1094493018 12:30972936-30972958 GTGAAGATGGAGAGAATAGAAGG - Intronic
1094583227 12:31753815-31753837 GAGAAGTTGTAGAGAGAAAAAGG + Intergenic
1094670714 12:32566191-32566213 GTGAGGTTATAGTGAAAAGATGG - Intronic
1095540646 12:43305272-43305294 AGGAAGACAGAGAGAGAAGAAGG + Intergenic
1096120289 12:49084558-49084580 GTGAGGACATAGAGAGAAGGTGG - Intergenic
1096152033 12:49320451-49320473 GTGAAGAGAAAGAGAGAATAGGG + Intergenic
1096980583 12:55726270-55726292 GGGAAGAAATATGGAGAAGAAGG + Intronic
1097404590 12:59174925-59174947 GTGAGAACATAGAGAGAAGACGG - Intergenic
1097481849 12:60137194-60137216 GTGAAGAGATGGGGAAAAGATGG - Intergenic
1098429559 12:70404922-70404944 GTGAACATTTAGAGTGAGGAGGG + Intronic
1098529546 12:71526122-71526144 CTGATGATCTAGAGAGAATAAGG + Intronic
1098572806 12:72008096-72008118 GTGAAGGCAAAGATAGAAGAAGG + Intronic
1098689315 12:73466641-73466663 GGGAAAACACAGAGAGAAGATGG + Intergenic
1098693216 12:73516771-73516793 CAGAAGATATAGAGACCAGAAGG - Intergenic
1098703151 12:73653963-73653985 TTGAAGTTATAGAAAGAAAAAGG - Intergenic
1099048762 12:77757423-77757445 TTGTAGAATTAGAGAGAAGAAGG - Intergenic
1099109301 12:78537512-78537534 GTGAGGATAAAAGGAGAAGAAGG - Intergenic
1099241282 12:80142486-80142508 CTGAAGATATAGAGAAAATGGGG - Intergenic
1099389575 12:82062839-82062861 GTGAAGACACAGAAAAAAGATGG + Intergenic
1099639645 12:85269954-85269976 GTGAAGATATAGTAAGAAGACGG - Intergenic
1099645526 12:85349138-85349160 TAGAAAATATAGAGAGAAGTGGG + Intergenic
1099754919 12:86833515-86833537 GTGAAGACACAGGGAGAAGACGG - Intronic
1099774387 12:87105381-87105403 GTGAGGATACAAGGAGAAGATGG - Intergenic
1099935885 12:89124813-89124835 GTGAAGAAAGAAAGAGAAGATGG - Intergenic
1100188799 12:92168005-92168027 GTGAGGCTATAGCAAGAAGATGG - Intergenic
1100593616 12:96052641-96052663 GTGAAGATACAGCAAGAAGGTGG + Intergenic
1100657608 12:96663290-96663312 GTGAAGAAATGAAGAGAAGAGGG + Intronic
1100700136 12:97138541-97138563 GTGAAGATACAATGAGAAGATGG + Intergenic
1100866787 12:98865964-98865986 GTGAGGTTACAGTGAGAAGACGG - Intronic
1101016133 12:100502444-100502466 GTGAACACACAGAGAGGAGACGG - Intronic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101071633 12:101081812-101081834 GTGAAGACACAGGGAGAAGATGG - Intronic
1101745732 12:107540040-107540062 GTGAAGATGCAGAGAGATGTAGG + Intronic
1101795907 12:107973439-107973461 GACAAGACATGGAGAGAAGACGG - Intergenic
1101833229 12:108275497-108275519 GACAAGACACAGAGAGAAGATGG - Intergenic
1102042566 12:109810058-109810080 GAGAAGAGATAGAGAGAGAAAGG + Intronic
1102765383 12:115428400-115428422 GGGAAGATTTAAAGAGAAGGTGG + Intergenic
1102777467 12:115533049-115533071 GAGAACATAGAGAGAGAATAAGG + Intergenic
1102799430 12:115718575-115718597 GTGAGGACACAGTGAGAAGATGG - Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1102930530 12:116858683-116858705 GTGAAGAGAGAGAGAGAGAAAGG - Exonic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103076412 12:117986327-117986349 GTGAGGGTACAGTGAGAAGATGG + Intergenic
1103128592 12:118446729-118446751 GTGAAGACATGGGGAGAAGGTGG - Intergenic
1103200972 12:119087674-119087696 GAGAGGAAATAGGGAGAAGATGG + Intronic
1103679858 12:122684871-122684893 GTGAGGACACAGGGAGAAGACGG - Intergenic
1103978818 12:124722399-124722421 GTAAAGACACAGAGAGAAGATGG - Intergenic
1104320009 12:127742144-127742166 GTGAGGACACAGGGAGAAGACGG + Intergenic
1104404272 12:128504599-128504621 GTGAAGACACAGAGAGAAAGTGG - Intronic
1105234538 13:18536520-18536542 GTGAGGATGTAAAGAAAAGACGG - Intergenic
1105298610 13:19113452-19113474 GAGAAGATGGAGAGAGAAGGCGG - Intergenic
1105563556 13:21519570-21519592 GGGAAGAAATAGAGTGAAAAGGG - Intronic
1105655411 13:22432164-22432186 GTGAAGACTCAGGGAGAAGATGG - Intergenic
1105823997 13:24105874-24105896 GTGAAGACACAGGGTGAAGACGG + Intronic
1106228137 13:27800409-27800431 GTGAAGACACGGGGAGAAGACGG + Intergenic
1106305888 13:28508913-28508935 GTGAAGACACAGGGAGGAGATGG + Intergenic
1106367615 13:29097678-29097700 GTGAAGATATAATGAGAAGATGG - Intronic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1106627019 13:31431139-31431161 GTGAAGACATAGAGTGTGGAAGG - Intergenic
1106689233 13:32096030-32096052 GTGAAGAAATAAAGACAGGAAGG - Intronic
1106925208 13:34606441-34606463 ATGAGGATATAGCAAGAAGATGG + Intergenic
1107094341 13:36518598-36518620 TTGAAGACACAGTGAGAAGATGG - Intergenic
1107239790 13:38218729-38218751 GTGAGGACACAGTGAGAAGAGGG - Intergenic
1107266703 13:38564142-38564164 GTGAAGAGGCAGAGAGAACACGG - Intergenic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1107514229 13:41113604-41113626 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1107519781 13:41168077-41168099 GAGAGGATACAGTGAGAAGAGGG + Intergenic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1108093607 13:46877719-46877741 GTGAAAATATAGAGATATGGAGG + Intronic
1108284013 13:48887629-48887651 GTGAAGACATAGTGAAAAGGTGG - Intergenic
1108334727 13:49427872-49427894 GTGAGGATACAGCGAAAAGATGG - Intronic
1108742833 13:53356358-53356380 ATAAAGATACAGGGAGAAGATGG - Intergenic
1108759390 13:53544786-53544808 GTGAAAAAATAGAGAGACAAAGG - Intergenic
1108845871 13:54677998-54678020 GAGAAAATATAGTGAAAAGAAGG + Intergenic
1108979377 13:56491522-56491544 ATGAAGAAACAGAGAGAAGGGGG + Intergenic
1109032961 13:57217258-57217280 GTGAAGAGACAGTGAGAAGATGG + Intergenic
1109157692 13:58931105-58931127 GTGAAGAGACAGGAAGAAGATGG + Intergenic
1109310468 13:60686799-60686821 GTGAAGACATAGTGAGAGGATGG + Intergenic
1109470367 13:62796642-62796664 GTGAGGATACAGGGAGAAAATGG - Intergenic
1109551584 13:63909426-63909448 GAGTAAATATAGAGAAAAGACGG - Intergenic
1109865938 13:68262697-68262719 GTGAAGACCTAGGGAGAAAATGG - Intergenic
1110379588 13:74835127-74835149 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1110496896 13:76178469-76178491 GTGGAGAGAAAGAGTGAAGACGG + Intergenic
1110606970 13:77444051-77444073 GGGAAGAGAAAGAAAGAAGAGGG + Intergenic
1110610759 13:77485273-77485295 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1110969290 13:81740624-81740646 GAGAAGTTATAGGAAGAAGAAGG + Intergenic
1111088678 13:83412303-83412325 GTGAAGAAATAGGGAGATGTAGG + Intergenic
1111321997 13:86643831-86643853 ATGAAGATAGAGGGAGAAGAAGG + Intergenic
1111333345 13:86790414-86790436 GTGAAGATACAGAGAAGAGATGG - Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1111955980 13:94759027-94759049 GGGAAGAAAAAGAGAGAAAACGG - Intergenic
1112146862 13:96709614-96709636 GTGAGGATATAGCAAGAAGGTGG + Intronic
1112169184 13:96951939-96951961 CTGAAGATATATAAAGAACATGG + Intergenic
1112187881 13:97145390-97145412 GGGAAGATATGGAGAAAAGGAGG + Intergenic
1112191038 13:97177595-97177617 ATGAAGAAATAGAGAAAAGTTGG + Intergenic
1112204365 13:97309472-97309494 GTGAAGAGACAGGAAGAAGATGG + Intronic
1112212182 13:97388720-97388742 CTGGAGATATAGACAGAACAGGG - Intronic
1112409154 13:99147024-99147046 GAAGAGACATAGAGAGAAGATGG - Intergenic
1112600520 13:100850943-100850965 GTGAGGTTACAGTGAGAAGATGG + Intergenic
1112694947 13:101937462-101937484 GTGAAGATGCAGTGAGAAGGTGG + Intronic
1112925109 13:104664123-104664145 ATGTATATATAGAGAGAATATGG + Intergenic
1113003723 13:105675464-105675486 GTGAGGACATAGTGAGAAGGTGG - Intergenic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113101062 13:106719629-106719651 GTGAGGACATACAGAGAAGATGG - Intergenic
1113128697 13:107009982-107010004 GAGAAAATTAAGAGAGAAGAAGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113162316 13:107395776-107395798 GTGAAAACATGGAGAGAAGACGG - Intronic
1113216483 13:108046534-108046556 ATAAAGATTTAGAGAAAAGATGG + Intergenic
1113338078 13:109395781-109395803 GTAAAGACACAGTGAGAAGACGG + Intergenic
1113360552 13:109627159-109627181 GTGAAGAGGGAGAGAGATGATGG - Intergenic
1114573451 14:23692169-23692191 GTGAAGACAAAGGGAGAAGATGG - Intergenic
1114888323 14:26883258-26883280 GTGAAGACACAGGGAGAAGATGG + Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115197468 14:30816867-30816889 GTGAAGAAAGAGAGAGAGGTAGG - Intergenic
1115306536 14:31939308-31939330 GAGAAGACACAGACAGAAGATGG + Intergenic
1115499935 14:34040391-34040413 GTGGGGATACAAAGAGAAGATGG + Intronic
1115873633 14:37835652-37835674 GTGAAGAAAGAAAGACAAGATGG + Intronic
1115921627 14:38380667-38380689 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1116082301 14:40190168-40190190 GTGAAGACACAGGGAGAAAATGG - Intergenic
1116162051 14:41280453-41280475 ATGAAGACAGAAAGAGAAGAAGG + Intergenic
1116311940 14:43338410-43338432 GGGAAGATATAAATAAAAGAAGG - Intergenic
1116319604 14:43443971-43443993 GCAAAGATATGGAGAGAAGGTGG - Intergenic
1116354997 14:43916253-43916275 GAGAAGATAGAGAGAGATCATGG + Intergenic
1116426169 14:44794578-44794600 GTGAAAATAGAAAGAGGAGAGGG - Intergenic
1116576249 14:46580028-46580050 TTGAAGACAAAGTGAGAAGATGG + Intergenic
1116865887 14:50031280-50031302 GAGAAGATCTAGAAAGAAGGAGG - Intergenic
1116975900 14:51115713-51115735 GTGAAGACACAGGGAGAAGATGG - Intergenic
1117214965 14:53541553-53541575 GAGAAGAGAAAGAGGGAAGAGGG + Intergenic
1117611101 14:57484332-57484354 GTGAAGATGAAGAGAGAGGTTGG + Intronic
1117643367 14:57824372-57824394 GACAAGAGATAGAGAGTAGATGG + Intronic
1117810821 14:59544862-59544884 GTGAAGACACAGAGAGAAAGCGG + Intronic
1118032105 14:61828095-61828117 GTGAAGACACAGGAAGAAGATGG + Intergenic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118071368 14:62249878-62249900 ATGAAGTCACAGAGAGAAGATGG - Intergenic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118304713 14:64646008-64646030 GGGGAGATAAAGAGAGAAGGAGG + Intergenic
1118850961 14:69583172-69583194 GTGAAGACATAGTGAGAAGGTGG - Intergenic
1118886820 14:69874251-69874273 GTGTAGATACAAAGAGAAGTTGG - Intronic
1119065851 14:71525511-71525533 GAGAAGAAATAAAGAAAAGAAGG - Intronic
1119103794 14:71905475-71905497 GAAAAGAAACAGAGAGAAGAAGG - Intergenic
1119345871 14:73923868-73923890 GTTAAGTTATTCAGAGAAGAGGG + Intronic
1119537266 14:75412639-75412661 GTGAGGACACAGGGAGAAGATGG + Intergenic
1119991171 14:79199252-79199274 GTAAAAATAGAGAGACAAGAAGG - Intronic
1119992436 14:79214193-79214215 TAGAATATATAGAGAGAAGGTGG + Intronic
1120142591 14:80945184-80945206 CTGAGGATACAGAGAAAAGATGG - Intronic
1120144661 14:80966871-80966893 GTGAAGATACAATGAGAAGGTGG - Intronic
1120242603 14:81966647-81966669 GTGAAGATTTTGAGGGTAGAGGG + Intergenic
1120425025 14:84336720-84336742 GTGAGGATAAAATGAGAAGATGG + Intergenic
1120500348 14:85289390-85289412 GTGAAATTACAGTGAGAAGATGG - Intergenic
1120608143 14:86605143-86605165 GTGAGGTTAGAGTGAGAAGATGG - Intergenic
1120841258 14:89087125-89087147 GTGAGGACACAGAGAGAAGGCGG - Intergenic
1120915496 14:89706578-89706600 GTGAGGTAATAGTGAGAAGATGG - Intergenic
1121005206 14:90486121-90486143 GTGAAGAACTAGAGGGGAGAGGG + Intergenic
1121716153 14:96077517-96077539 GTGAAGACACAGGGAGAAGGTGG + Intronic
1121887079 14:97553520-97553542 GTGAAAACATAGAGAGAACCTGG + Intergenic
1121896737 14:97655709-97655731 GTGAGGATACAGTTAGAAGACGG + Intergenic
1121903645 14:97719245-97719267 GTGAAGATACAGTGAGAAGCTGG - Intergenic
1122161516 14:99787761-99787783 GTGAAGACACAGGGAGGAGATGG - Intronic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1124046785 15:26157872-26157894 GTGAGGATACAATGAGAAGATGG - Intergenic
1124212584 15:27775757-27775779 GTGAAGACACAGGGAGAAGACGG - Intronic
1124354806 15:28986965-28986987 GTGAGGATGTAGTGAGAAGATGG - Intronic
1124606111 15:31171442-31171464 GTGAGGACATAGGGAGAGGATGG - Intergenic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125347591 15:38733704-38733726 ATGAAGACACAGTGAGAAGATGG - Intergenic
1126526001 15:49654934-49654956 GTGAGGATATAGCAGGAAGATGG - Exonic
1126918373 15:53491642-53491664 GTAAAAATTTAGCGAGAAGAGGG - Intergenic
1126933416 15:53679703-53679725 GCAAAGATATAGAGTGGAGATGG + Intronic
1127463197 15:59218811-59218833 GTGCAGATGCAGAGAGGAGAAGG + Intronic
1127704041 15:61529752-61529774 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1128206705 15:65859038-65859060 GAGAAGAGAGAGAGAAAAGAAGG - Intronic
1128410068 15:67387700-67387722 GTGAAGATATAGAAAGTATCTGG - Intronic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1128538803 15:68510743-68510765 GTGAAGAGAAAGAGAGAAGCAGG - Intergenic
1128691056 15:69725305-69725327 TTGAAAAGATAGTGAGAAGATGG + Intergenic
1128706696 15:69842106-69842128 GTGAAGATACAGTGAGAAGATGG + Intergenic
1130162859 15:81418996-81419018 GTGAGGGTACAGTGAGAAGATGG + Intergenic
1130201904 15:81838992-81839014 GTGAAGACAAAGTGAGAAAATGG + Intergenic
1130354510 15:83117422-83117444 GAGAAGGTAGAGAGAGAAAAGGG + Intronic
1130363742 15:83213768-83213790 ATGAGGATACAGTGAGAAGATGG + Intergenic
1130884252 15:88080345-88080367 GTTTAGATATAGAGAAAAGGGGG - Intronic
1130969748 15:88722739-88722761 GTGAAGGTCAAGAGAGAAGGCGG - Intergenic
1131428462 15:92366873-92366895 GTGAAGAGACAGTGAGAAGTTGG - Intergenic
1131686268 15:94771415-94771437 GTGAAGACATCAGGAGAAGATGG - Intergenic
1131705952 15:94996393-94996415 GTAAAGACATAGTGAGAAGATGG + Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132179471 15:99741636-99741658 GTGAGGATACAGTGAGAAGGTGG + Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132527176 16:423038-423060 GTGAGGACAGAGTGAGAAGATGG + Intergenic
1133418666 16:5626314-5626336 ATGAAGACACAGGGAGAAGACGG - Intergenic
1133510636 16:6454022-6454044 GTGAAAACCCAGAGAGAAGACGG - Intronic
1133810260 16:9155885-9155907 GTGAAGACATAGGGAAAAGGCGG + Intergenic
1133849520 16:9488951-9488973 GTGAGGATACAGCAAGAAGATGG + Intergenic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1134269787 16:12723514-12723536 GTGAGGATACAGGGAGAAGTCGG + Intronic
1134351767 16:13444366-13444388 GTGAAAAGAAAGAGAGAAGAAGG + Intergenic
1134414885 16:14034638-14034660 GTAAAGACACAGGGAGAAGATGG - Intergenic
1134691612 16:16194322-16194344 TTGAAGATAAAGAGTGAATAAGG + Intronic
1134758482 16:16691284-16691306 GGCTAGATATAGAGAAAAGATGG - Intergenic
1134857273 16:17530713-17530735 GAGAAGACATAGAGAAGAGAAGG - Intergenic
1134987590 16:18667894-18667916 GGCTAGATATAGAGAAAAGATGG + Intergenic
1135087383 16:19486318-19486340 GTAAAGACATGGGGAGAAGATGG - Intronic
1135169304 16:20169158-20169180 GGGAAGATAGAGGGAGAAGATGG + Intergenic
1135173688 16:20209402-20209424 GTGAAGACACAGCGAGAAGGTGG + Intergenic
1135201608 16:20442307-20442329 GTGAAGACAGAGGGAGAAGACGG - Intergenic
1135462307 16:22655393-22655415 GTGAAGACACAGGGAGAAGATGG + Intergenic
1135877756 16:26219191-26219213 GGGAAGTAATAGAGAGAAAAAGG - Intergenic
1137513602 16:49123252-49123274 GTGAAGATGCAGGGAGAAGGTGG - Intergenic
1137539826 16:49354680-49354702 GTGAGGACACAGGGAGAAGATGG + Intergenic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1138088750 16:54156971-54156993 GTGAAGAGATTGGGAGAAGCAGG - Intergenic
1138725979 16:59139622-59139644 GAAGAGACATAGAGAGAAGATGG - Intergenic
1138825016 16:60308681-60308703 GTGAAGACATAATGAGAAGTAGG - Intergenic
1139177202 16:64702245-64702267 TTGAAAATACATAGAGAAGAAGG + Intergenic
1139192793 16:64884198-64884220 GTGCAGACACAGGGAGAAGATGG - Intergenic
1139760103 16:69178064-69178086 GGGAAGATGAAGGGAGAAGATGG - Intronic
1139818761 16:69701481-69701503 GGGAAGAAATGGAGAAAAGAAGG - Intronic
1139850182 16:69947238-69947260 GTGAAGACATAGGGAGAAGGCGG - Intergenic
1139879167 16:70170151-70170173 GTGAAGACATAGGGAGAAGGCGG - Intergenic
1140373354 16:74425401-74425423 GTGAAGACACAGGGAGAAGGCGG + Intergenic
1140537891 16:75727513-75727535 GTGAGGTTAAAGTGAGAAGACGG + Intronic
1140574198 16:76145769-76145791 GTGAAGATACAAAAAGAAGTTGG + Intergenic
1140601151 16:76476658-76476680 GTGAGGACACAGTGAGAAGATGG - Intronic
1141121162 16:81358107-81358129 CTGAAGATACAGAGATAATAAGG - Intronic
1142254506 16:89007173-89007195 GAGAAGATGGAGGGAGAAGAGGG - Intergenic
1203142563 16_KI270728v1_random:1777934-1777956 GTGAGGACACAGGGAGAAGACGG + Intergenic
1143271570 17:5679318-5679340 GTGAAGACATAGAGAAAAGATGG + Intergenic
1143771949 17:9174574-9174596 GTGAAGACACAGGGAGAAGACGG - Intronic
1143901098 17:10175476-10175498 GTGAAGACATAGGGAGAAGACGG - Intronic
1143963354 17:10738630-10738652 GTGAGGACACAGGGAGAAGAGGG + Intergenic
1143971241 17:10797439-10797461 GTGAGGATGTAGAGAGAAAAGGG - Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144257550 17:13484523-13484545 GTGAAGATACAATGAGAAGATGG + Intergenic
1144263108 17:13542453-13542475 GTGAAGACACAGAGAGAAGGTGG + Intronic
1144382704 17:14718611-14718633 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1144444114 17:15310525-15310547 GTGAAGACACAGGGAGAAGGTGG + Intronic
1145019847 17:19421150-19421172 GTGAAGTGAAAGTGAGAAGATGG - Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145095823 17:20025165-20025187 GTGAAGACGCAGGGAGAAGATGG + Intronic
1145275861 17:21429895-21429917 GTGAGGACACAGGGAGAAGATGG + Intergenic
1145712147 17:26987781-26987803 GTGAGGACACAGGGAGAAGATGG + Intergenic
1146185915 17:30724109-30724131 GTGAGGTTATAGTGAGAAGGCGG + Intergenic
1146273942 17:31502891-31502913 GTGACGACACAGGGAGAAGATGG - Intronic
1146549718 17:33769832-33769854 GTGAGGACACAGTGAGAAGATGG - Intronic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1146672122 17:34746881-34746903 GTGAGGATACAAGGAGAAGATGG - Intergenic
1147280993 17:39361186-39361208 GGGAAGATCTAGAGAGGTGAAGG + Intronic
1147564911 17:41530018-41530040 GTGATAATACACAGAGAAGAGGG - Intergenic
1148254857 17:46121331-46121353 GTGAAGTCATAGACAGAAAAGGG - Intronic
1148957015 17:51362394-51362416 GTGAGGATACAGTGAGAAGGAGG - Intergenic
1148960677 17:51390269-51390291 GTGAGGACACAGCGAGAAGAGGG - Intergenic
1149071080 17:52544011-52544033 GTGAAGACATGAGGAGAAGATGG + Intergenic
1149139584 17:53414829-53414851 GTGAAGATAAATAGAAAAGTTGG + Intergenic
1149144356 17:53472177-53472199 GTGAAGACACAGCAAGAAGATGG - Intergenic
1149293760 17:55242011-55242033 GTGAAGAAACAGGAAGAAGATGG - Intergenic
1149440391 17:56669073-56669095 GTGAAGATACAGGGAGAAGACGG - Intergenic
1149442751 17:56688952-56688974 GTGAAGTTACAGAAAGAACAAGG + Intergenic
1149657597 17:58318445-58318467 GTCAAGGTCTAAAGAGAAGATGG + Exonic
1150167046 17:62953934-62953956 GGAAAGATATGGAAAGAAGATGG - Intergenic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150594798 17:66594456-66594478 GTGAAGAAATAAAGAGACGCTGG - Intronic
1150950652 17:69799799-69799821 GTGAAGACAGAAGGAGAAGATGG + Intergenic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151106648 17:71623507-71623529 GTGATGATACAATGAGAAGATGG - Intergenic
1151132390 17:71910756-71910778 GTGAAGACAGAGGGAGAAGACGG - Intergenic
1151136228 17:71948106-71948128 GTAAATAAATAGAGAAAAGATGG - Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1151355294 17:73554489-73554511 GTGAAGACACAGGGAGAAGATGG + Intronic
1152256273 17:79241785-79241807 GTGAAGACACAGTGAGAAGGCGG - Intronic
1152728049 17:81957317-81957339 GTAAAGAGACAGAGAGAGGAAGG - Intronic
1153082080 18:1238928-1238950 GTGAAGACACAGTGAGAAGGTGG - Intergenic
1153090244 18:1334821-1334843 GTGATGACACAGTGAGAAGATGG - Intergenic
1153296382 18:3550640-3550662 ATGAAGACACAGGGAGAAGATGG + Intronic
1153512804 18:5873834-5873856 ATGAAGACACAGGGAGAAGATGG + Intergenic
1153597557 18:6743107-6743129 GAGAAGGAAGAGAGAGAAGAGGG + Intronic
1153827858 18:8893341-8893363 ATGAAGATACAAAGAGAAGATGG - Intergenic
1154023944 18:10689326-10689348 GTGATGTTATAGAGAAAAGTGGG - Intronic
1154515004 18:15153338-15153360 GTGAGGATGTAAAGAAAAGACGG + Intergenic
1155026941 18:21949615-21949637 GTGAATAGACAGGGAGAAGATGG + Intergenic
1155432163 18:25771001-25771023 GTGAAGATGCAAAGAGACGATGG - Intergenic
1155491132 18:26403053-26403075 GTGAAGAAAGAGGGAGAAGTTGG + Intergenic
1156092556 18:33489029-33489051 GTGAGGATATAATGAGAAGATGG + Intergenic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156521750 18:37727736-37727758 GTGCAGACACAGACAGAAGATGG - Intergenic
1156566625 18:38198608-38198630 GTGAAGACATAGAGAGAAAATGG - Intergenic
1156578615 18:38349385-38349407 GTGAGGATGCAGTGAGAAGATGG + Intergenic
1156658792 18:39320725-39320747 ATGCAGGTATAGACAGAAGAAGG - Intergenic
1156807920 18:41209244-41209266 GTGAGGACATAGCGAGAAGGAGG + Intergenic
1157163291 18:45334914-45334936 GTGAACATTTAGCGAGAAGAGGG - Intronic
1157301395 18:46482399-46482421 GTGAGGACACAGAGAGAAGGCGG + Intronic
1157301754 18:46484449-46484471 GTGAGGACACAGTGAGAAGATGG + Intronic
1157537141 18:48468225-48468247 GTGAAGAGACCCAGAGAAGATGG + Intergenic
1157537750 18:48472658-48472680 GTGAGGACATAGTGAGAAGGTGG + Intergenic
1157957131 18:52111030-52111052 GTGAAGATACAGCAAGAAGGAGG + Intergenic
1158091130 18:53715005-53715027 GTGGAGATACAGGGAGAAGAGGG - Intergenic
1158522086 18:58180030-58180052 GTGGAGGAATAGAGAGAATAGGG - Intronic
1158565558 18:58551400-58551422 GGAAAGATATAGAGGGAAGATGG - Intronic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158798591 18:60878565-60878587 GTGTATATACATAGAGAAGATGG + Intergenic
1159202964 18:65211405-65211427 GTGAAGACACAGTAAGAAGATGG + Intergenic
1159212463 18:65343400-65343422 GTGAAGACAGAGGGAGAAGGTGG + Intergenic
1159349773 18:67257835-67257857 GTGAAGATACAAGGAGAAGATGG - Intergenic
1159360510 18:67395779-67395801 ACGAAGAAAAAGAGAGAAGAAGG - Intergenic
1159378844 18:67630371-67630393 GTGAAAATATGGAGCGAAGGGGG - Intergenic
1159469827 18:68837618-68837640 GTGAAGACACAGGGAGAAAACGG - Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159638509 18:70835891-70835913 GTGAAGACATAGGGAGATGATGG + Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1159900075 18:74037553-74037575 GGGAAGACACAGGGAGAAGATGG - Intergenic
1159966743 18:74602294-74602316 GAGAAGGTAGAGAGAGATGATGG + Intronic
1160047291 18:75398780-75398802 ATGAAGAGAGAGAGAGAGGAAGG - Intergenic
1161540293 19:4846752-4846774 GTGAATACACAGAGAGAAGATGG + Intronic
1161792389 19:6368262-6368284 GTGAAGACACAGCGAGAAGGCGG - Intronic
1162147532 19:8621850-8621872 GTGAAGACGCAGAGAGAAGGTGG + Intergenic
1162151977 19:8652904-8652926 GAGAAGAGAGAGAGAGAAGGAGG - Intergenic
1162306942 19:9880664-9880686 GTGAAGATACAGTAAGAAGGTGG + Intronic
1162820559 19:13220927-13220949 GTGAAGGTAAAGAGAGCACAAGG - Intronic
1162972861 19:14191620-14191642 GTGAGGATATAGTGAGAAGGCGG - Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1163137134 19:15320139-15320161 GTGATGATCTAGAGAGAAGCAGG + Intronic
1163176288 19:15566113-15566135 GAGAAGAAATAAAGAGAACACGG - Intergenic
1163373093 19:16913456-16913478 GTGAACATACAGTGAGAAGGTGG + Intronic
1165085419 19:33342770-33342792 GTGAAGACATTGGAAGAAGATGG - Intergenic
1165188854 19:34045284-34045306 AGGAAGAGAGAGAGAGAAGAAGG + Intergenic
1166512359 19:43417657-43417679 GTGAAGATACAGAGATGAAAAGG - Intronic
1166575347 19:43832101-43832123 TTGAATATTTAGGGAGAAGAGGG + Intronic
1166715193 19:44962505-44962527 ATGAAGACACAGGGAGAAGACGG - Intronic
1166883352 19:45942358-45942380 GTGAAGACACAGGGAGAAGAAGG + Intronic
1166964308 19:46518872-46518894 GTGAGGATACAGGGAGAAGACGG - Intronic
1166967766 19:46540527-46540549 GTGAAGACACAGGGAGAAGGCGG - Intronic
1166968827 19:46548344-46548366 GTGAGGACATAGTGAGAAGGTGG + Intronic
1167232901 19:48296692-48296714 GGGCAGATATGGAGACAAGACGG + Exonic
1167250872 19:48397852-48397874 GGGAAGATACAGAGGTAAGAGGG - Intronic
1167339913 19:48909151-48909173 GTGAAAATGCAGTGAGAAGACGG - Intronic
1167814229 19:51865586-51865608 GTCAATATAAAGAGAGAAAAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167909244 19:52688614-52688636 GAGAAGGAATAGAGTGAAGAAGG - Intronic
1167913627 19:52723192-52723214 GAGAAGCAATAGAGGGAAGAAGG - Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1168080470 19:54006450-54006472 GTGAAGATACAGGGATAAGTTGG - Intronic
1168198639 19:54796551-54796573 ATGATGATATAGGGAGAAGAGGG + Intronic
1168325048 19:55534299-55534321 GTGAGGACACAGGGAGAAGACGG + Intronic
1168453409 19:56484407-56484429 GTAAAGATTTAGGTAGAAGAAGG - Intergenic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925316190 2:2926074-2926096 GTGAAGACACAGGAAGAAGATGG + Intergenic
925736616 2:6969381-6969403 AAGATGATATAAAGAGAAGACGG + Intronic
925781472 2:7386009-7386031 GTGAGGAGAGAGAGAGAAGGGGG + Intergenic
926260936 2:11260487-11260509 GTGTAAATATATATAGAAGAAGG - Intronic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
926573341 2:14553817-14553839 GTGAAGCTATAACAAGAAGATGG + Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926696833 2:15775959-15775981 GTGAGGACACAGAGAAAAGATGG + Intergenic
926727679 2:16011168-16011190 GTGAGGACATAGCAAGAAGACGG + Intergenic
926984763 2:18610764-18610786 GTGGAGATATAGCAAGAAGAGGG + Intergenic
927290842 2:21403362-21403384 GTGAGGACATATTGAGAAGAAGG + Intergenic
927368466 2:22326899-22326921 GTGCACACACAGAGAGAAGAAGG + Intergenic
927444183 2:23143216-23143238 GTGAAGACATAGCAAGAAGGTGG - Intergenic
927512306 2:23651807-23651829 GTGAGGATACAGTGAGAAGGCGG - Intronic
927529094 2:23777116-23777138 GTGAGGACACAGAGAGAAGGAGG + Intronic
927883056 2:26702187-26702209 GTGAGGACACAGTGAGAAGATGG - Intronic
927916785 2:26942223-26942245 GTGAAGATGGAGGGAGAAGATGG - Intronic
927947679 2:27146946-27146968 GTGAACATATAGAAAGGAGATGG - Intergenic
928613286 2:33011532-33011554 GTGAAGTCACAGGGAGAAGACGG + Intronic
929047778 2:37806759-37806781 GTGAAGACACAGGGAGAAGATGG + Intergenic
929205895 2:39292461-39292483 GTGAAGACATGGCCAGAAGACGG + Intronic
929247053 2:39713568-39713590 GTGAAGACACAGGGAGAAGATGG + Intronic
929323390 2:40574831-40574853 GTGAAGATACAGTAAGAAGGAGG + Intronic
929570129 2:43017586-43017608 TTGAAAATATAGAGAGATGCGGG - Intergenic
929985836 2:46731300-46731322 GTGAGGTTACAGTGAGAAGATGG + Intronic
930186762 2:48419100-48419122 GGGAAGATATACAGAGCAGGTGG - Intergenic
930237059 2:48898544-48898566 GTGAGGACACAGTGAGAAGATGG + Intergenic
930371724 2:50509981-50510003 GTGAGGATACAAAGAGAAGGTGG + Intronic
930377895 2:50590704-50590726 GTGAGGATACAGCAAGAAGATGG + Intronic
930426816 2:51223277-51223299 GAGAAGAAAAAGAGAGAAAAAGG + Intergenic
930866163 2:56123937-56123959 GTGAGGACACAGTGAGAAGATGG - Intergenic
931061005 2:58529933-58529955 ATGAAGAGATGAAGAGAAGAAGG + Intergenic
931207917 2:60165578-60165600 GTGTATATATAGAGAGAAAGAGG + Intergenic
931382569 2:61767113-61767135 GTGAAGACACAGTGAGAAGGTGG - Intergenic
931628127 2:64275471-64275493 GTGAGGACACAGTGAGAAGAAGG - Intergenic
931634877 2:64332121-64332143 GTGAAGACATAGGGAGACGATGG + Intergenic
931790122 2:65657538-65657560 GGGAAGATACAAAGAGAATAGGG - Intergenic
931835742 2:66096796-66096818 GTGAACAAAAAGATAGAAGAAGG - Intergenic
931970127 2:67576752-67576774 GTGAAGATATAATGAAAAGCTGG - Intergenic
931987694 2:67757181-67757203 GTGGAGAGAGAGAGAGAAGGGGG - Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932653720 2:73588287-73588309 GAGATCATAGAGAGAGAAGAGGG - Intronic
932711806 2:74071112-74071134 GTGAAGATATAGCGAGGAGGTGG - Intronic
932918654 2:75884256-75884278 GCGAAGATACAAGGAGAAGATGG + Intergenic
932939438 2:76145133-76145155 GAGAATATAAAGAGAAAAGAGGG + Intergenic
932959305 2:76394133-76394155 GTGAAGATGCAGAGGGAAGATGG - Intergenic
932972300 2:76558919-76558941 GTGAGGTTAGAGTGAGAAGATGG + Intergenic
933339135 2:80999173-80999195 ATGGAGATAGAGAGAGTAGAAGG - Intergenic
933428884 2:82149460-82149482 GTGAGGTTGAAGAGAGAAGAGGG + Intergenic
933472443 2:82742980-82743002 ATGAAGATATAGAAAGACGGAGG + Intergenic
933493622 2:83019909-83019931 GTGAGGACATAGAGAGAAGGTGG - Intergenic
934049304 2:88197183-88197205 GTGAAGACACAGGGAGACGATGG + Intergenic
934169317 2:89326240-89326262 GTGAAGACATGGTGAGAAGGTGG - Intergenic
934197977 2:89856344-89856366 GTGAAGACATGGTGAGAAGGTGG + Intergenic
934744670 2:96751305-96751327 TTGAGGAAAGAGAGAGAAGAAGG - Intergenic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935197524 2:100826819-100826841 GTTAAGATATGGAGACAAGGCGG - Intronic
935240777 2:101176017-101176039 GTGAGGACAGAGGGAGAAGATGG + Intronic
935270523 2:101430523-101430545 GTGAAGACACAGCGAGAAGGCGG + Intronic
935321460 2:101893532-101893554 GTGTACATATCAAGAGAAGAAGG + Intronic
935331935 2:101983478-101983500 GTGAGGACACAGGGAGAAGATGG + Intergenic
935468204 2:103425038-103425060 GTGAAGAAACACAGAGAAGATGG + Intergenic
935529847 2:104218969-104218991 GTGAAGACACAGGGAGAAGATGG - Intergenic
935603137 2:104942853-104942875 GTGAGGACATAGGGAGAAGGTGG - Intergenic
935609495 2:105006263-105006285 ATGAAGATATAGGGAGAAGGTGG - Intergenic
935611652 2:105031949-105031971 GTGAAGATACAGGAAAAAGATGG - Intergenic
935626478 2:105175969-105175991 GTGAGGATACAGTGAGAAGGTGG + Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
936140536 2:109936235-109936257 GTGAAGACACAGAGAGGAGATGG + Intergenic
936177227 2:110234180-110234202 GTGAAGACACAGAGAGGAGATGG + Intergenic
936204158 2:110435251-110435273 GTGAAGACACAGAGAGGAGATGG - Exonic
936287507 2:111192066-111192088 GTGAGGACACAGTGAGAAGACGG + Intergenic
936604546 2:113936858-113936880 GTGAAGACATATAAAGAAGATGG - Intronic
936892905 2:117392965-117392987 GTGAAGACACAGAGAGAAGGTGG - Intergenic
937014065 2:118587513-118587535 GTGAGGACACAGAGAGAAGGCGG + Intergenic
937086657 2:119176307-119176329 GTGAAGACACAGGGAGAAGAGGG - Intergenic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937283049 2:120733591-120733613 GAGAAGAAAAACAGAGAAGAAGG + Intergenic
937488487 2:122340773-122340795 ATGAAGACATAGGGAGAAGATGG + Intergenic
937539895 2:122936359-122936381 GAGAAGAAATGGACAGAAGAGGG + Intergenic
937656881 2:124386982-124387004 GTGAGGATAGAGCAAGAAGATGG + Intronic
937795368 2:126011654-126011676 GTGAAGACACAGTAAGAAGATGG + Intergenic
937921075 2:127131316-127131338 GTGAAGGCACAGAGAGAAAACGG + Intergenic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
938079374 2:128361467-128361489 GTGAGGATACAGTGAGAAGGTGG + Intergenic
938151870 2:128894013-128894035 GTGAAGACGTAGGGAGAAGACGG + Intergenic
938515269 2:131998121-131998143 GTGAGGATATAAAGAAAAGACGG + Intergenic
938719427 2:134052875-134052897 GTGAAGTTCTAGGGAGAAGGTGG - Intergenic
938920857 2:135993318-135993340 GTGAAGACACAGGGAGAAGAGGG + Intergenic
938971006 2:136432358-136432380 GTGAAGACATAAGGAGAAGATGG - Intergenic
938982215 2:136537671-136537693 GTGAGGATACAGGGAGAAGGTGG + Intergenic
939086023 2:137719355-137719377 GTGAAGATACAGTGAGAAGGCGG - Intergenic
939173960 2:138728229-138728251 ATGAAGACACAGGGAGAAGATGG + Intronic
939256140 2:139747011-139747033 CGGAAGAGAAAGAGAGAAGAGGG + Intergenic
939329658 2:140740768-140740790 ATGAAGATATAGGGAGAAGATGG - Intronic
939520275 2:143221796-143221818 GTGAAAATATGGCCAGAAGATGG + Intronic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
939797000 2:146657326-146657348 GTGAAGATGCAGCAAGAAGAAGG + Intergenic
939922974 2:148139746-148139768 GTGAACATATTGAGAGATAATGG - Intronic
939956750 2:148533800-148533822 GTGAAGACATAGGAAGAAGACGG - Intergenic
940382008 2:153025699-153025721 CAGCAGATATAGAGAGAAGTGGG - Intergenic
940605172 2:155914048-155914070 GTGAGGACATAGTGAGAAGATGG - Intergenic
940609937 2:155977665-155977687 GTGAGGATACAGTGAGAAGGTGG - Intergenic
940697881 2:157002684-157002706 GTGAATGTAGATAGAGAAGAGGG + Intergenic
940701738 2:157053215-157053237 CTGAAGAGCTGGAGAGAAGAGGG + Intergenic
940939679 2:159544483-159544505 GGGAATATATAAAGAGGAGAAGG + Intronic
940991253 2:160098898-160098920 GTGAAGATACAGGGAGAGGGTGG - Intergenic
941124821 2:161571966-161571988 TTGATGAAATTGAGAGAAGATGG - Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941304162 2:163840828-163840850 TTGAAGATAAAAAGAAAAGAGGG + Intergenic
941424693 2:165327922-165327944 GTAAAGAGATAGGGAGAGGAGGG - Intronic
941431393 2:165418288-165418310 TTGAATATATAGAAAGATGAGGG + Intergenic
941456756 2:165718354-165718376 GTGAGGATACAATGAGAAGATGG + Intergenic
941778826 2:169422489-169422511 GTGAAGATGTTGAGATAAAAAGG - Intergenic
942075636 2:172354884-172354906 GGGAAGATAAACAGAGATGAAGG + Intergenic
942554738 2:177160158-177160180 ATGTAGATTTAGAGATAAGATGG - Intergenic
942614547 2:177776736-177776758 GTGAGGACACAGAGAGAAGGTGG + Intronic
942752590 2:179304524-179304546 GTAAAGACATAGGGTGAAGAGGG + Intergenic
942862313 2:180629722-180629744 GAAAATATATAGGGAGAAGACGG + Intergenic
943086223 2:183314976-183314998 GTAAATATATAAAGAGAAGAGGG - Intergenic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
943724262 2:191236886-191236908 GTGAGGATATAGCAAGAAGGTGG - Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943949410 2:194111667-194111689 GTGAGGACACAGAGAGAAGCTGG - Intergenic
943990826 2:194689847-194689869 GTGAGGACATAGTGAGAAGGTGG - Intergenic
944005766 2:194903320-194903342 GTGAGGACACAGTGAGAAGATGG + Intergenic
944300871 2:198123525-198123547 GTGAAGACATAGGGAAAAGATGG + Intronic
944427351 2:199597148-199597170 GTGAGGATACAGTGAGAAGGTGG + Intergenic
944701717 2:202251803-202251825 GTGAGGATATAGCAAGAAGGCGG - Intergenic
944724349 2:202454956-202454978 GTGAGGACACAGAGAGAAGGTGG - Intronic
944832421 2:203546184-203546206 GTGAAGACACAGGGAGAAGACGG - Intergenic
945094007 2:206202338-206202360 TGGAGGCTATAGAGAGAAGACGG + Intronic
945213328 2:207406996-207407018 GTGAGGACACAGAGAGAAGGTGG - Intergenic
945410070 2:209497330-209497352 GTGAGGATATAGTGAGAATGTGG + Intronic
945742915 2:213685349-213685371 GTGAAGAGACACAGAGAATAAGG + Intronic
945763377 2:213943007-213943029 GTGAAAATACAATGAGAAGATGG + Intronic
945935182 2:215896754-215896776 GTGAAGTTAGAGTGAGAAGATGG - Intergenic
946028523 2:216687327-216687349 CTGAAGATATATAGAGAAAAGGG + Intronic
946097480 2:217287971-217287993 GTGAAGATACAAGAAGAAGATGG - Intronic
946150001 2:217758024-217758046 GTGGGGATACAGTGAGAAGATGG + Intergenic
946270264 2:218586397-218586419 GTGAGGACATAGTGAGAAGCTGG + Intronic
946345554 2:219107638-219107660 CTGAAGACAGAGAGAGAAGTGGG - Intronic
946573143 2:221046102-221046124 GTGAAGATATAGAAGCAAGGAGG + Intergenic
946881007 2:224177092-224177114 GTGAAGACAGAGTGAGAAGGTGG - Intergenic
946994366 2:225374374-225374396 GTGAAAATAGAGAAAGAAGAAGG + Intergenic
947078202 2:226366962-226366984 GTGGAGATACAGTGAGAAGGTGG + Intergenic
947181428 2:227414820-227414842 GTGAAGACACAGGGAGAAGATGG + Intergenic
947464349 2:230327692-230327714 GTGAAGGTAGAGAGGGCAGAGGG - Intronic
947628214 2:231634581-231634603 GTGAAGGGATAGAGAGAAACAGG + Intergenic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
947860134 2:233352769-233352791 GTGAAGACACAGGGAGAAGATGG - Intergenic
947922739 2:233892485-233892507 GTGAGGACACAGGGAGAAGACGG - Intergenic
948166503 2:235866778-235866800 GTGAAGACACAGGGAGAAGATGG - Intronic
948383797 2:237568964-237568986 GTGAGGATACAACGAGAAGACGG - Intergenic
948436739 2:237958852-237958874 GTGAAGAAACAGGGAGAAGATGG - Intergenic
1168915325 20:1480625-1480647 GTGAAGATACAGGGAGAAGGTGG + Intronic
1168935736 20:1664064-1664086 AGGAAGAGAGAGAGAGAAGAGGG + Intergenic
1168957448 20:1844386-1844408 GGAAAGAAAGAGAGAGAAGAAGG - Intergenic
1169047160 20:2542653-2542675 GTAAAAATATAGAAAGAAAAAGG - Intronic
1169281169 20:4268083-4268105 GTGAAGATATAGTGAGAAGGTGG - Intergenic
1169284451 20:4296336-4296358 GTGAAGATACAGGGAGAAGGCGG + Intergenic
1169675206 20:8145224-8145246 GTGAAGATGCAGGGAGAAGCAGG - Intronic
1169810884 20:9608046-9608068 GTGAGGTTATAGTGAGAAGATGG - Intronic
1169831947 20:9835377-9835399 GGTAAAATATAGAGGGAAGATGG + Intronic
1169856008 20:10103642-10103664 GCGAAGATATAGAGAAAAGATGG - Intergenic
1169902713 20:10569773-10569795 GTGAAGACAAAGGGAGAGGACGG - Intronic
1169975696 20:11324865-11324887 GTGAAGATACAAGGAGAAGATGG + Intergenic
1170010941 20:11723434-11723456 GTGTAGATACAGAGCGGAGAAGG + Intergenic
1170118291 20:12885106-12885128 GTTAAGATTTAAAGATAAGAAGG + Intergenic
1170126649 20:12970975-12970997 GTGAAAGAATAGAGAGAAGTGGG - Intergenic
1170252919 20:14305461-14305483 CAGTATATATAGAGAGAAGAGGG + Intronic
1170816933 20:19721532-19721554 TTGAAGAAATAGAGAGGAGGGGG + Exonic
1170861124 20:20104822-20104844 GTGAAGACATGGGGAGAAGATGG - Intronic
1171014607 20:21528865-21528887 GTAGAGATACAGAGAGAAGATGG - Intergenic
1171053633 20:21884790-21884812 GTGAAGACACAAGGAGAAGATGG - Intergenic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1172562934 20:35905510-35905532 GTGAGGATGTAGCAAGAAGATGG + Intronic
1172858931 20:38032452-38032474 GTTAAGTTATAGACATAAGAGGG - Intronic
1172886398 20:38234008-38234030 ATGAAGATACAGGGAGAAGATGG + Intronic
1173012895 20:39198570-39198592 GTGAAAGTAAAGAGAGATGAGGG - Intergenic
1173338659 20:42134881-42134903 GTGAAGCTGGAGAGAGAAGTAGG - Intronic
1173470754 20:43321637-43321659 GTGAAGACACAGGGAGAAGATGG - Intergenic
1173484852 20:43433483-43433505 GGAAGGATAGAGAGAGAAGAAGG + Intergenic
1173662576 20:44744799-44744821 GTGAAGATGGAGAGAAATGAGGG - Intergenic
1173881276 20:46414339-46414361 GTGAAGACACAGTGAGAAGATGG - Intronic
1173936286 20:46868317-46868339 GTAAAGACACAGGGAGAAGACGG - Intergenic
1174005189 20:47405018-47405040 GTGAAGAGATGGAAAGAATAAGG - Intergenic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174533636 20:51234095-51234117 ACGAAGACACAGAGAGAAGACGG - Intergenic
1174959558 20:55139667-55139689 CTGAAGACATACGGAGAAGAGGG + Intergenic
1175055947 20:56198408-56198430 GTGTAAATATAGAGAGAAAGTGG + Intergenic
1175180692 20:57144775-57144797 GTGAGGATATAGCGAGAAGATGG - Intergenic
1175528594 20:59656394-59656416 ATATAGATATAGAGAGATGATGG - Intronic
1175544177 20:59767475-59767497 GTGAATAAATAGATAGATGATGG - Intronic
1175757611 20:61539440-61539462 GTGAGGACACAGGGAGAAGATGG - Intronic
1176246811 20:64101445-64101467 GTCATGACATAGTGAGAAGATGG - Intergenic
1176453385 21:6884453-6884475 GTGAAGACATAGAGTGAAATGGG - Intergenic
1176778526 21:13164806-13164828 GTGAGGATGTAAAGAAAAGACGG - Intergenic
1176831560 21:13749501-13749523 GTGAAGACATAGAGTGAAATGGG - Intergenic
1177022859 21:15884900-15884922 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1177210692 21:18067421-18067443 GTGAAGATAAAGGGAGAAACCGG + Intronic
1177309735 21:19375110-19375132 GTGAAGATGCAGTGAAAAGATGG - Intergenic
1177316804 21:19472811-19472833 GTGAAGAAAAAGGGAAAAGAGGG + Intergenic
1177494062 21:21866097-21866119 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1177660826 21:24081580-24081602 GAAAAGACACAGAGAGAAGATGG + Intergenic
1177916965 21:27100970-27100992 GTGAAGACATAGAAAGATGATGG - Intergenic
1177976149 21:27853820-27853842 GAGAGGATATAAAGAAAAGACGG - Intergenic
1178039043 21:28619092-28619114 ATGAAGACACAGGGAGAAGACGG + Intergenic
1178204185 21:30444000-30444022 GTGAGGACACAGAGAGAAGGTGG + Intergenic
1178402164 21:32296110-32296132 GTGAAGACACAGGGAGGAGATGG - Intronic
1178433638 21:32537831-32537853 GTGAAGCAATAGTGAGAGGAGGG + Intergenic
1178446535 21:32648610-32648632 GTTTAAATATAGACAGAAGAAGG - Intronic
1178484655 21:33011042-33011064 GTGAAGACACATGGAGAAGACGG - Intergenic
1178631821 21:34268094-34268116 GTGAGGACATAGTGAGAAGGCGG + Intergenic
1178805535 21:35836185-35836207 GTGAGGACACAGGGAGAAGATGG - Intronic
1179175687 21:39006286-39006308 GGTAACATATAGAGAGATGAGGG + Intergenic
1179221228 21:39409205-39409227 ATGAAGACATAGTGAGAAGCGGG + Intronic
1179272860 21:39865197-39865219 GTGAGGATACAGGGAGAAGATGG - Intergenic
1179302464 21:40124654-40124676 GTGAAGACACAGGGAGAAGAGGG + Intronic
1179367687 21:40773401-40773423 ATGAAGACACAGGGAGAAGAAGG - Intronic
1179721802 21:43320549-43320571 CTGAAGATACAGGGAGAAGACGG + Intergenic
1180055260 21:45355440-45355462 GTGAGGACACAGGGAGAAGATGG + Intergenic
1181385247 22:22540270-22540292 GTAAAGATATAGCAAGAAGGTGG - Intergenic
1182013525 22:27020386-27020408 GCGAAGAGAAAGACAGAAGAGGG + Intergenic
1182028166 22:27136621-27136643 GTCAAGCCATAGAGAGCAGAAGG - Intergenic
1182049860 22:27304404-27304426 GGAGAGAGATAGAGAGAAGATGG - Intergenic
1182275891 22:29188391-29188413 GTTAAGACACAGAGAGAAGATGG - Intergenic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1182994990 22:34803667-34803689 GTGAAGATAGAGACAGAGGTTGG - Intergenic
1183024946 22:35058077-35058099 GGCCAGATTTAGAGAGAAGATGG - Intergenic
1184308180 22:43623546-43623568 GTGAAGACCCAGAGAGCAGAGGG + Intronic
1184454791 22:44603498-44603520 GTGAGGACATAGGGAGAAGGTGG - Intergenic
1184463255 22:44652465-44652487 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463267 22:44652859-44652881 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184463279 22:44653216-44653238 GTGAAGATGTAGACTGAAGAAGG + Intergenic
1184597057 22:45520387-45520409 GTGAGGACACAGGGAGAAGAGGG - Intronic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
949130146 3:490134-490156 GTGAGGATACAATGAGAAGATGG - Intergenic
949143539 3:665871-665893 GTGAAGAAATGGAAAGAAGCTGG - Intergenic
949295467 3:2517131-2517153 GTGAAGAGATACAGAGAAAAAGG + Intronic
949563304 3:5222463-5222485 GTGAAGATCAACAGTGAAGAAGG + Intergenic
949656574 3:6227439-6227461 GGGAAGATACAATGAGAAGATGG + Intergenic
949743728 3:7264601-7264623 GGGAAGACATTGAGAGTAGATGG - Intronic
949840487 3:8314707-8314729 GTGAAGACACTGGGAGAAGATGG + Intergenic
950318103 3:12023385-12023407 GTGAAGAAGTAGAGAGGATAGGG + Intronic
950459854 3:13114877-13114899 GTGAAGATTTGGAGAGGAGGTGG + Intergenic
950721436 3:14885527-14885549 GTGAAGATGTAGGGAGCCGAAGG - Intronic
950850941 3:16061679-16061701 GTGAAGACATTGAGAGAAACAGG - Intergenic
950944615 3:16931993-16932015 GTGAAGATATAAGGAAAAGGTGG + Intronic
950945765 3:16944594-16944616 GTGAAGACACAGAGAGGAGATGG + Intronic
950973582 3:17215660-17215682 GAGAAGGGATAGAGAGAAAAAGG + Intronic
951156334 3:19358269-19358291 GGGAGGAGAAAGAGAGAAGAAGG - Intronic
951224283 3:20102993-20103015 GTGAAGAGAAAGAGAGGAAAAGG - Intronic
951467576 3:23018954-23018976 GTGAAGATACAATGAGAAGTTGG + Intergenic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952215892 3:31277994-31278016 GTGAAGACACAGGGAGAAGATGG - Intergenic
952235032 3:31470647-31470669 GTGAAGCTATAGAAAGAACTTGG - Intergenic
952563191 3:34620405-34620427 GGGAAGACAAAAAGAGAAGATGG - Intergenic
952586344 3:34897408-34897430 GTGAAGACACAGGGAGAAAATGG - Intergenic
952998433 3:38907658-38907680 ATGAAGATATACTGATAAGAAGG - Intronic
953065357 3:39464741-39464763 GTGAAGCCACAGGGAGAAGATGG - Intergenic
953239612 3:41137178-41137200 GTGAGGATACAATGAGAAGACGG - Intergenic
953340808 3:42132737-42132759 GAGAGGATATAGACAGAAGCAGG - Intronic
953467570 3:43136955-43136977 GTGAGGATATCGTGAGTAGACGG - Intergenic
954697916 3:52437276-52437298 GTGATGGAAGAGAGAGAAGAGGG - Intronic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
955369131 3:58335903-58335925 GTGAAGAGATGGAGGGAGGAAGG - Intronic
955474315 3:59320168-59320190 GTGCAGAGATTGAGAGAATAGGG - Intergenic
955539327 3:59957317-59957339 GTGAAGATAGAGCAAGAAGGTGG + Intronic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
955716788 3:61837893-61837915 GTGAAGACACACAGAGAAGGTGG - Intronic
955805370 3:62728468-62728490 ATGAAGATATAGTCAGAAAAAGG - Intronic
955854112 3:63254912-63254934 GTGAAGACACAGGGAGAAGATGG + Intronic
955857375 3:63287641-63287663 GTTAAGAAAATGAGAGAAGAAGG + Intronic
956021631 3:64939476-64939498 GTGAGGATATAGAGATGAGTGGG + Intergenic
956118261 3:65940436-65940458 GTGAAGATACAGTGAGAAGATGG - Intronic
956118602 3:65943240-65943262 GTGAAGGTTCAGAGAGAAAAAGG - Intronic
956142740 3:66162132-66162154 GTGAAGACACAGGGAGAAGATGG - Intronic
956361964 3:68458190-68458212 GGGGAAATATAGAGAGAAGGGGG - Intronic
956366414 3:68508110-68508132 GTGAAGCCATAGTGAGAAGATGG - Intronic
956581214 3:70816123-70816145 GTGAAGGTATAGGGTGAAGTGGG + Intergenic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
956672143 3:71700994-71701016 GTGAAGATACAAGGAGAGGATGG + Intronic
956708756 3:72022209-72022231 GTGATGACACAGAGAGAAGGTGG + Intergenic
956752366 3:72353489-72353511 GTGAAGATACAGGGAGAAGATGG + Intergenic
956932742 3:74063991-74064013 GTAATGACATGGAGAGAAGATGG - Intergenic
957185655 3:76938387-76938409 GTAAAGACATACAGAGATGAGGG - Intronic
957543160 3:81602528-81602550 GTGAAGATACAGTGAGAAGTGGG - Intronic
957915624 3:86684790-86684812 GTGAAGATACAGCAAGAAGCTGG + Intergenic
958469182 3:94496657-94496679 GTAAAGACACAGGGAGAAGATGG + Intergenic
958597806 3:96252420-96252442 GTGTATATATAAAGATAAGAAGG + Intergenic
958600815 3:96294338-96294360 GTGAAGACAGAGAGAGAAGGTGG - Intergenic
958610443 3:96417243-96417265 GTGAAAATTTAGAGAGATCATGG + Intergenic
958904489 3:99927039-99927061 GGGAAGATATGGAGTGAAGATGG - Intronic
958989510 3:100826164-100826186 GTGAGGATACAGTGAGAAGGTGG + Intronic
959208187 3:103340588-103340610 CTGAAAATATAAAGAGAAGGTGG + Intergenic
959231354 3:103656329-103656351 GTGAAGATGTAGGGAGAAGGCGG + Intergenic
959355142 3:105317370-105317392 ATGAAGAAATAGGGAAAAGATGG - Intergenic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
959497971 3:107073258-107073280 GTGAAGATACTGGAAGAAGATGG - Intergenic
959527923 3:107398361-107398383 GTGAAGAGATAGAGAAAAAAAGG + Intergenic
959544242 3:107575229-107575251 GTGAAGGTAGAGAGAGGAAAAGG - Intronic
959643682 3:108672055-108672077 GTGAAGTTATAGTGGGAAGACGG - Intronic
959747374 3:109792438-109792460 GTGAGGACATAGTGAGAAGGCGG + Intergenic
960201301 3:114839757-114839779 GAGAAGACAGAGAGAGCAGAAGG + Intronic
960320134 3:116224553-116224575 GTGAAGATATGCAGAAAAAAAGG - Intronic
960374069 3:116877210-116877232 TTGAGGATAGAAAGAGAAGATGG - Intronic
960436110 3:117628798-117628820 GTGGTGAGAGAGAGAGAAGAAGG - Intergenic
960463052 3:117960347-117960369 GTGAAGACACAGTGAGAAGGCGG + Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
960851538 3:122059876-122059898 GTGAAGACACAGGGCGAAGACGG + Intronic
961165477 3:124760570-124760592 GTGAAGACACAGTGAGAAGGTGG - Intergenic
961563738 3:127748621-127748643 GTGAGGACACAGGGAGAAGACGG + Intronic
961580283 3:127875243-127875265 GTGAAGACACAGGGAGAAGATGG - Intergenic
961928424 3:130508246-130508268 GTGAATACACAGAGAGAAGGCGG + Intergenic
961973670 3:130997983-130998005 ATGAAAATTTAGAGAGAAGTTGG + Intronic
962073849 3:132059592-132059614 GTGAAGACACAGGGAGAAGATGG - Intronic
962327770 3:134450062-134450084 GTGAAGATTGAAAGGGAAGAAGG - Intergenic
962349221 3:134644552-134644574 AGGAAGCTATAGAGAGAAGATGG - Intronic
962456275 3:135568246-135568268 GTAAAGATAAAGAGAAAGGAAGG + Intergenic
962599952 3:136984197-136984219 CTGAAGATAAAGAGAGGACAAGG + Intronic
963044135 3:141090082-141090104 GAGAAGAGAGGGAGAGAAGAGGG - Intronic
963291705 3:143496943-143496965 GTGAGGACATAGCGAGTAGATGG - Intronic
963315839 3:143757861-143757883 GTGAAGATAACGAGATAAGGAGG + Intronic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
963943524 3:151119427-151119449 GTGAAGACACAGTGAGAAGGTGG - Intronic
964033722 3:152169892-152169914 GTGAGGATACAATGAGAAGATGG - Intergenic
964209978 3:154215691-154215713 GTGAGGACATAGGGAGAAGGTGG - Intronic
964307615 3:155357619-155357641 GTGAGGATACAGTGAGAAGGTGG + Intergenic
964450405 3:156807133-156807155 GGGAAGATAAAAAGAGAAGTTGG - Intergenic
964523737 3:157594998-157595020 GTGAAAACACAGAGAGAAAATGG + Intronic
964532383 3:157682508-157682530 GTGAAGACATAGTGAGAAGATGG - Intergenic
964562909 3:158018308-158018330 GTGAAGACACAGGGAGAAGGTGG - Intergenic
964762249 3:160145620-160145642 GTGAGGACATAATGAGAAGATGG - Intergenic
964870170 3:161305311-161305333 GTGAAGATAAAAGGAGAATATGG + Intergenic
965238362 3:166158035-166158057 ATGAAGATACAAGGAGAAGATGG + Intergenic
965307995 3:167092369-167092391 GTGAGGACATAGTGAGAAGGTGG - Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965779948 3:172274778-172274800 GTGAAGACAGAGGGAGAAAATGG - Intronic
965797560 3:172457232-172457254 GTGAGGATGCAGTGAGAAGATGG - Intergenic
965987466 3:174773224-174773246 GTATAGAAATAGAGAGGAGAAGG + Intronic
965997201 3:174898287-174898309 CTCATGATATAGAGAGTAGAAGG + Intronic
966104081 3:176313959-176313981 GTGAAGACACAGTGAGAAGGTGG - Intergenic
966170658 3:177076337-177076359 GTGAAGACACAGGGAGAACATGG - Intronic
966577757 3:181522093-181522115 GTGAGGACACAGTGAGAAGACGG - Intergenic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967112466 3:186306376-186306398 GTAGAGATATAGAGAAAAGGAGG + Intronic
967226410 3:187295818-187295840 GTGAAGACGTAGGGTGAAGATGG + Intergenic
967360623 3:188626600-188626622 GTGAGGACACAGAGAGAAGGTGG - Intronic
967526820 3:190504617-190504639 GTGGAGATATAGAGAACAAAGGG - Intergenic
967536165 3:190605695-190605717 GTAAAGACAAGGAGAGAAGATGG - Intronic
968439311 4:613589-613611 GTGAGGATACAGCGAGAAGGTGG - Intergenic
969040696 4:4293522-4293544 CTGACCATATACAGAGAAGATGG - Intronic
969092443 4:4705087-4705109 GTAAAGACACAGGGAGAAGATGG + Intergenic
969125725 4:4946418-4946440 GTGAAGACACAGGGAGAAGACGG + Intergenic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969272145 4:6110288-6110310 GTGAAGACACAGGGAGAAGGCGG + Intronic
969275854 4:6135335-6135357 GTGAGGACATGGGGAGAAGACGG + Intronic
969286348 4:6204748-6204770 GTGGAGACACAGTGAGAAGATGG + Intergenic
969493137 4:7511274-7511296 GTGCAGAGAGAGAGAGAAGGAGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969635508 4:8367105-8367127 GTGAAGACAAAGAAATAAGAAGG + Intronic
969995934 4:11313287-11313309 GTAAAGACATAGTGAGAAGGTGG + Intergenic
970128811 4:12843981-12844003 GTGAAGATGCGGGGAGAAGATGG - Intergenic
970191529 4:13523372-13523394 GTGAAGCTAAAGAGGGATGAGGG - Intergenic
970215869 4:13759663-13759685 TTGAAGATATAGAGTGAAAGGGG + Intergenic
970374993 4:15448041-15448063 ATGAAGACACAGTGAGAAGATGG + Intergenic
970558679 4:17261043-17261065 GTGAGGATACACTGAGAAGACGG - Intergenic
970648216 4:18147475-18147497 GTGAAGACACAGGGAGAACAGGG - Intergenic
970669008 4:18374733-18374755 GTGAGGACACAGACAGAAGATGG + Intergenic
970755748 4:19424144-19424166 TTGAAGTTATAAACAGAAGAGGG - Intergenic
970775067 4:19663894-19663916 GTGAGGATATAGCCAGAAGGTGG + Intergenic
970874940 4:20858285-20858307 GTGAAGATGGAGTGGGAAGATGG + Intronic
970974226 4:22024514-22024536 GTGAGGACATAGTGAAAAGATGG - Intergenic
971137677 4:23887749-23887771 TTAAAGAGAGAGAGAGAAGAAGG + Intronic
971161365 4:24137235-24137257 GGGAAGACACAGGGAGAAGACGG + Intergenic
971193830 4:24453115-24453137 GTGAAGATACAGGGAGAAGATGG + Intergenic
971222088 4:24717570-24717592 GTGAGGACACAGAGAGAAGGAGG + Intergenic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
971251877 4:24979424-24979446 GAGAAGACATGGAGAGAAGTGGG + Intronic
971285080 4:25281152-25281174 GTTCAGATAATGAGAGAAGAGGG + Intergenic
971353375 4:25872469-25872491 GTGAAGAGCCAGAGAAAAGATGG + Intronic
971357147 4:25905476-25905498 GTTAAGATACAATGAGAAGACGG + Intronic
971493166 4:27235983-27236005 GTGAAGGAATAGAGATAAGCAGG + Intergenic
971511322 4:27428783-27428805 GTGAGGACACAGTGAGAAGATGG - Intergenic
971645238 4:29191040-29191062 GTCAAGATAAAGGGAGAATATGG - Intergenic
971753016 4:30675706-30675728 GTGAGGTTACAGTGAGAAGAAGG + Intergenic
972009253 4:34155590-34155612 GCCAAGTTATAGTGAGAAGATGG - Intergenic
972262320 4:37421941-37421963 GTGAGGACACAGCGAGAAGATGG - Intronic
972381135 4:38521576-38521598 GGGAAGACACAGAGAGAAGATGG + Intergenic
972394439 4:38646609-38646631 GTGAAGACAAAGGGAGAAGAGGG + Intergenic
972576036 4:40352566-40352588 GGAAAGAGAGAGAGAGAAGATGG - Intronic
972662151 4:41126741-41126763 GTGAAGACATAGGGATAAGACGG - Intronic
972668199 4:41188525-41188547 GTGAGGACACAGTGAGAAGATGG + Intronic
972956870 4:44403567-44403589 GTGAAGATAGAGTGAGAAGGTGG - Intronic
973077564 4:45948347-45948369 GACAAGTTATAGAGAGTAGAGGG - Intergenic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
973698393 4:53513338-53513360 ATGAAGATATGGACAGTAGAAGG + Intronic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974616245 4:64286425-64286447 GAGAAGCTAGAGACAGAAGAAGG + Intronic
974719514 4:65719453-65719475 GTGACATTATAGTGAGAAGATGG - Intergenic
974905990 4:68057834-68057856 GTGAAGAGATAAAGATAATATGG + Intronic
975181274 4:71348506-71348528 GGGAGGATACAGGGAGAAGAAGG + Intronic
975225487 4:71866411-71866433 GTGACAATACAGTGAGAAGATGG + Intergenic
975364443 4:73512298-73512320 GAGAGGAGATAGAGAGTAGAGGG - Intergenic
975421353 4:74167700-74167722 CTGAAGATCTGGAGAGAACATGG + Intronic
975600431 4:76094076-76094098 ATGAGGATATAGTGAGAAGGTGG + Intronic
975615091 4:76238021-76238043 GTAATGATATAGAGAGGAGAAGG + Intronic
975818718 4:78247522-78247544 GTGAAGAAAGAAAGAGAGGAAGG - Intronic
975914383 4:79306380-79306402 GTGAAGATACAGGGAGAAAATGG - Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976153403 4:82115961-82115983 GTGAACACACAAAGAGAAGATGG + Intergenic
976574009 4:86647800-86647822 GAGAAGACATAGAGAGAAGATGG + Intronic
976741588 4:88362517-88362539 GTGATGACATAGAAAGAAAAGGG - Intergenic
976763212 4:88572076-88572098 GTGAAGTCACAGGGAGAAGAGGG + Intronic
977011766 4:91644190-91644212 GTGAGGATATAGCAAGAAGTTGG - Intergenic
977247166 4:94646358-94646380 GTGAAGACACATGGAGAAGATGG + Intronic
977358138 4:95972083-95972105 GTGAGGTTACAGTGAGAAGATGG - Intergenic
977419408 4:96778953-96778975 GTAAAGACAGGGAGAGAAGATGG + Intergenic
977441290 4:97071033-97071055 ATGAAGATACAGGGAGAAGATGG + Intergenic
977638587 4:99329535-99329557 GTGAGGATACAGAGGGAAGGTGG + Intergenic
977660406 4:99579011-99579033 CAGAAGACATAGAGATAAGAGGG + Intronic
977673136 4:99718527-99718549 GTGAAGCCACAGGGAGAAGATGG + Intergenic
977882803 4:102225132-102225154 GTGAGGATATAGTGAGAACGCGG - Intergenic
977895578 4:102361144-102361166 GTAAAGACAGAGGGAGAAGATGG + Intronic
978048781 4:104168718-104168740 ATTAAGATGTAGAGAGAATAAGG - Intergenic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
978630875 4:110742790-110742812 GTGAGGACATAGTGAGAGGATGG - Intergenic
978963947 4:114719114-114719136 GTGAAGTTATAGTGAGAAGATGG - Intergenic
978996764 4:115166339-115166361 TTGAACACATAGAGAGTAGAAGG - Intergenic
979100448 4:116605641-116605663 GTGAAGATACAGTGAGAAGTCGG - Intergenic
979565265 4:122147593-122147615 GTGAAGACACAGGAAGAAGATGG + Intergenic
979646026 4:123070527-123070549 GTGAGGACACAGTGAGAAGATGG - Intronic
979788284 4:124745017-124745039 GTGAAGATATGGTAAGATGAAGG + Intergenic
980449889 4:132957639-132957661 GTCAAGATACAGAGGGAAGGTGG + Intergenic
980511864 4:133802037-133802059 GTGAAGACTGAGAGAAAAGAAGG - Intergenic
980812538 4:137901356-137901378 GTGAGGACACAGGGAGAAGATGG - Intergenic
980967779 4:139539854-139539876 GTGAGGATATCAGGAGAAGATGG + Intronic
981135300 4:141204316-141204338 GTGAGAATTGAGAGAGAAGAAGG + Intronic
981272057 4:142856826-142856848 GTGAAGATATGATGAGAAGATGG - Intergenic
981444434 4:144819309-144819331 GTGAAGACACAGGAAGAAGACGG - Intergenic
981856152 4:149295355-149295377 GTGAAGACACAGGGAGAAGATGG + Intergenic
982089335 4:151866903-151866925 GAGAAGAGGCAGAGAGAAGACGG - Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982611763 4:157583099-157583121 GTGAAGATACGATGAGAAGATGG + Intergenic
982646805 4:158034125-158034147 GTGAAGACACGGTGAGAAGACGG - Intergenic
982688759 4:158524872-158524894 GTGAAGATATAGGAAATAGAAGG + Intronic
982699169 4:158639919-158639941 GTGAAGACAGACAGAGAAGATGG + Intronic
982729432 4:158940175-158940197 GTAAAGACACAGGGAGAAGATGG - Intronic
982775959 4:159441617-159441639 GTGAAGGCAAAGGGAGAAGATGG - Intergenic
982969572 4:161966629-161966651 GTGAAGACACAGAGAAAACATGG + Intronic
983010512 4:162540002-162540024 TTGGAGACATAGTGAGAAGAAGG - Intergenic
983112580 4:163771502-163771524 GTGAAGATACAGCAAAAAGATGG - Intronic
983159553 4:164394416-164394438 GTGAAGATGCAGAGAGAATGTGG - Intergenic
983363258 4:166755362-166755384 GAGCAGGTATAGAGAGATGACGG + Intronic
983849129 4:172558513-172558535 GTGAGGATACAGAGAGAAGGTGG + Intronic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
984120841 4:175741227-175741249 GGAAAGATACAGAGAGAAAAGGG - Intronic
984191123 4:176606935-176606957 GTGAAGATGGAGAGAGAGGCTGG + Intergenic
984222843 4:176999422-176999444 TTGAATATATACACAGAAGAGGG - Intergenic
984382746 4:179015960-179015982 GTGAAGATGGAGAGAGAGGCTGG - Intergenic
984731932 4:183076385-183076407 ATGAAAATATAGGGAGAAGATGG - Intergenic
984740669 4:183158440-183158462 GTGAAGACACAAGGAGAAGACGG - Intronic
984763228 4:183379948-183379970 GTGAGGATGTGGTGAGAAGATGG + Intergenic
984910285 4:184668045-184668067 GTGAGGATAGAGTGGGAAGAGGG - Intronic
984928698 4:184827664-184827686 GAGGAGACATAGGGAGAAGATGG - Intergenic
984981891 4:185290020-185290042 GTGAAGACACATGGAGAAGATGG - Intronic
985003826 4:185512906-185512928 GGGAACACATAGAGAGAAGCAGG + Intronic
985040043 4:185880986-185881008 GTGAAGAAAAAGAGAAAGGAAGG + Intronic
985075469 4:186209617-186209639 GTGAAGACATAAGGAGAAAATGG - Intronic
985519003 5:362198-362220 GTGAAGATGCAGTGAGAAGGTGG + Intronic
985641305 5:1064660-1064682 GTGAAGGGATAGCGAGGAGACGG + Intronic
985690981 5:1312180-1312202 GTGAGGACACAGGGAGAAGACGG + Intergenic
985715051 5:1452434-1452456 GTGAAGATAGAGTAAGAAGGCGG + Intergenic
985829507 5:2217735-2217757 GTGAAGGTTGAAAGAGAAGACGG - Intergenic
985944632 5:3168443-3168465 ATGAAGATACAGCAAGAAGATGG + Intergenic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986059823 5:4177568-4177590 GTGAAGATACAGCAAGAAAATGG - Intergenic
986257828 5:6115375-6115397 GTGAGGTTAGAGTGAGAAGATGG + Intergenic
986279347 5:6310940-6310962 GTGACAATGCAGAGAGAAGACGG + Intergenic
986463612 5:7998325-7998347 GAGAAGACACAGGGAGAAGATGG - Intergenic
986543200 5:8869045-8869067 GTGATGATACACTGAGAAGATGG - Intergenic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
986751479 5:10791850-10791872 GTGAAGACACAGGGAGAAGACGG + Intergenic
986768779 5:10952605-10952627 GTGAAGGTAGAGTGAGAAGACGG + Intergenic
986902363 5:12452164-12452186 GTGAGGAGAGAGAGAGAAGGCGG + Intergenic
986928545 5:12790347-12790369 GAGTAGAAATAGAGAGATGAGGG + Intergenic
987042081 5:14072394-14072416 GTGAAAATGGAGATAGAAGATGG - Intergenic
987173191 5:15280097-15280119 GTGAAGACACAGGGAGAAGCTGG + Intergenic
987198857 5:15554291-15554313 GGGGAGATATAGAGTGAGGAAGG - Intronic
987201229 5:15580182-15580204 GTGAGGATACAGCAAGAAGATGG + Intronic
987222541 5:15805030-15805052 GTGAAGACACAGGGAGAAGATGG - Intronic
987564669 5:19568667-19568689 GTGAAAATATAGGGAGAAGAGGG + Intronic
987707916 5:21478923-21478945 GTGAGGATACTGAGAGAAGATGG - Intergenic
987729415 5:21749213-21749235 GTGAACACACAGAGAGAAGACGG + Intergenic
987772447 5:22323781-22323803 TTTAAGTTATAGAAAGAAGAGGG + Intronic
987826135 5:23033503-23033525 GTGAGGATACAAGGAGAAGATGG + Intergenic
987826763 5:23040197-23040219 GTGAAAAGACAGGGAGAAGATGG + Intergenic
987840579 5:23218360-23218382 GTGAAGATACAGTGAGAAGGTGG - Intergenic
987869565 5:23597670-23597692 GTGAAGACACAAGGAGAAGATGG + Intergenic
987899117 5:23988122-23988144 GTGACAATATAGTGAGAAGGTGG + Intronic
988029423 5:25743519-25743541 GTGAAGACACAGTGAGAAGGTGG - Intergenic
988035165 5:25818248-25818270 GTCAAGATACAGGGAGAAGATGG + Intergenic
988123254 5:26994590-26994612 GTGAAGATACAATGAGAAAATGG + Intronic
988129540 5:27085104-27085126 GTGAAGATATAGAAATAAAATGG + Intronic
988205836 5:28132720-28132742 GTGAATATATAAAGGGGAGAGGG + Intergenic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988351991 5:30120500-30120522 GTGAAGAGACAGTGAGAAGGTGG + Intergenic
988422815 5:31026889-31026911 ATGAAGACACAGGGAGAAGATGG + Intergenic
988522732 5:31961003-31961025 GTGATGTTATAAAGAGAATATGG - Intronic
988663070 5:33294688-33294710 TTAAAGATATAGAGACCAGAAGG + Intergenic
988751866 5:34196014-34196036 GTGAGGATACTGAGAGAAGATGG + Intergenic
988909031 5:35821108-35821130 GAGAAGATACAGAAAGCAGAGGG - Intergenic
989001958 5:36770609-36770631 GTGAAGGCACAGAGAGAAAATGG - Intergenic
989066437 5:37467355-37467377 GTGAGGATACTGAGAGAAGATGG - Intronic
989254889 5:39355820-39355842 GTGAAGACACAGGGAGAAGATGG - Intronic
989801279 5:45543956-45543978 GTAAAGAGATTAAGAGAAGATGG + Intronic
990076779 5:51855396-51855418 TTGAAGATACAGGGAAAAGATGG + Intergenic
990389166 5:55300973-55300995 GTGAACATATAGCAAGATGATGG - Intronic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990723078 5:58720228-58720250 TTGTAGATATATAGAGAATATGG + Intronic
991021790 5:61987032-61987054 GTGAAGACACAGTGAGAAGATGG + Intergenic
991044285 5:62206714-62206736 GTGGAGAGAGAGAGATAAGAAGG + Intergenic
991119663 5:62997101-62997123 GTGAAGTAACAGTGAGAAGATGG - Intergenic
991247982 5:64528144-64528166 CCGAAGATCTAGGGAGAAGACGG + Intronic
991288477 5:65007557-65007579 GTGAGGATACAGCAAGAAGATGG - Intronic
991296193 5:65084245-65084267 GAGAAGACATAGGGAGGAGATGG - Intergenic
991335884 5:65546735-65546757 GTGAAGACACAGGAAGAAGATGG + Intronic
991492281 5:67195028-67195050 GAGAGGACACAGAGAGAAGATGG + Intronic
991737194 5:69638799-69638821 GTGAGGATACCGAGAGAAGATGG + Intergenic
991739631 5:69656831-69656853 GTGAGGATACCGAGAGAAGATGG + Intergenic
991757871 5:69896346-69896368 GTGAGGATACCGAGAGAAGATGG - Intergenic
991788768 5:70218525-70218547 GTGAGGATACCGAGAGAAGATGG + Intergenic
991791206 5:70236572-70236594 GTGAGGATACCGAGAGAAGATGG + Intergenic
991813519 5:70493631-70493653 GTGAGGATACCGAGAGAAGATGG + Intergenic
991816651 5:70514914-70514936 GTGAGGATACCGAGAGAAGATGG + Intergenic
991819091 5:70532955-70532977 GTGAGGATACCGAGAGAAGATGG + Intergenic
991837274 5:70772228-70772250 GTGAGGATACCGAGAGAAGATGG - Intergenic
991881215 5:71218889-71218911 GTGAGGATACCGAGAGAAGATGG + Intergenic
991883652 5:71236913-71236935 GTGAGGATACCGAGAGAAGATGG + Intergenic
992142954 5:73817885-73817907 GTAAAGATACACAGAGGAGAGGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992419664 5:76590378-76590400 GTAAAGAGAGAGAGAGAAAAAGG - Intronic
992428078 5:76678967-76678989 GTTCATATATAGAGAAAAGAAGG - Intronic
992883806 5:81137671-81137693 GTGAAGACACAGGAAGAAGACGG + Intronic
992987686 5:82250475-82250497 GTGGGGATACAGTGAGAAGATGG - Intronic
993003878 5:82410566-82410588 GTGAAGACACAGAACGAAGATGG + Intergenic
993078937 5:83271734-83271756 GGGAAGAGAGAGAGAGAAAAGGG + Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993312696 5:86356194-86356216 GTGAGAACATAGGGAGAAGATGG - Intergenic
993358709 5:86946613-86946635 GTGAAGATACAGTGAGAAGTTGG - Intergenic
993383667 5:87237463-87237485 GTGAGGACATAGTGAGAAGATGG + Intergenic
993504539 5:88693782-88693804 GAGAAGGTAGAGAGAGATGAGGG + Intergenic
993593298 5:89822951-89822973 GTGAAGACACAGTGAGAATATGG + Intergenic
993644413 5:90445217-90445239 GTGAGGTTACAGTGAGAAGATGG + Intergenic
993687556 5:90958640-90958662 GTGAAGACAAAGGGAGATGATGG - Intronic
993760732 5:91793572-91793594 GTGTATATATAGAGAGAGGGGGG - Intergenic
993830694 5:92753877-92753899 ATGAAGAAACAGGGAGAAGATGG + Intergenic
994117249 5:96074443-96074465 GTGAAGACACAGTGAGAAGGTGG + Intergenic
994282498 5:97922233-97922255 GAGAAGACACAGAGAGAATATGG - Intergenic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
994419984 5:99519901-99519923 GTGAGGATACTGAGAGAAGATGG - Intergenic
994466756 5:100144354-100144376 AGCAATATATAGAGAGAAGATGG - Intergenic
994487226 5:100395241-100395263 GTGAGGATACTGAGAGAAGATGG + Intergenic
994649770 5:102511934-102511956 GTGAGGACACAGTGAGAAGATGG - Intergenic
994717848 5:103345375-103345397 GTGAGGATATAATGAGAAGATGG + Intergenic
994925125 5:106106126-106106148 GAGAAGATAAAGGGAGATGAAGG + Intergenic
994942916 5:106347990-106348012 TAGAAGATAGTGAGAGAAGAAGG + Intergenic
994965870 5:106670085-106670107 GAGCAGAGAAAGAGAGAAGAGGG - Intergenic
994987546 5:106956510-106956532 GGGAAGACGTTGAGAGAAGAGGG + Intergenic
995173243 5:109142132-109142154 GTGAAGATAGAGTGGGAAGGAGG + Intronic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
995673634 5:114636519-114636541 GTGGTGAGAGAGAGAGAAGAGGG + Intergenic
995707850 5:115003571-115003593 GGGAAGATATGGATAGAGGAGGG - Intergenic
995837071 5:116409624-116409646 ATGAAGGCATAGGGAGAAGATGG + Intronic
995964791 5:117891755-117891777 GTAAGGATATAGTGAAAAGACGG + Intergenic
996139767 5:119892466-119892488 GTGATGATACAGAGAGAAGGTGG + Intergenic
996263269 5:121500884-121500906 GTGAAGACACAGGGAGAAGATGG + Intergenic
996272619 5:121625193-121625215 ATGCAGACTTAGAGAGAAGAGGG + Intergenic
996486961 5:124047092-124047114 GTGAAGAGAAAGAGAGAGGAGGG + Intergenic
996509118 5:124299295-124299317 GTGAAGACACAGGGAGAAGATGG - Intergenic
996752236 5:126900465-126900487 GTGAGGACATAGACAGAAGTTGG + Intronic
996766552 5:127040210-127040232 GTGATGAGGTAGATAGAAGATGG + Intergenic
997205717 5:132048377-132048399 GTGAGGTTATAGCAAGAAGATGG + Intergenic
997345930 5:133192026-133192048 GTGAGGACACAGTGAGAAGATGG + Intergenic
997621339 5:135298207-135298229 GTGAAGACATAGCAAGAAGCAGG + Intronic
997774908 5:136594698-136594720 GTTAAGACACAGGGAGAAGATGG - Intergenic
998393616 5:141804100-141804122 GAGGAGAGAGAGAGAGAAGAAGG - Intergenic
998512549 5:142725371-142725393 GTGAGGACATAGTGAGAAGGTGG - Intergenic
998652836 5:144140814-144140836 GTGAAGACACAGGGAGAAGATGG + Intergenic
998713859 5:144858201-144858223 GTGAATATATATATATAAGATGG + Intergenic
998716121 5:144886612-144886634 GTGAAGAAAAAAAAAGAAGAAGG + Intergenic
998783424 5:145683529-145683551 GTGAGGACATAGCGAGAAGGTGG - Intronic
998798300 5:145841929-145841951 GTGAAGAAAGAGAGAGACGAAGG + Intergenic
999340555 5:150766980-150767002 CTGAAGATATAGAAAGAAGAAGG + Intergenic
999503466 5:152170250-152170272 GTGAAGATAGAGATAGTAAATGG + Intergenic
999670419 5:153954715-153954737 GTGAGGACACAGTGAGAAGAAGG - Intergenic
999672651 5:153971365-153971387 GTGAGGATGGAGAGAGGAGATGG - Intergenic
999907840 5:156163035-156163057 GAAAAGATGTAGAGAGAAGCTGG - Intronic
999950279 5:156642083-156642105 GTGAAGATACAGTAAGATGATGG - Intronic
1000616327 5:163432058-163432080 GAGAAGAGAGAGACAGAAGAGGG - Intergenic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000799029 5:165701257-165701279 GTGAAGACATAGAAGGAAGGTGG + Intergenic
1000803219 5:165754733-165754755 GTGAAGACGTAGGGAAAAGATGG - Intergenic
1000820835 5:165981547-165981569 GTAAAGACATAAGGAGAAGATGG - Intergenic
1000836363 5:166159776-166159798 CCGAAGATATTGATAGAAGATGG + Intergenic
1000910701 5:167018646-167018668 ATGAAGATACAGAGATTAGATGG - Intergenic
1000922784 5:167158619-167158641 GTGAAGATATAAGGAGAAGATGG - Intergenic
1000959692 5:167585153-167585175 TGGAAAATAGAGAGAGAAGAAGG - Intronic
1001140104 5:169137283-169137305 ATGTAGATAGAAAGAGAAGAGGG - Intronic
1001852615 5:174982732-174982754 GTGAAGACACAGGGAGAAGATGG - Intergenic
1001876970 5:175210135-175210157 GTGAAGACCCAGAGAGAAGGTGG - Intergenic
1002531821 5:179851464-179851486 GTAAAGATATAGGGAGAAGCTGG + Intronic
1003265615 6:4562773-4562795 GTGAAAACACAGGGAGAAGATGG + Intergenic
1003266887 6:4573892-4573914 GGGGAGAGAAAGAGAGAAGAAGG - Intergenic
1003402054 6:5798654-5798676 GTGAGGACATAGTGAGAAGTTGG - Intergenic
1003699930 6:8452252-8452274 GTCATGATGTAGAAAGAAGATGG + Intergenic
1003844165 6:10155494-10155516 GTCAGGATTTAGAGAGAAAATGG + Intronic
1003875746 6:10434751-10434773 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1003877032 6:10447062-10447084 GTGAGGACACAGGGAGAAGATGG - Intergenic
1004043526 6:12006114-12006136 GTGAGGACACAGAGAGAAGGTGG + Intergenic
1004088996 6:12480182-12480204 GTGAGGACACAGGGAGAAGATGG + Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004255743 6:14062352-14062374 GTGAAGATACTGGAAGAAGATGG + Intergenic
1004483963 6:16048179-16048201 GAAAATATATAGTGAGAAGACGG - Intergenic
1004668279 6:17769963-17769985 ATGAAGAAATAGAGGGAAAATGG + Intronic
1004773407 6:18812951-18812973 AAGGAGATATAGAGAGAAAATGG + Intergenic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1004897412 6:20162004-20162026 GGGAAGACACAGGGAGAAGACGG - Intronic
1005121671 6:22396859-22396881 GTAAAGACACAGAGAAAAGATGG + Intergenic
1005159514 6:22843006-22843028 GTGAGGATACAAGGAGAAGATGG - Intergenic
1005330189 6:24742218-24742240 GTGAAAGGATAGAGAGAATAGGG + Intergenic
1005368517 6:25105167-25105189 GTGAAGAGACAGAGTAAAGATGG + Intergenic
1005442668 6:25887427-25887449 GTGGGGATACAGGGAGAAGACGG - Intergenic
1005550029 6:26902717-26902739 GTGAGGATACTGAGAGAAGATGG + Intergenic
1005683365 6:28228394-28228416 GTGAGGATACAGCAAGAAGATGG - Intronic
1005773076 6:29097256-29097278 TTAAAGATCCAGAGAGAAGAAGG + Intergenic
1006068862 6:31482597-31482619 GACAAGATAGAGGGAGAAGATGG - Intergenic
1006209448 6:32382926-32382948 ATGATGAGAGAGAGAGAAGAGGG - Intergenic
1006843440 6:37046794-37046816 GTGAAGAGAAAGAGAGAAGACGG + Intergenic
1006956146 6:37874161-37874183 GTGAACACACAGGGAGAAGATGG - Intronic
1007002583 6:38328420-38328442 GTGAGGGTATAGCGAGAAGGTGG + Intronic
1007246488 6:40466966-40466988 GGGAAGACAGAGGGAGAAGACGG + Intronic
1007835139 6:44668220-44668242 GGGACGAGAAAGAGAGAAGAGGG + Intergenic
1008142053 6:47843396-47843418 GTGAGGACACAGTGAGAAGATGG - Intergenic
1008287159 6:49667809-49667831 GTGAGCCTATAGAGAGGAGAAGG - Intergenic
1008491408 6:52090589-52090611 CTGAAGAAATAAAGAGAGGAGGG - Intergenic
1009020292 6:57941616-57941638 GTGAGGATACTGAGAGAAGATGG + Intergenic
1009354918 6:62731352-62731374 GTGAAGTTACAGAAAGAAGGTGG - Intergenic
1009422942 6:63483733-63483755 GTAAAGACATAGGGAGAAGATGG - Intergenic
1009961150 6:70522880-70522902 GTGAAAATAAAGACAGAATATGG - Intronic
1010273323 6:73939693-73939715 GTGAAGACACAGGGAGAAGATGG + Intergenic
1010504240 6:76636896-76636918 GTGAAGATACAGCAAGAAGATGG + Intergenic
1010580029 6:77584822-77584844 GTGAAGATATAGCGAGATGGTGG - Intergenic
1011300862 6:85872239-85872261 GAAAAGAAAGAGAGAGAAGAAGG - Intergenic
1011443446 6:87411922-87411944 GTGAGGATGCAGAGAAAAGATGG + Intronic
1011542597 6:88448222-88448244 GTGAAGATGTGGAGAGAAATTGG + Intergenic
1011613470 6:89176552-89176574 GTGAAGACACAGTGGGAAGATGG + Intergenic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1011648035 6:89478841-89478863 GTGAAGAGACATAGAGAAGATGG + Intronic
1011756095 6:90499626-90499648 GTGAGGACACAGTGAGAAGATGG - Intergenic
1012015016 6:93838953-93838975 GGGAAGACACAGAGAGCAGATGG - Intergenic
1012180177 6:96143232-96143254 GTGATGACACAGTGAGAAGATGG + Intronic
1012297938 6:97547822-97547844 GTGAAGATACAAGAAGAAGATGG - Intergenic
1012311083 6:97724657-97724679 GTGAGTATATGGAGAGAAAACGG + Intergenic
1012352061 6:98264142-98264164 GTGAGGACACAGTGAGAAGATGG - Intergenic
1012794482 6:103742300-103742322 CTGAAGATATAGAAAGACGGAGG - Intergenic
1012807484 6:103912977-103912999 GTGAAAACCTAGGGAGAAGATGG - Intergenic
1013346242 6:109263380-109263402 GTGAAGGCAGAGGGAGAAGATGG + Intergenic
1013497282 6:110710637-110710659 GTGAGGTTACAGTGAGAAGATGG - Intronic
1013559747 6:111292403-111292425 GTGATGGTACAGGGAGAAGACGG + Intergenic
1013688520 6:112613022-112613044 GGGAAGATAAGGAAAGAAGAGGG + Intergenic
1013710947 6:112897746-112897768 GTGAAGACACAGTGAGATGATGG - Intergenic
1013799501 6:113925491-113925513 GTGAAGATACAGTGAGAAGATGG - Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1013865377 6:114690210-114690232 ATGAAGACATAGGAAGAAGATGG - Intergenic
1013986799 6:116203838-116203860 GTGAAGATATTGAGAATATAAGG - Intronic
1014060309 6:117064063-117064085 GTGAAGACACAGTGAGAAGGTGG + Intergenic
1014072578 6:117200299-117200321 TTGTAGAGAAAGAGAGAAGAGGG - Intergenic
1014143161 6:117966698-117966720 GTGAAGACACAGGGAGAAGATGG - Intronic
1014153667 6:118087205-118087227 GTGAAGACACAAGGAGAAGATGG - Intronic
1014490081 6:122052276-122052298 GTGAAAGGATAGAGAGAGGAAGG + Intergenic
1014645178 6:123964504-123964526 GAGATGATATAGAGATGAGAAGG - Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1014736671 6:125101967-125101989 CTGAAGACATAAAGAAAAGATGG + Intergenic
1014761304 6:125359737-125359759 GAGAAGAGAGAGGGAGAAGAGGG + Intergenic
1014909018 6:127066599-127066621 GTGAAGACAGAGAGAGAAAATGG + Intergenic
1014943368 6:127469619-127469641 TTGAAGTTATAGGGAAAAGATGG + Intronic
1014961676 6:127694607-127694629 GTGAAGACAGAGGGAGAAGATGG - Intergenic
1015104728 6:129522412-129522434 GTGAAGGTGAAGAGAGATGACGG + Intergenic
1015298775 6:131629295-131629317 GTGAAGACACAAGGAGAAGAAGG - Intronic
1015348726 6:132191639-132191661 GTGAAAATAGAGAGAGGAGGGGG + Intergenic
1015556780 6:134470725-134470747 AGGAAGAGAGAGAGAGAAGAAGG - Intergenic
1015719710 6:136228448-136228470 GTGAAGACACAGCAAGAAGATGG + Intergenic
1015899416 6:138049329-138049351 GTGTATATATAGAGAGACAAAGG - Intergenic
1015914861 6:138205470-138205492 ATGAAGATAGAGTGAGAAGTAGG - Intronic
1016090233 6:139969117-139969139 GTGAACATACACAAAGAAGACGG - Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016540385 6:145157883-145157905 GTGAGGATACAGTGAGAAGATGG + Intergenic
1016582213 6:145641365-145641387 GTGAAGATACAGGGAGAAGATGG + Intronic
1016645921 6:146408117-146408139 GTGAGGATACAATGAGAAGATGG - Intronic
1016852634 6:148636561-148636583 GTGAAGACACAGGGGGAAGATGG + Intergenic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017155180 6:151316551-151316573 GTGACGATACAGTGAGAAGGCGG - Intronic
1017695023 6:157005978-157006000 GGGAAGACAGAGAGAAAAGAGGG - Intronic
1017792883 6:157817034-157817056 GTGAGGACATAGCGAGAAGATGG + Intronic
1017918066 6:158848006-158848028 GTGAAGACACAGGCAGAAGACGG + Intergenic
1018035102 6:159875039-159875061 GTGATGATACAGGGAGAAAATGG + Intergenic
1018053034 6:160028217-160028239 GTGAAGACACAGAAAGAAAACGG - Intronic
1018269607 6:162062598-162062620 GTGAAAATATGGGGAGAAGGTGG + Intronic
1018731620 6:166656202-166656224 GTAAAGATATAAAGAAAACAAGG + Intronic
1019199750 6:170304999-170305021 GTGAGGATACAGTGAGAAGATGG - Intronic
1019375126 7:686433-686455 GGGAAGATGGAGAGAGAAGGTGG + Intronic
1019799805 7:3079948-3079970 GTGAGGACACAGGGAGAAGATGG + Intergenic
1019949105 7:4356683-4356705 GTGAAGACATAGGGAGAAGATGG + Intergenic
1020108587 7:5434859-5434881 GTGAGGACGTAGGGAGAAGACGG - Intronic
1020358969 7:7306597-7306619 GTAAAGAAATGAAGAGAAGAAGG + Intergenic
1020364731 7:7368677-7368699 GTGAAGACATAACGAGAAGGTGG + Intronic
1020468175 7:8504808-8504830 GTGAGGATATAATGAGAAGATGG + Intronic
1020549361 7:9581895-9581917 GTGAGGATACAATGAGAAGATGG + Intergenic
1020711012 7:11605161-11605183 ATGTACATATAGAGAGAGGAGGG - Intronic
1020896270 7:13944369-13944391 GTGAAGTTGCAGCGAGAAGATGG - Intronic
1021344133 7:19502589-19502611 GTGAACATATAGACACAGGAAGG + Intergenic
1021365878 7:19777114-19777136 GTGAGGATACAATGAGAAGACGG + Intergenic
1021376536 7:19914721-19914743 GTGAAGGCTGAGAGAGAAGAGGG - Intergenic
1021394555 7:20131294-20131316 GTAAAGATACAGGGAGAAGACGG + Intergenic
1021483025 7:21138989-21139011 GTGAAGAGAGAGAGCCAAGAAGG + Intergenic
1022155064 7:27652679-27652701 GTGAGGATACAGTGAGAAAATGG - Intronic
1022508805 7:30922494-30922516 GTGAAGAGAGAGTGAGAGGAGGG - Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022628492 7:32062451-32062473 GTAAAGATCTAAAGACAAGAAGG - Intronic
1022657698 7:32335569-32335591 GTAAAAATATAGGGAGAAGATGG - Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1022981065 7:35605441-35605463 GTGAGGACACAGTGAGAAGATGG + Intergenic
1023408152 7:39858373-39858395 GACAAAATATAGAGAGCAGATGG - Intergenic
1023544963 7:41308780-41308802 GTAAAGACACAGAGAGAAGACGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023597352 7:41845187-41845209 GTGAGGACATAGCGAGAAGGTGG - Intergenic
1023611359 7:41974611-41974633 GTAAGGATATAGACAGAGGAGGG + Intronic
1023624745 7:42104823-42104845 GTGAGGACACAGTGAGAAGAAGG + Intronic
1023660270 7:42463852-42463874 GTTGAGATATAGAAAGAAGATGG + Intergenic
1024032280 7:45471595-45471617 GAGAAGACAGAAAGAGAAGAAGG + Intergenic
1024048386 7:45600766-45600788 GTGAGGACACAGGGAGAAGATGG - Intronic
1024103582 7:46058734-46058756 GTGAAGATACAGGCAGAAGATGG + Intergenic
1024182945 7:46915984-46916006 GTGAAGACAAAAAGAGAAAATGG - Intergenic
1024188826 7:46984248-46984270 ATGAAGATATAGTAAGGAGAAGG + Intergenic
1024225093 7:47320571-47320593 GTGAGGACACAGGGAGAAGATGG - Intronic
1024347105 7:48324248-48324270 GTGAGGACACAAAGAGAAGATGG - Intronic
1024808861 7:53183745-53183767 GTAAGGACATAGTGAGAAGATGG - Intergenic
1025144528 7:56492624-56492646 GGGAAGATGTAGAAAGAACAGGG + Intergenic
1026054990 7:66976144-66976166 GTGAAGAAATAGAGAAAAATTGG - Intergenic
1026103439 7:67401687-67401709 GTGAAGACAGAGGGAGAAGATGG + Intergenic
1026124867 7:67570643-67570665 GGGAGGACACAGAGAGAAGACGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1026503889 7:70965942-70965964 GTGAGGATATAGGGAGAAGGTGG + Intergenic
1026509568 7:71016857-71016879 GTGAGGACACAGAGAGAAGCTGG - Intergenic
1027505501 7:79012885-79012907 GTGTGGATATAATGAGAAGATGG - Intronic
1027543177 7:79493629-79493651 GAGAGGAGAGAGAGAGAAGAGGG - Intergenic
1027694031 7:81386763-81386785 GTGAGGATACAGTGAGAAGGCGG - Intergenic
1027740847 7:82002275-82002297 GTGAGGTTAGAGTGAGAAGATGG + Intronic
1027986085 7:85292124-85292146 GTGAAGACACAGGGAGAAGATGG + Intergenic
1028202342 7:87976424-87976446 GTGAGGACACAGAGAGAAAATGG + Intronic
1028239062 7:88397459-88397481 GTGAGGATAGAGTGAGAAGGTGG + Intergenic
1028384488 7:90239273-90239295 GTGAAGTAAAAGGGAGAAGACGG + Intergenic
1028387224 7:90269756-90269778 GTGAAGAAAAAGAAAGAAGATGG + Intronic
1028411344 7:90533653-90533675 GTGAACACACAGGGAGAAGATGG - Intronic
1028650791 7:93148899-93148921 GTGAAGACACAAAGAAAAGATGG + Intergenic
1028722438 7:94049002-94049024 ATGAGGACATAGAGAGTAGAAGG + Intergenic
1028744345 7:94310215-94310237 GTGAAGACACAGCGAGAAGGTGG + Intergenic
1028749918 7:94371818-94371840 GTGAAGATGGAGGGAGAAAATGG + Intergenic
1028923158 7:96328777-96328799 GAGAAGACACAGGGAGAAGATGG - Intergenic
1029184629 7:98729826-98729848 GTGAGGACACAGGGAGAAGACGG - Intergenic
1029190796 7:98770712-98770734 GCAAAGAGACAGAGAGAAGACGG - Intergenic
1030472637 7:109985663-109985685 GTGAGGCTAGAGTGAGAAGATGG + Intergenic
1030675328 7:112379120-112379142 GAGAAGATATAAAGAGAGGAAGG - Intergenic
1030789974 7:113712488-113712510 AGAAAGATACAGAGAGAAGAGGG - Intergenic
1030823220 7:114121246-114121268 GTGAGGATACAAAGAGAAGATGG + Intronic
1030860934 7:114627547-114627569 GTGAAGAAATAGGAAGAGGATGG - Intronic
1030924223 7:115431275-115431297 GTGAAGACAAGAAGAGAAGATGG + Intergenic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1031313319 7:120227160-120227182 GGGAAGACACAGAGGGAAGATGG - Intergenic
1031357773 7:120809009-120809031 GTGAAGACACAGGGAGAAGATGG + Intronic
1031372169 7:120981705-120981727 GTGAAGATGCAGAGAGAACAGGG - Intergenic
1031446336 7:121859518-121859540 GAAAAGAGAGAGAGAGAAGAGGG - Intergenic
1031768675 7:125813601-125813623 GTGAAGATGTAGAAATAAGAGGG - Intergenic
1032083545 7:128872162-128872184 ATGGAGATATACAGAGAACAAGG - Intronic
1032155683 7:129465746-129465768 GCCAAGATATAGGGACAAGATGG + Intronic
1032337737 7:131042146-131042168 GTAAAAATACAGAGGGAAGAAGG + Intergenic
1032532013 7:132629780-132629802 GTGAGGACATAGTGAGAAGGCGG - Intronic
1032546480 7:132748060-132748082 GTGAAGACACAGAGAGAAGGTGG - Intergenic
1032602083 7:133308427-133308449 GTGAAGACACAGGGAGAAGATGG + Intronic
1032653999 7:133907796-133907818 GGAAAGAAAGAGAGAGAAGAAGG + Intronic
1032713368 7:134482644-134482666 GGGAAGATATAGTGAGAAGGTGG - Intergenic
1032751319 7:134844766-134844788 GTGAAGACACAGGGAGAAGGTGG - Intronic
1033266144 7:139888883-139888905 GTGCAGGTATAGAGTGGAGAAGG + Intronic
1033342906 7:140505889-140505911 GTGAGGATATGGGGAGAAGGTGG - Intergenic
1033946322 7:146723190-146723212 ATGGAGATACAGTGAGAAGATGG + Intronic
1034271935 7:149807388-149807410 GTGAAGAAAAAGAAAAAAGAGGG - Intergenic
1034293727 7:149952035-149952057 GTGAAGACATGGTGAGGAGAAGG - Intergenic
1034506360 7:151495092-151495114 ATGAAGTTATTGAGAGAAAAAGG - Intronic
1034564994 7:151906272-151906294 GAGAAGAGGTAGAGAGAAGTGGG + Intergenic
1034569973 7:151947658-151947680 GTGAGGACACAGGGAGAAGATGG - Intergenic
1034675838 7:152891912-152891934 ATGAAGACACAGGGAGAAGACGG + Intergenic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1034812339 7:154144818-154144840 GTGAAGACATGGTGAGGAGAAGG + Intronic
1034882217 7:154771387-154771409 GTGAAGACATGGCGAGAAGGCGG - Intronic
1035032575 7:155871011-155871033 GTGAGGACACAGGGAGAAGATGG - Intergenic
1035248186 7:157578908-157578930 ATGAAATTATAGAGTGAAGAGGG + Intronic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1036072074 8:5451909-5451931 GTCAGGACATAGGGAGAAGATGG - Intergenic
1036093045 8:5690370-5690392 GTGAAGACACAGGGAGAAGCTGG + Intergenic
1037103886 8:15080956-15080978 GTGAAGACACAGGGAGGAGAAGG + Intronic
1037179966 8:15993536-15993558 GTGAAGATACAATGCGAAGATGG + Intergenic
1037443613 8:18942667-18942689 GTGAAGACACAGGGAGAAGGTGG + Intronic
1037502050 8:19495783-19495805 GTGATGATAAAGAGAGAAGCGGG + Intronic
1037513527 8:19607445-19607467 GTGAAGATACAGACAGCTGATGG + Intronic
1037681701 8:21103002-21103024 ATGAAGGGATAGAGAGAAAATGG + Intergenic
1037983078 8:23269049-23269071 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1038120575 8:24609754-24609776 GTGAAGATACAGGGAGAAGATGG + Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1038190251 8:25313720-25313742 GTGAAGACGAAGGGAGAAGATGG - Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038556127 8:28518704-28518726 GTGAGGCTATAGAGACAAAATGG - Intronic
1039019823 8:33192690-33192712 GTGAGGACACAGTGAGAAGATGG - Intergenic
1039163504 8:34649698-34649720 GTGAAGACATAGCAAGAAGGTGG - Intergenic
1039407853 8:37328243-37328265 GAGGAGAGAGAGAGAGAAGAAGG - Intergenic
1039504555 8:38042580-38042602 GTGCAGATACAGGGAGAAGGTGG - Intronic
1039668758 8:39570294-39570316 GTGAGGTTATAGCAAGAAGATGG + Intergenic
1039715092 8:40099590-40099612 GTGAGGACAAAGGGAGAAGATGG + Intergenic
1039737196 8:40345424-40345446 GTGAGGACACAGTGAGAAGATGG - Intergenic
1039798574 8:40935547-40935569 GTGAAGACACGGGGAGAAGACGG + Intergenic
1039800409 8:40949802-40949824 GTGAAGACACAGAAAGAAGGTGG + Intergenic
1039906296 8:41788880-41788902 ATGAAGAGATAGAGAGGAGCTGG - Intronic
1040705717 8:50124210-50124232 GTGAAGACACAGGGAGAAAATGG + Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1041171849 8:55150567-55150589 GTGCAGTTATAGGGAGCAGAGGG - Intronic
1041405144 8:57490754-57490776 GTGAAGACACAGGGAGAAAATGG + Intergenic
1041439935 8:57883509-57883531 GTGAAGACACAGGGAGAAGATGG + Intergenic
1041501344 8:58542215-58542237 GTGAAAATATGGAGAGCTGATGG + Intergenic
1041578881 8:59433741-59433763 GTGAGGACACAGAGAGAAGGTGG - Intergenic
1041600450 8:59711438-59711460 GTGAAGAAGCAGAGAGAAGGTGG + Intergenic
1041644243 8:60235252-60235274 GTGAAGATAAAGGGAGAAGGTGG - Intronic
1041723143 8:60994169-60994191 GTGAAGATACAGGGAGAAGATGG - Intergenic
1042210301 8:66373479-66373501 GTGAAGATACAGGGTAAAGAAGG + Intergenic
1042422416 8:68607405-68607427 GTAAAGATATAGTGAAAAGGCGG - Intronic
1042428975 8:68681979-68682001 ATGAAGAGATAGAAAGTAGAAGG + Intronic
1042473167 8:69214177-69214199 ATGAAGACACAGGGAGAAGATGG + Intergenic
1042634644 8:70860330-70860352 GTGAAGATACAACGAGAAGTTGG + Intergenic
1043116511 8:76260880-76260902 GTGAGGATACAGAGAAAAGGGGG + Intergenic
1043138083 8:76552966-76552988 GTGAAGATATGGCAATAAGATGG - Intergenic
1043392769 8:79807628-79807650 GTGAAGACGCAGGGAGAAGACGG + Intergenic
1043546076 8:81317099-81317121 GTGAAGACAGAGGGAGAAGACGG + Intergenic
1043622410 8:82211661-82211683 GTTAAGATAGAGAGAAAAGATGG + Intergenic
1043821193 8:84867132-84867154 GTGAAGACATGGGGAGAAGATGG - Intronic
1044167372 8:89003310-89003332 GTAAAGACACAGAGAGAAGAGGG + Intergenic
1044250531 8:90000296-90000318 GTAAAGACACAGGGAGAAGATGG + Intronic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044884570 8:96763050-96763072 ATGAAGACATAAGGAGAAGATGG - Intronic
1044937338 8:97305831-97305853 GTGAAGACACAGCAAGAAGATGG - Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045487242 8:102640992-102641014 GTGAAGACACAGGGAGAAGATGG + Intergenic
1045660550 8:104433063-104433085 GTGAAGACACAGGAAGAAGATGG + Intronic
1045793981 8:106021009-106021031 GTGAAGACACAGTGAGAAGGCGG + Intergenic
1045900467 8:107273252-107273274 GGGTAGATAGAGAGAGGAGAGGG + Intronic
1046130987 8:109968634-109968656 GGGAAGGAAGAGAGAGAAGAGGG - Intronic
1046186096 8:110721545-110721567 ATGAAGATACAGTGAGAAAACGG - Intergenic
1046264049 8:111807778-111807800 GTGAGGACACAGAGAGAAGTTGG - Intergenic
1046289231 8:112135408-112135430 GAAAAGATACACAGAGAAGAAGG + Intergenic
1046411156 8:113844750-113844772 GTAAGGATATAATGAGAAGATGG + Intergenic
1046585026 8:116140609-116140631 GTGAAGATAGAGGGAGAAGGTGG + Intergenic
1046733860 8:117754956-117754978 GAGATGATATAGAGAAAAGAAGG + Intergenic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047111838 8:121799200-121799222 GGGAAGATAGAGATAAAAGAAGG - Intergenic
1047288684 8:123510197-123510219 GTTAACATATAGAAAGCAGACGG - Intronic
1047562245 8:126000105-126000127 GTGAAGACATAGTGAGAAGGTGG + Intergenic
1047786009 8:128154459-128154481 GTGAAGGCATACAGAGAAGATGG - Intergenic
1047818724 8:128494718-128494740 GTGAGGATACAAAGAGAAGATGG - Intergenic
1048148090 8:131865127-131865149 GTGAAGACACAGGGAGAAGACGG + Intergenic
1048166859 8:132069494-132069516 GTGAAAATACACAGAAAAGAAGG + Intronic
1048236339 8:132694400-132694422 GTGAAGATGCAGGGAGAAGATGG + Intronic
1048250826 8:132865420-132865442 GTGAGGATACAGGGAGGAGATGG + Intergenic
1048489703 8:134881172-134881194 GTGAGAATACAGGGAGAAGATGG + Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048936929 8:139365197-139365219 GTGAGGACACAGGGAGAAGACGG - Intergenic
1049297549 8:141850865-141850887 GTGAAGACCCAGGGAGAAGATGG + Intergenic
1050146305 9:2571720-2571742 GTGAGGATAAAAACAGAAGATGG - Intergenic
1050185235 9:2966000-2966022 GGGAAGACACAGAGAAAAGAAGG + Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050997364 9:12237240-12237262 GTGAAGATACAAGGAGAAGATGG - Intergenic
1051551005 9:18329172-18329194 GTGAGGACACAGTGAGAAGATGG + Intergenic
1051747150 9:20305927-20305949 GTGAAGGCAGAGGGAGAAGATGG - Intergenic
1051923106 9:22290967-22290989 ATGAAGATAGAGAAGGAAGAAGG + Intergenic
1051940385 9:22498395-22498417 GTGAAGACAGAGGGAGAATATGG + Intergenic
1051944227 9:22547064-22547086 GTGAAGATGTGGAGAGGAGATGG - Intergenic
1052110230 9:24573535-24573557 GTCAAGATATTGAGGCAAGACGG - Intergenic
1052324974 9:27207969-27207991 GTGAGGATAGTGAGAGGAGAGGG + Intronic
1052409560 9:28105776-28105798 GTGAGGACACAGAGAGAAGGTGG + Intronic
1052441635 9:28504215-28504237 GGGAAAATATAGAGAAATGATGG - Intronic
1052561070 9:30084652-30084674 GTGAGGAAAAAGTGAGAAGAGGG - Intergenic
1052898578 9:33770702-33770724 GTGAGGACACTGAGAGAAGATGG + Intronic
1053532286 9:38894652-38894674 GTGAAGACACAGGGAGAAGACGG + Intergenic
1054204511 9:62119061-62119083 GTGAAGACACAGGGAGAAGACGG + Intergenic
1054633851 9:67469303-67469325 GTGAAGACACAGGGAGAAGACGG - Intergenic
1054760544 9:69000585-69000607 GTGAAGACATAGGGAGATGAAGG - Intronic
1054777925 9:69139465-69139487 GTGAAGACATAGAGAAAAGATGG + Intronic
1054968431 9:71056694-71056716 TATAAGACATAGAGAGAAGATGG + Intronic
1055184883 9:73439104-73439126 GTGAAAATATAATGAGAAAAAGG + Intergenic
1055209137 9:73767837-73767859 GTGAGAATATAGTGAGAAGGTGG + Intergenic
1055234680 9:74106321-74106343 GAGAAGATATAGGGACAAGAGGG + Intergenic
1055262138 9:74449476-74449498 ATGAAGACACAGGGAGAAGATGG - Intergenic
1055351160 9:75389814-75389836 ATGAAAATAAATAGAGAAGAAGG + Intergenic
1055476584 9:76668959-76668981 GTGAAAACAGAGAGAGAAGATGG - Intronic
1055827182 9:80340709-80340731 GAGAAGATATAGAGAGAGATTGG + Intergenic
1055877369 9:80959471-80959493 GTGAGGTTACAGTGAGAAGATGG + Intergenic
1055904128 9:81273023-81273045 GTGAAGACACAGACAGAAGGTGG + Intergenic
1056319576 9:85423664-85423686 GTGGAGATATAAAGAAAAGGGGG + Intergenic
1056622093 9:88222862-88222884 GTGAGGACACAGGGAGAAGAAGG + Intergenic
1056713130 9:89007751-89007773 GGGAAGACAAAGAAAGAAGAAGG - Intergenic
1057151650 9:92801202-92801224 GTGAAGACACAGGGGGAAGATGG - Intergenic
1057302167 9:93893142-93893164 GTGAAGATACAATGAGAGGAAGG + Intergenic
1057613538 9:96567640-96567662 TTGTAGAGATAGAGAGTAGAAGG + Intronic
1058022699 9:100106203-100106225 AGGAAGATGAAGAGAGAAGATGG - Intronic
1058315793 9:103564320-103564342 TTGTAGATATAGATTGAAGACGG - Intergenic
1058503151 9:105642959-105642981 GTAGAGACATAGAGAGAAGATGG + Intergenic
1058698893 9:107584852-107584874 GTGAAGGTTTGGAGAGGAGAGGG - Intergenic
1058735525 9:107890568-107890590 GTGAAGACATAGGAAGAAGATGG + Intergenic
1058933797 9:109748851-109748873 GTGAAGACACAGGGAGAAGATGG - Intronic
1059009279 9:110439264-110439286 GTGAGGATACAGTGAGAAGGTGG + Intronic
1059243975 9:112833996-112834018 TTGAAGATACAGACAGGAGAGGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059370200 9:113824501-113824523 TTGAGGATATAATGAGAAGATGG + Intergenic
1059660914 9:116399123-116399145 GTGAAGATAGAAAGAGGATAAGG - Exonic
1059857052 9:118411192-118411214 GTAAAGCTCTATAGAGAAGACGG + Intergenic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060167664 9:121432356-121432378 GTGAAGACTTACAGAGAACAGGG + Intergenic
1060291762 9:122309396-122309418 GTGATAGTATAGAAAGAAGAAGG - Intronic
1060326678 9:122623097-122623119 GTGAGGATACAATGAGAAGATGG - Intergenic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1060671346 9:125472364-125472386 GTGAAAATTGAGAGAGGAGATGG - Intronic
1060853916 9:126899868-126899890 GTAAAGTTACAGTGAGAAGATGG - Intergenic
1061278808 9:129585346-129585368 GAGAAGAAAGAGTGAGAAGAGGG + Intergenic
1061362508 9:130152616-130152638 GTGAGGTTACAGTGAGAAGATGG - Intergenic
1061977873 9:134081070-134081092 GTGAAGACATACGGAGAAGATGG + Intergenic
1062347987 9:136124222-136124244 GTGAGGACACAGGGAGAAGACGG + Intergenic
1203515795 Un_GL000213v1:62-84 GTGAAGACATAGAGTGAAATGGG + Intergenic
1185557993 X:1036475-1036497 GTGAGGACACAGGGAGAAGACGG + Intergenic
1185571206 X:1136354-1136376 GTGAGGACACAGGGAGAAGACGG - Intergenic
1185571246 X:1136589-1136611 GTGAGGACACAGGGAGAAGACGG - Intergenic
1185606509 X:1370103-1370125 GTGAGGACACAGGGAGAAGACGG + Intronic
1185606637 X:1370799-1370821 GTGAGGACACAGGGAGAAGACGG + Intronic
1185606677 X:1371034-1371056 GTGAGGACACAGGGAGAAGACGG + Intronic
1185606893 X:1372201-1372223 GTGAGGACACAGGGAGAAGACGG + Intronic
1185607193 X:1373833-1373855 GTGAGGACACAGGGAGAAGACGG + Intronic
1185607361 X:1374764-1374786 GTGAGGACACAGGGAGAAGACGG + Intronic
1185607707 X:1376630-1376652 GTGAGGACACAGGGAGAAGACGG + Intronic
1185609893 X:1387922-1387944 GTGAGGACACAGGGAGAAGACGG + Intronic
1185609926 X:1388155-1388177 GTGAGGACACAGGGAGAAGACGG + Intronic
1185618354 X:1437009-1437031 GTGAGGACACAGGGAGAAGATGG - Intronic
1185618390 X:1437240-1437262 GTGAGGACACAGGGAGAAGACGG - Intronic
1185627902 X:1495464-1495486 GTGAGGACACAGGGAGAAGACGG + Intronic
1185627939 X:1495699-1495721 GTGAGGACACAGGGAGAAGACGG + Intronic
1185631142 X:1516567-1516589 GTGAGGACACAGGGAGAAGATGG + Intronic
1185682066 X:1897067-1897089 GTGAGGACACAGGGAGAAGATGG - Intergenic
1185689146 X:2138937-2138959 GTGAAGATACAGTAGGAAGAAGG + Intergenic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185704767 X:2258523-2258545 GTGAGGACACAGGGAGAAGACGG + Intronic
1185714232 X:2328367-2328389 GTGAGGACACAGGGAGAAGATGG + Intronic
1185721834 X:2388467-2388489 GTGAGGACACAGGGAGAAGACGG + Intronic
1185721893 X:2388932-2388954 GTGAGGACACAGGGAGAAGACGG + Intronic
1185726272 X:2424380-2424402 GTGAGGACACAGGGAGAAGATGG + Intronic
1185746086 X:2574626-2574648 GTGAGGACACAGGGAGAAGACGG + Intergenic
1185770366 X:2761285-2761307 GTAAAGACACAGGGAGAAGAGGG + Intronic
1185773885 X:2786827-2786849 ATGAAGACACAGGGAGAAGACGG + Intronic
1185773921 X:2787062-2787084 GTGAGGACACAGGGAGAAGATGG + Intronic
1185773956 X:2787297-2787319 GTGAGGACACAGGGAGAAGATGG + Intronic
1185776351 X:2805680-2805702 GTGAGGACACAGGGAGAAGATGG - Intronic
1185800661 X:3007613-3007635 GTGAAGACACAGGGAGAAGACGG - Intronic
1185800695 X:3007848-3007870 GTGAGGACACAGGGAGAAGACGG - Intronic
1185842719 X:3408042-3408064 GTGAGGACACAGGGAGAAGACGG - Intergenic
1185842745 X:3408277-3408299 GTGAGGACACAGGGAGAAGATGG - Intergenic
1185843065 X:3411138-3411160 GTGAGGACACAGGGAGAAGATGG - Intergenic
1185853492 X:3510758-3510780 GTGAGGACACAGGGAGAAGACGG + Intergenic
1185873652 X:3684741-3684763 GTGAGGACACAGGGAGAAGATGG - Intronic
1185880649 X:3736948-3736970 GAGAAGAAAATGAGAGAAGATGG + Intergenic
1185887455 X:3795650-3795672 GTGAGGATACAGTGAGAAGGTGG - Intergenic
1185942230 X:4334555-4334577 GTGAGGATACAGGGAGAAGATGG + Intergenic
1185942267 X:4334790-4334812 GTGAGGACACAGGGAGAAGATGG + Intergenic
1185986923 X:4845213-4845235 GTGAAGACACAGGGAGAAGGTGG + Intergenic
1186022575 X:5272486-5272508 GTGAGGACACAGGGAGAAGACGG + Intergenic
1186044142 X:5516071-5516093 GTGAAGACACAGGGAGAAGAAGG - Intergenic
1186057907 X:5671098-5671120 GTGAGGACACAGGGAGAAGATGG + Intergenic
1186129250 X:6448581-6448603 ATGAAGACACAGGGAGAAGATGG - Intergenic
1186146741 X:6632140-6632162 GTGAAGACACAGGGAGAAGGTGG - Intergenic
1186317536 X:8386973-8386995 GTGGAGGGATAGAGAGAGGAAGG + Intergenic
1186327867 X:8499118-8499140 ATGAAGAAAGAGAGAAAAGAAGG + Intergenic
1186470559 X:9818761-9818783 GTGAAGAAAAAGAAAGAAGAGGG - Intronic
1186481696 X:9901125-9901147 GTGAGGACACAGGGAGAAGACGG - Intronic
1186685532 X:11921282-11921304 GTGAAGGTATAGCAAGAAGGCGG - Intergenic
1186745522 X:12564066-12564088 GTGAGGATACAATGAGAAGATGG - Intronic
1186878132 X:13837567-13837589 ATGATGATAAAGAGAGGAGAAGG - Intronic
1187068958 X:15868946-15868968 ATGAAGACACAGTGAGAAGATGG - Intergenic
1187175513 X:16892912-16892934 GTCAAGATGTAGAAAGCAGATGG + Intergenic
1187701104 X:21965072-21965094 GAGAAGATACAGGGAGAAAAGGG - Intronic
1187775862 X:22756334-22756356 ATGTATATATAGAGAGAAAAGGG - Intergenic
1187933284 X:24313026-24313048 GTGATGCTCCAGAGAGAAGATGG - Intergenic
1187938943 X:24363028-24363050 GTGATGCTCCAGAGAGAAGATGG + Intergenic
1188036463 X:25322954-25322976 GTGAAAATTTTGAGAGAAAAAGG - Intergenic
1188112850 X:26212646-26212668 GTGAGGAGACAGTGAGAAGATGG + Intergenic
1188160270 X:26791739-26791761 GTGAAGACAGATAGGGAAGAGGG - Intergenic
1188663401 X:32789100-32789122 GTGAAGCAATAAATAGAAGAAGG + Intronic
1188846767 X:35082148-35082170 GTAAAGACACAGGGAGAAGATGG + Intergenic
1188850349 X:35124481-35124503 GTAGAGAAAGAGAGAGAAGATGG + Intergenic
1189075544 X:37910257-37910279 GTAAAGATACAGGGGGAAGATGG - Intronic
1189158814 X:38789089-38789111 ATGAGGATATAGCAAGAAGATGG + Intergenic
1189271042 X:39752177-39752199 GTGAGGAAACAGAGAGAAGGTGG + Intergenic
1189275199 X:39780423-39780445 GTGAAGACACAGCGAGAAGACGG + Intergenic
1189339123 X:40191217-40191239 GTGAAGATACACTGAGAAGGTGG + Intergenic
1189569761 X:42283951-42283973 GTGAGGACACAGTGAGAAGACGG + Intergenic
1189638107 X:43034419-43034441 GTGAGGATACAGAAAGAAGGTGG + Intergenic
1189732599 X:44037064-44037086 GTGAGGATATAATGAGAAGATGG + Intergenic
1189852311 X:45189744-45189766 GTGAGGAGAGATAGAGAAGATGG + Intronic
1189859884 X:45261558-45261580 GTGAAGACACAGTGAGAAGGTGG - Intergenic
1189963633 X:46349823-46349845 GTGAGGATACAGTGAAAAGATGG - Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190478740 X:50853345-50853367 GTGCAGATAGAGAGAGAAGAAGG - Intergenic
1190798322 X:53764612-53764634 GTGAAGATAAAGAAAGAGAATGG - Intergenic
1191047335 X:56152649-56152671 GTGAAGGTAGAGAGAGGGGAAGG + Intergenic
1191146307 X:57169059-57169081 GTGAAGACACAGTGAGAAGGTGG - Intergenic
1191800975 X:65079051-65079073 TTGTAGAGATAGAGAGTAGAAGG - Intergenic
1192101723 X:68271677-68271699 GAGAAGGTATAAAGAGAAGGTGG + Intronic
1192165359 X:68824392-68824414 GAGGAGATAAAGAGAGAAGGAGG + Intergenic
1192182391 X:68924353-68924375 GTGGAGCTGGAGAGAGAAGAGGG - Intergenic
1192390937 X:70727785-70727807 ATGAAGATATAGAAAGAAGGTGG + Intronic
1192586160 X:72319661-72319683 GTGAAGATAAAGGTAGAATAAGG - Intergenic
1192622133 X:72688563-72688585 TTCAAGATCTGGAGAGAAGAAGG - Intronic
1193061959 X:77216201-77216223 GTGAGGATATAGAGAAAAGGTGG - Intergenic
1193940108 X:87672424-87672446 GTGAAGATACAAAGAGAAATTGG - Intergenic
1193988161 X:88272876-88272898 ATGAAGACACAGGGAGAAGATGG - Intergenic
1193990385 X:88299747-88299769 GTGAGGGTACAGGGAGAAGATGG + Intergenic
1194070978 X:89325873-89325895 GAGAACAAAGAGAGAGAAGAAGG - Intergenic
1194528019 X:95004279-95004301 GTGAGGACATAGTAAGAAGATGG - Intergenic
1194599169 X:95899414-95899436 GTGAGGATACAGAGAGAAGGTGG - Intergenic
1194629342 X:96264502-96264524 GTGAAGACATGGTGAGAAGATGG - Intergenic
1194747459 X:97644025-97644047 GTGGAGATACAGGGAGAAGTTGG - Intergenic
1194784807 X:98069644-98069666 GAGAAGATCTAGAGTGAACAGGG + Intergenic
1195301178 X:103531134-103531156 GAGAGCATATGGAGAGAAGAAGG - Intergenic
1195345902 X:103951064-103951086 GTGAAGACACAGGGAGAAGATGG - Intronic
1195361703 X:104088450-104088472 GTGAAGACACAGGGAGAAGATGG + Intergenic
1195571038 X:106399075-106399097 GTGAGGACACAGTGAGAAGACGG - Intergenic
1195656733 X:107338529-107338551 GTGAAGACACGGAGAGAAGGTGG + Intergenic
1195791229 X:108589143-108589165 GTGTAGATGCAGAGAGAATAAGG + Intronic
1195825567 X:108996611-108996633 TTGAACACATAGAGAGTAGAAGG + Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1197221558 X:123919376-123919398 GTAACCATATAGAGAGTAGAAGG - Intergenic
1197340849 X:125265176-125265198 GTGAAGACACACAGAAAAGATGG - Intergenic
1197347950 X:125346923-125346945 GAGAAGAGAGAGAGAGAAGGAGG + Intergenic
1197531923 X:127639276-127639298 GTGAAGACACAGTGAGAAGGTGG + Intergenic
1197645619 X:129013271-129013293 GCGAAGACACAGTGAGAAGATGG + Intergenic
1197788430 X:130224239-130224261 GTGAAGACACAGTGAGAATATGG + Intronic
1197828497 X:130615765-130615787 TTGAAGAGAAAGAGAGAAGTTGG - Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198012613 X:132574093-132574115 CTGAAGATAGAGAGAGATGCAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198473398 X:136971635-136971657 CTAAAGATATTGACAGAAGAGGG - Intergenic
1198516766 X:137416500-137416522 TTGACGATATAGAAGGAAGAGGG + Intergenic
1198520835 X:137450795-137450817 GTGAGGACATAGGGAGAAGTTGG - Intergenic
1198703034 X:139417660-139417682 GTAAAGACACAGAGAGAAGATGG + Intergenic
1199028374 X:142967106-142967128 GTGAATATACAGGGAGAAGATGG - Intergenic
1199235958 X:145492904-145492926 GTGAAGAAAGAAAGAGAAGATGG - Intergenic
1199279842 X:145988432-145988454 GTGAAGTTACAGCAAGAAGATGG + Intergenic
1199316528 X:146385254-146385276 ATGAAGATGGAGAGAGAGGAAGG + Intergenic
1199323894 X:146474806-146474828 GTGAAGTTACAGGGAGAAGATGG + Intergenic
1199360969 X:146918284-146918306 GTGAAGATACAGAAAGCATAGGG - Intergenic
1199487775 X:148367098-148367120 GTGAAGACACATGGAGAAGATGG + Intergenic
1199495793 X:148451020-148451042 GTGAAGATGCAGAGAGAAGGTGG - Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1199762474 X:150915731-150915753 GTGAGGATACAGCAAGAAGATGG + Intergenic
1199817629 X:151412789-151412811 GAGAAGACACAGGGAGAAGACGG - Intergenic
1199848349 X:151707697-151707719 GTGAAGCCACAGGGAGAAGATGG - Intergenic
1199890005 X:152069540-152069562 GTGAAGACAGAGTGAGAAGGTGG - Intergenic
1199905763 X:152227991-152228013 GTGAAGATACTAAGAAAAGAAGG + Intronic
1200275156 X:154725067-154725089 GAAAAGACACAGAGAGAAGATGG + Intronic
1200725208 Y:6661614-6661636 GAGAACAAAGAGAGAGAAGAAGG - Intergenic
1200742583 Y:6870075-6870097 GAGAAGAGAAAGAGAGAGGAAGG + Intronic
1200774902 Y:7161488-7161510 GTGAGGATACAGTGAGAAGGTGG + Intergenic
1200784510 Y:7248409-7248431 GAGAAGAAAATGAGAGAAGATGG - Intergenic
1200809973 Y:7474002-7474024 GTGAGGATACAGGGAGAAGATGG - Intergenic
1201231405 Y:11868233-11868255 GTGAAGACACAGGGAGAAGATGG + Intergenic
1201232131 Y:11875437-11875459 GTGAGGACACAGGGAGAAGATGG + Intergenic
1201232469 Y:11878598-11878620 GTGAGGACACAGGGAGAAGATGG + Intergenic
1201234964 Y:11900365-11900387 GTGAGGACACAGGGAGAAGATGG - Intergenic
1201293624 Y:12445795-12445817 GTGAGGACACAGGGAGAAGATGG + Intergenic
1201293658 Y:12446030-12446052 GTGAGGACACAGGGAGAAGATGG + Intergenic
1201295812 Y:12462325-12462347 ATGAAGACACAGGGAGAAGACGG - Intergenic
1201424480 Y:13833298-13833320 GTGAGGACACAGGGAGAAGATGG + Intergenic
1201849535 Y:18462748-18462770 GTGAAGGTAAGCAGAGAAGATGG - Intergenic
1201883783 Y:18857627-18857649 GTGAAGGTAAGCAGAGAAGATGG + Intergenic
1201887717 Y:18904040-18904062 GAGAAGAAATAGAGAGAGGAAGG + Intergenic