ID: 1163064161

View in Genome Browser
Species Human (GRCh38)
Location 19:14780925-14780947
Sequence ACTTCTGGACAAAGAGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064161_1163064168 30 Left 1163064161 19:14780925-14780947 CCGCCTTCTCTTTGTCCAGAAGT No data
Right 1163064168 19:14780978-14781000 TGGACAACCTCTGCAATGATGGG No data
1163064161_1163064165 10 Left 1163064161 19:14780925-14780947 CCGCCTTCTCTTTGTCCAGAAGT No data
Right 1163064165 19:14780958-14780980 CTGACCTATTTTGCAGCTTCTGG No data
1163064161_1163064167 29 Left 1163064161 19:14780925-14780947 CCGCCTTCTCTTTGTCCAGAAGT No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064161 Original CRISPR ACTTCTGGACAAAGAGAAGG CGG (reversed) Intergenic
No off target data available for this crispr