ID: 1163064163

View in Genome Browser
Species Human (GRCh38)
Location 19:14780940-14780962
Sequence GTCAGCAGGACTGAGACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064163_1163064165 -5 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064165 19:14780958-14780980 CTGACCTATTTTGCAGCTTCTGG No data
1163064163_1163064167 14 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data
1163064163_1163064169 16 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064169 19:14780979-14781001 GGACAACCTCTGCAATGATGGGG No data
1163064163_1163064173 29 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064173 19:14780992-14781014 AATGATGGGGGGTGCGAACATGG No data
1163064163_1163064168 15 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064168 19:14780978-14781000 TGGACAACCTCTGCAATGATGGG No data
1163064163_1163064170 17 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064170 19:14780980-14781002 GACAACCTCTGCAATGATGGGGG No data
1163064163_1163064171 18 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064171 19:14780981-14781003 ACAACCTCTGCAATGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064163 Original CRISPR GTCAGCAGGACTGAGACTTC TGG (reversed) Intergenic
No off target data available for this crispr