ID: 1163064165

View in Genome Browser
Species Human (GRCh38)
Location 19:14780958-14780980
Sequence CTGACCTATTTTGCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064160_1163064165 21 Left 1163064160 19:14780914-14780936 CCTATGTTTCTCCGCCTTCTCTT No data
Right 1163064165 19:14780958-14780980 CTGACCTATTTTGCAGCTTCTGG No data
1163064162_1163064165 7 Left 1163064162 19:14780928-14780950 CCTTCTCTTTGTCCAGAAGTCTC No data
Right 1163064165 19:14780958-14780980 CTGACCTATTTTGCAGCTTCTGG No data
1163064161_1163064165 10 Left 1163064161 19:14780925-14780947 CCGCCTTCTCTTTGTCCAGAAGT No data
Right 1163064165 19:14780958-14780980 CTGACCTATTTTGCAGCTTCTGG No data
1163064163_1163064165 -5 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064165 19:14780958-14780980 CTGACCTATTTTGCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064165 Original CRISPR CTGACCTATTTTGCAGCTTC TGG Intergenic
No off target data available for this crispr