ID: 1163064166

View in Genome Browser
Species Human (GRCh38)
Location 19:14780962-14780984
Sequence TTGTCCAGAAGCTGCAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064166_1163064168 -7 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064168 19:14780978-14781000 TGGACAACCTCTGCAATGATGGG No data
1163064166_1163064170 -5 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064170 19:14780980-14781002 GACAACCTCTGCAATGATGGGGG No data
1163064166_1163064173 7 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064173 19:14780992-14781014 AATGATGGGGGGTGCGAACATGG No data
1163064166_1163064174 25 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064174 19:14781010-14781032 CATGGTCCTCATTTGTCAAAAGG No data
1163064166_1163064169 -6 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064169 19:14780979-14781001 GGACAACCTCTGCAATGATGGGG No data
1163064166_1163064167 -8 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data
1163064166_1163064175 26 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064175 19:14781011-14781033 ATGGTCCTCATTTGTCAAAAGGG No data
1163064166_1163064176 27 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064176 19:14781012-14781034 TGGTCCTCATTTGTCAAAAGGGG No data
1163064166_1163064171 -4 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064171 19:14780981-14781003 ACAACCTCTGCAATGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064166 Original CRISPR TTGTCCAGAAGCTGCAAAAT AGG (reversed) Intergenic
No off target data available for this crispr