ID: 1163064167

View in Genome Browser
Species Human (GRCh38)
Location 19:14780977-14780999
Sequence CTGGACAACCTCTGCAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064163_1163064167 14 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data
1163064166_1163064167 -8 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data
1163064162_1163064167 26 Left 1163064162 19:14780928-14780950 CCTTCTCTTTGTCCAGAAGTCTC No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data
1163064161_1163064167 29 Left 1163064161 19:14780925-14780947 CCGCCTTCTCTTTGTCCAGAAGT No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data
1163064164_1163064167 0 Left 1163064164 19:14780954-14780976 CCTGCTGACCTATTTTGCAGCTT No data
Right 1163064167 19:14780977-14780999 CTGGACAACCTCTGCAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064167 Original CRISPR CTGGACAACCTCTGCAATGA TGG Intergenic
No off target data available for this crispr