ID: 1163064170

View in Genome Browser
Species Human (GRCh38)
Location 19:14780980-14781002
Sequence GACAACCTCTGCAATGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064163_1163064170 17 Left 1163064163 19:14780940-14780962 CCAGAAGTCTCAGTCCTGCTGAC No data
Right 1163064170 19:14780980-14781002 GACAACCTCTGCAATGATGGGGG No data
1163064166_1163064170 -5 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064170 19:14780980-14781002 GACAACCTCTGCAATGATGGGGG No data
1163064164_1163064170 3 Left 1163064164 19:14780954-14780976 CCTGCTGACCTATTTTGCAGCTT No data
Right 1163064170 19:14780980-14781002 GACAACCTCTGCAATGATGGGGG No data
1163064162_1163064170 29 Left 1163064162 19:14780928-14780950 CCTTCTCTTTGTCCAGAAGTCTC No data
Right 1163064170 19:14780980-14781002 GACAACCTCTGCAATGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064170 Original CRISPR GACAACCTCTGCAATGATGG GGG Intergenic
No off target data available for this crispr