ID: 1163064172

View in Genome Browser
Species Human (GRCh38)
Location 19:14780985-14781007
Sequence CGCACCCCCCATCATTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064172_1163064184 26 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064184 19:14781034-14781056 GAACTGGAACCTGGGGGTTTGGG No data
1163064172_1163064185 27 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064185 19:14781035-14781057 AACTGGAACCTGGGGGTTTGGGG No data
1163064172_1163064179 17 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064179 19:14781025-14781047 TCAAAAGGGGAACTGGAACCTGG No data
1163064172_1163064180 18 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064180 19:14781026-14781048 CAAAAGGGGAACTGGAACCTGGG No data
1163064172_1163064176 4 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064176 19:14781012-14781034 TGGTCCTCATTTGTCAAAAGGGG No data
1163064172_1163064183 25 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064183 19:14781033-14781055 GGAACTGGAACCTGGGGGTTTGG No data
1163064172_1163064182 20 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064182 19:14781028-14781050 AAAGGGGAACTGGAACCTGGGGG No data
1163064172_1163064178 10 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064178 19:14781018-14781040 TCATTTGTCAAAAGGGGAACTGG No data
1163064172_1163064175 3 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064175 19:14781011-14781033 ATGGTCCTCATTTGTCAAAAGGG No data
1163064172_1163064174 2 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064174 19:14781010-14781032 CATGGTCCTCATTTGTCAAAAGG No data
1163064172_1163064181 19 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064181 19:14781027-14781049 AAAAGGGGAACTGGAACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064172 Original CRISPR CGCACCCCCCATCATTGCAG AGG (reversed) Intergenic
No off target data available for this crispr