ID: 1163064174

View in Genome Browser
Species Human (GRCh38)
Location 19:14781010-14781032
Sequence CATGGTCCTCATTTGTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064166_1163064174 25 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064174 19:14781010-14781032 CATGGTCCTCATTTGTCAAAAGG No data
1163064172_1163064174 2 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064174 19:14781010-14781032 CATGGTCCTCATTTGTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064174 Original CRISPR CATGGTCCTCATTTGTCAAA AGG Intergenic
No off target data available for this crispr