ID: 1163064176

View in Genome Browser
Species Human (GRCh38)
Location 19:14781012-14781034
Sequence TGGTCCTCATTTGTCAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163064172_1163064176 4 Left 1163064172 19:14780985-14781007 CCTCTGCAATGATGGGGGGTGCG No data
Right 1163064176 19:14781012-14781034 TGGTCCTCATTTGTCAAAAGGGG No data
1163064166_1163064176 27 Left 1163064166 19:14780962-14780984 CCTATTTTGCAGCTTCTGGACAA No data
Right 1163064176 19:14781012-14781034 TGGTCCTCATTTGTCAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163064176 Original CRISPR TGGTCCTCATTTGTCAAAAG GGG Intergenic
No off target data available for this crispr