ID: 1163073629

View in Genome Browser
Species Human (GRCh38)
Location 19:14867579-14867601
Sequence TACTCTATTCCTCATTCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163073624_1163073629 6 Left 1163073624 19:14867550-14867572 CCTTCCAGAGTTCTAACCTCCTA No data
Right 1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG No data
1163073626_1163073629 -10 Left 1163073626 19:14867566-14867588 CCTCCTAATGCCTTACTCTATTC No data
Right 1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG No data
1163073625_1163073629 2 Left 1163073625 19:14867554-14867576 CCAGAGTTCTAACCTCCTAATGC No data
Right 1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG No data
1163073623_1163073629 21 Left 1163073623 19:14867535-14867557 CCATGGACTTGTTTGCCTTCCAG No data
Right 1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG No data
1163073622_1163073629 27 Left 1163073622 19:14867529-14867551 CCTTCTCCATGGACTTGTTTGCC No data
Right 1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163073629 Original CRISPR TACTCTATTCCTCATTCCCG AGG Intergenic
No off target data available for this crispr