ID: 1163073761

View in Genome Browser
Species Human (GRCh38)
Location 19:14869544-14869566
Sequence GAACCATCCAAGACCCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163073761_1163073763 26 Left 1163073761 19:14869544-14869566 CCATGTAGGGTCTTGGATGGTTC No data
Right 1163073763 19:14869593-14869615 ATTTCTGTGAAGAATGTCATTGG 0: 597
1: 1667
2: 12990
3: 9029
4: 4941

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163073761 Original CRISPR GAACCATCCAAGACCCTACA TGG (reversed) Intergenic
No off target data available for this crispr