ID: 1163075335

View in Genome Browser
Species Human (GRCh38)
Location 19:14885985-14886007
Sequence ATTCCTCTCTAGCAGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163075329_1163075335 22 Left 1163075329 19:14885940-14885962 CCCTACTGAGTTTTCTGAAAGGA No data
Right 1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG No data
1163075330_1163075335 21 Left 1163075330 19:14885941-14885963 CCTACTGAGTTTTCTGAAAGGAA No data
Right 1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG No data
1163075333_1163075335 -7 Left 1163075333 19:14885969-14885991 CCATGGAGAAGTGTAAATTCCTC No data
Right 1163075335 19:14885985-14886007 ATTCCTCTCTAGCAGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163075335 Original CRISPR ATTCCTCTCTAGCAGGTTGA TGG Intergenic
No off target data available for this crispr