ID: 1163083114

View in Genome Browser
Species Human (GRCh38)
Location 19:14957682-14957704
Sequence ATTCTAATGGGGAAAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163083109_1163083114 28 Left 1163083109 19:14957631-14957653 CCACAATGTCTATGGTATTTTTG 0: 1
1: 0
2: 9
3: 102
4: 611
Right 1163083114 19:14957682-14957704 ATTCTAATGGGGAAAGCAGGAGG 0: 1
1: 0
2: 2
3: 22
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163083114 Original CRISPR ATTCTAATGGGGAAAGCAGG AGG Intronic
900364497 1:2305565-2305587 ATTTTAATGGGGAGAGTGGGGGG + Intronic
901717382 1:11167408-11167430 ATTCTTTTTGGAAAAGCAGGAGG - Intronic
902320634 1:15662332-15662354 ATTTTAATAGGGCGAGCAGGAGG + Exonic
902721900 1:18309517-18309539 ACGCCAATGGGGAAAGGAGGGGG - Intronic
903362618 1:22786381-22786403 AATCCAATGGGGAATGCAAGAGG - Intronic
904340194 1:29829334-29829356 AATCTCATGGGGAGAGGAGGAGG - Intergenic
904707257 1:32400917-32400939 ATTCTAATGGGGTGGGTAGGGGG - Intergenic
904912301 1:33944488-33944510 ATTTTAATGGGGAAGGGTGGAGG - Intronic
905549118 1:38822150-38822172 ATCCTAATGGGGTTAGTAGGAGG - Intergenic
909708653 1:78617937-78617959 ATGCTACTGGGGAAAGCTGGTGG - Intergenic
910485637 1:87710556-87710578 ATTCAAATGGGGAACTCAGGAGG - Intergenic
910873038 1:91852461-91852483 AATCTAATGGAGAAGGTAGGTGG + Intronic
912874422 1:113343180-113343202 ATTCTACTGGGGATACAAGGAGG + Intergenic
913156733 1:116107082-116107104 ATTCAAATGGTGCAAGCTGGAGG - Intergenic
913564915 1:120063459-120063481 ATTCTAATGGAGGAATAAGGAGG + Intronic
913633215 1:120730104-120730126 ATTCTAATGGAGGAATAAGGAGG - Intergenic
914285501 1:146222809-146222831 ATTCTAATGGAGGAATAAGGAGG + Intronic
914546532 1:148673564-148673586 ATTCTAATGGAGGAATAAGGAGG + Intronic
914620033 1:149397106-149397128 ATTCTAATGGAGGAATAAGGAGG - Intergenic
917210011 1:172621738-172621760 ATTAAAATGAGAAAAGCAGGGGG - Intergenic
917487304 1:175466853-175466875 ATACTAATGGGGAACCCAGAAGG - Intronic
917721251 1:177788689-177788711 TTTCTAATGGGAAAAGCTGGAGG + Intergenic
919551612 1:198996477-198996499 ATTCTGATTGGGAAAGAGGGGGG - Intergenic
921595259 1:217047669-217047691 GTTCCAATGGGGGAAGCAGATGG + Intronic
1063366549 10:5494255-5494277 CTTTTAATGGGGCAAGGAGGAGG - Intergenic
1063432231 10:6000470-6000492 ATTCTAGGGGTGAACGCAGGTGG - Intergenic
1065304728 10:24357383-24357405 ATTTTAATAGGGAAAAGAGGTGG - Intronic
1066501689 10:36001025-36001047 AGTCTAGAAGGGAAAGCAGGGGG + Intergenic
1067898032 10:50206085-50206107 TTTCTAATAGGGAAAACAGAAGG - Exonic
1067971192 10:50972860-50972882 ATTCTAATGGGAAAAGTAGCAGG - Intergenic
1069979061 10:72239657-72239679 GCTCTGATGGGGAAAGCATGAGG + Intergenic
1070144110 10:73761208-73761230 TTCCTAATGGGTAGAGCAGGTGG + Intronic
1070565405 10:77600333-77600355 AGCCTAGTGGGGAGAGCAGGAGG + Intronic
1073034456 10:100553574-100553596 ATTTTCAGTGGGAAAGCAGGGGG - Exonic
1073444065 10:103570585-103570607 ATACTAGTGGGGAGAGGAGGTGG + Intronic
1074082565 10:110179384-110179406 GTCCTCATGGGGATAGCAGGAGG - Intergenic
1075647973 10:124109011-124109033 ATACTGATGTGGAAAGCATGTGG - Intergenic
1076374693 10:129975250-129975272 TATCCAATGGGGAAAGAAGGTGG - Intergenic
1078796095 11:14592994-14593016 ATTCTAATGGAGGAGGGAGGAGG - Intronic
1079345105 11:19644966-19644988 ATTCTTATGGGAAAAGAAGGTGG + Intronic
1079574980 11:21992799-21992821 ATTATAATGGAGAAAGCACTTGG - Intergenic
1080989558 11:37514418-37514440 ATCCTTATGGGAAAAGCAAGAGG + Intergenic
1081729634 11:45361172-45361194 ATTAGGATGGGGAGAGCAGGTGG + Intergenic
1081740083 11:45433026-45433048 ATGCTGATGGGTCAAGCAGGAGG + Intergenic
1081837741 11:46170924-46170946 AGTCTATTGGGGACAGCAGGAGG - Intergenic
1087158443 11:94926679-94926701 CTGCCTATGGGGAAAGCAGGAGG - Intergenic
1087800662 11:102499859-102499881 ATTCTATGGTGGAAAGCAAGAGG + Intergenic
1087916119 11:103812829-103812851 TTTCTTATGGGGTCAGCAGGGGG + Intergenic
1088348208 11:108854521-108854543 ATTTTAATGGTCAAAGAAGGTGG + Intronic
1091816253 12:3440568-3440590 ATGTTACTGGGGAAAGGAGGAGG + Intronic
1093208333 12:16278520-16278542 ATTCTATTTTGGAAAGCAGGAGG + Intergenic
1093581628 12:20790444-20790466 CTTCTCTTGAGGAAAGCAGGGGG - Intergenic
1094307557 12:29037703-29037725 ATGAGAATGGGGAAAGCGGGAGG - Intergenic
1094719510 12:33049035-33049057 CTTCACATGGCGAAAGCAGGAGG - Intergenic
1095179612 12:39132147-39132169 GTTCTAATGGGCAAAGAATGAGG - Intergenic
1096027636 12:48380820-48380842 ATTATCAAGGGGAAATCAGGTGG + Intergenic
1097092543 12:56518739-56518761 AATGTAATGGGCAAAGCAGAAGG + Intergenic
1097406104 12:59192477-59192499 TTACTGATGGGGAAAGGAGGAGG + Intergenic
1097885007 12:64720257-64720279 TTTCTAAAGGGGAAGGGAGGAGG + Intronic
1099475738 12:83105524-83105546 CTTCACATGGTGAAAGCAGGAGG + Intronic
1103038423 12:117675115-117675137 ATTCTAAGAAGGAAAGCAGGTGG - Intronic
1107382151 13:39868343-39868365 ATTCAACTGGGGAAATCAGCAGG - Intergenic
1108352081 13:49596961-49596983 AGTCACATGGTGAAAGCAGGAGG + Intergenic
1109183634 13:59244501-59244523 ATTCTAACGAGGAAGGCAGATGG + Intergenic
1111634550 13:90887181-90887203 ATTATACTGGGGAATGGAGGAGG + Intergenic
1111880697 13:93953345-93953367 AGTCTGAAGGGGAAAGTAGGAGG - Intronic
1113400631 13:109989428-109989450 ATTTGAATGGGCAAAGCCGGTGG + Intergenic
1114757633 14:25278371-25278393 AGCCTAACAGGGAAAGCAGGTGG - Intergenic
1117034785 14:51716822-51716844 ATTCAGATGGGGACAGGAGGAGG + Intronic
1117301410 14:54432271-54432293 CTACTAATCTGGAAAGCAGGTGG + Intronic
1117863162 14:60114431-60114453 ATTCAAATGTGCAAAGGAGGAGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118912655 14:70074616-70074638 ATTCTTATGGTCAAAGCAAGAGG + Intronic
1119109072 14:71954806-71954828 ATTCTAATGGAGAAAGTAAATGG - Intronic
1120411496 14:84162807-84162829 AATATAAAGAGGAAAGCAGGGGG + Intergenic
1121837592 14:97106173-97106195 ATGCTAATGACAAAAGCAGGTGG - Intergenic
1122140645 14:99660924-99660946 CTCCTAATGGGGAGAGGAGGAGG + Intronic
1124960998 15:34394797-34394819 ATTTTAATTGGCAAAGGAGGCGG - Intronic
1124977628 15:34541018-34541040 ATTTTAATTGGCAAAGGAGGCGG - Intronic
1125741606 15:41969172-41969194 ATTCTAATGAGGAAAAAAGAGGG - Intronic
1126648423 15:50897845-50897867 CTTCTAAGGAGGAAAGTAGGAGG + Intergenic
1130919261 15:88330468-88330490 AATATAGTGGGGAACGCAGGAGG - Intergenic
1137884188 16:52084980-52085002 AGACTATTGGGGAAAGAAGGGGG - Intergenic
1138030515 16:53556089-53556111 ATCCAAATGGACAAAGCAGGAGG - Intergenic
1140887806 16:79259846-79259868 ATTCTAATGGGGTGGGAAGGGGG + Intergenic
1141600569 16:85123820-85123842 ATTCCACTGGGGAGAGGAGGGGG - Intergenic
1143327735 17:6110425-6110447 ATTCTAATAGGGGAAGTGGGTGG - Intronic
1144182613 17:12766937-12766959 ATTCTAAGGGAGAAAGAGGGAGG + Exonic
1145294365 17:21576145-21576167 ATTCTGATGGGGAGGGCGGGAGG - Intergenic
1145369467 17:22297035-22297057 ATTCTGATGGGGAGGGCGGGAGG + Intergenic
1148345509 17:46900921-46900943 ATTCTAGTGGGGAGGGGAGGTGG + Intergenic
1148833836 17:50454873-50454895 ATTCTAATTGGGAAATCGGCAGG - Intronic
1150623317 17:66824379-66824401 AATCCCATGGGGAAAGCTGGGGG + Intergenic
1153511002 18:5852515-5852537 GTTCTACTGGGAAAAGCAGCGGG + Intergenic
1156934704 18:42689716-42689738 ATATTAATGGGGAAAGCTAGAGG + Intergenic
1157114329 18:44849011-44849033 ATGAGAATGGGGAGAGCAGGTGG - Intronic
1158162833 18:54505613-54505635 CTTCTAGTGGGGAAAGATGGGGG + Intergenic
1159171140 18:64768264-64768286 ATTCAAATGGGAAAAGCCGCAGG + Intergenic
1159562051 18:70006561-70006583 ATTCTAATGGGAAAAGAGGGGGG - Intronic
1160037106 18:75311422-75311444 AAGCTGATGGGGAAAGAAGGAGG - Intergenic
1160226018 18:77011506-77011528 CTACTCATGGGGAAGGCAGGTGG + Intronic
1161563058 19:4984437-4984459 ATTATAATGGGGCAGCCAGGTGG + Intronic
1163083114 19:14957682-14957704 ATTCTAATGGGGAAAGCAGGAGG + Intronic
1164589270 19:29497388-29497410 ATTCTGGGGTGGAAAGCAGGAGG + Intergenic
1165043307 19:33084345-33084367 CTTCTAATCTGGAAAGAAGGGGG + Intronic
1165221080 19:34317220-34317242 ATTCTAATGGGGAAGACAACAGG - Intronic
1165581741 19:36871270-36871292 AATGTAATGGGGTAAGGAGGTGG - Intronic
1166137076 19:40784052-40784074 ATTCTCCTGGGCAAAGCGGGAGG - Exonic
925878945 2:8334512-8334534 ATTTTCATGGGGAAAGGAGAGGG + Intergenic
925887980 2:8410143-8410165 ATCCTAATGAGGGGAGCAGGTGG - Intergenic
926534771 2:14098064-14098086 ATTCTCTTGGGGAATGCAGGGGG + Intergenic
927133232 2:20078565-20078587 ATTCTACTGAGGGAAGAAGGTGG + Intergenic
927150152 2:20190964-20190986 TTCCTTATAGGGAAAGCAGGAGG - Intergenic
927179041 2:20430984-20431006 TTTATCATGGGGAAATCAGGAGG - Intergenic
928069571 2:28201080-28201102 TTTTTAATGGGGAGAGCAAGGGG + Intronic
928138603 2:28707989-28708011 CTTCTAATGAGGAGAGGAGGAGG - Intergenic
928535477 2:32236000-32236022 CTTCAAAGGAGGAAAGCAGGTGG + Intronic
930617354 2:53607507-53607529 ACTCTAGTGTGGACAGCAGGTGG - Intronic
931661768 2:64571601-64571623 ATTTTATTGGGGAAGGGAGGAGG + Intronic
938191276 2:129283127-129283149 ATTCTAATGGTAAAAGCAAGTGG + Intergenic
938984877 2:136565208-136565230 ATTCTAATGGGAGAAAAAGGGGG + Intergenic
941430180 2:165404863-165404885 GTTCTAATGGGAAAGGCATGAGG - Intergenic
941613743 2:167694714-167694736 ATTCTGTTGGTGAAAGCAGGTGG + Intergenic
942102487 2:172598982-172599004 ATTCTAATGGAGAAAGCAAGAGG + Intronic
942396990 2:175560694-175560716 ATTCCAAAGGGTAAAGCATGAGG - Intergenic
942908615 2:181213821-181213843 ATTCTAAGGAGGGAAGCAAGAGG - Intergenic
944081529 2:195793838-195793860 ATTCTAATCATGAAAGCAGTGGG + Intronic
944278970 2:197872400-197872422 AGTTTAATGGGGAAAACAGACGG - Intronic
944529287 2:200651513-200651535 CTGCTCATGTGGAAAGCAGGAGG + Intronic
944605327 2:201347181-201347203 CGTCTAATGGGAAAAGGAGGAGG - Intronic
945224466 2:207519401-207519423 ATCCTTATGGGGAAAGAGGGAGG - Intergenic
947235183 2:227934125-227934147 ACTCCCTTGGGGAAAGCAGGTGG + Intergenic
947456075 2:230255177-230255199 AGTCTAATGTGGAAAGGGGGAGG + Intronic
1169621595 20:7512991-7513013 ATTATAATGGGAAGAGGAGGAGG + Intergenic
1170677104 20:18492603-18492625 TTTCCAATGGAGAAATCAGGTGG - Intronic
1171095152 20:22325821-22325843 GTTCTCATGGGGAAACCAGATGG + Intergenic
1173896529 20:46555240-46555262 AATCTGATGGGGAGACCAGGAGG - Intergenic
1173904252 20:46614253-46614275 ATTCTGATGGGGAACCCTGGGGG + Intronic
1173948703 20:46973028-46973050 TTTATAATGGAGGAAGCAGGTGG + Intronic
1178463747 21:32827052-32827074 ATTTGAATGAGGAATGCAGGTGG - Intergenic
1178546386 21:33496198-33496220 CTTCGAAAGAGGAAAGCAGGAGG - Intergenic
1178709710 21:34905350-34905372 ACTCTAATTGGGAAAGGTGGGGG - Intronic
1178752519 21:35318146-35318168 TTTCCAATGGGGAACTCAGGAGG + Intronic
1180617045 22:17135187-17135209 ATGATGATGGGGAAAGCAGCAGG + Intergenic
1181630121 22:24146643-24146665 ATTCTAACTGTGAATGCAGGTGG - Intronic
1184020678 22:41819295-41819317 AGTCTGATGGGGAAGGCAGCAGG + Intronic
1184044437 22:41963910-41963932 ATTGTAATGGGGAAAGCTGCTGG - Intergenic
949871858 3:8595912-8595934 ATTTTAATGGGGACAGATGGTGG + Intergenic
951417653 3:22444893-22444915 CTTCTAATGAGGAAGGAAGGAGG + Intergenic
955235167 3:57132493-57132515 ATTCTAATGGGGGAGGGAAGTGG + Intronic
957725569 3:84061752-84061774 ATTTTAATGGGGAAAAAATGAGG - Intergenic
959858068 3:111184467-111184489 ATTCTACCGTGGAAAGCAGAAGG - Intronic
962871576 3:139499440-139499462 ATTCTAATGCAGATATCAGGGGG - Intergenic
963443061 3:145365720-145365742 ATTCTAAAGGGGAATGCTGCTGG + Intergenic
964647894 3:158978026-158978048 ATTCACCTGGGGACAGCAGGCGG - Intronic
968753773 4:2403994-2404016 ATCACAATGGGGAAAGCAGTTGG + Intronic
969392478 4:6900891-6900913 AGTCTAATGGGGGACGCAGAGGG + Intergenic
970227883 4:13878777-13878799 ACTCCAATAGGGAACGCAGGTGG - Intergenic
971150452 4:24025837-24025859 AATTCAATGGGGAAAGGAGGAGG + Intergenic
971829085 4:31666668-31666690 AATCAAATGGGGAAAGCAAAGGG + Intergenic
973745532 4:53959929-53959951 ATTCTGGTGGGGAAAGAAGAGGG + Intronic
973777294 4:54255265-54255287 CTTCTAATGGGAAAGGGAGGTGG - Intronic
977378191 4:96236333-96236355 CTTCACATGGTGAAAGCAGGAGG - Intergenic
977437175 4:97012982-97013004 ATTCTAATGTGGATAGCAGGAGG - Intergenic
977501142 4:97839236-97839258 ATTCTCATGAGGCAAGTAGGTGG + Intronic
977551066 4:98444389-98444411 ATTCTAAGGGAGACAACAGGAGG + Intergenic
978905910 4:114005245-114005267 AGTCTGATGGGGAAGGCAGGAGG - Intergenic
978914020 4:114101758-114101780 ATTATAATGGGTCTAGCAGGAGG + Intergenic
979154144 4:117360993-117361015 AATATGATGAGGAAAGCAGGTGG + Intergenic
981257070 4:142674197-142674219 ATGAAAATGGGAAAAGCAGGTGG - Intronic
983791867 4:171809160-171809182 ATACTAAAAGGGAAAGAAGGAGG - Intergenic
985370904 4:189284435-189284457 ATGGTTATGGGGAAAGGAGGGGG + Intergenic
986690024 5:10306576-10306598 GGTCTAATGGGAAAGGCAGGAGG + Intronic
987050337 5:14143327-14143349 ATTTCAATGGGGAAGGAAGGAGG - Intergenic
987217590 5:15753517-15753539 ATTTTAATTGGGAGAGAAGGAGG + Intronic
989158119 5:38364229-38364251 AGTCTACTGGGGAATGCAGATGG + Intronic
990783402 5:59392733-59392755 ATTCAAATGGAGAAGGCAGGGGG - Intronic
991152867 5:63392194-63392216 ATTAAAATGGATAAAGCAGGAGG - Intergenic
991453250 5:66775310-66775332 ATGCTTATGGGGAAATCAGTGGG - Intronic
992021993 5:72633942-72633964 ATGCTACTGGGAAAAGGAGGAGG - Intergenic
992181324 5:74201023-74201045 ATTCCCAAGGGCAAAGCAGGCGG - Intergenic
993352529 5:86867867-86867889 GTTTTCATGGGGAAAGCAGAAGG - Intergenic
993585943 5:89728259-89728281 ATTCTGATGGTGATAGAAGGAGG + Intergenic
994403471 5:99313874-99313896 GTTCTAATGGGGAAGGTATGAGG + Intergenic
994996953 5:107076151-107076173 ATTGAAATGGGGAAAACAGAAGG - Intergenic
996422528 5:123278232-123278254 AGCCCAACGGGGAAAGCAGGTGG + Intergenic
996977301 5:129450347-129450369 ATTCTTATTGGGACAGGAGGAGG - Intergenic
997964679 5:138347696-138347718 AGTATATTGGGGAATGCAGGTGG + Exonic
1000121572 5:158202970-158202992 AGTCTGTTGGGGAGAGCAGGAGG + Intergenic
1000266711 5:159645084-159645106 ATTAGAATGTGGAAAGCAGCAGG + Intergenic
1001253445 5:170166125-170166147 AGTCTAATGGGGAAGGCATAGGG + Intergenic
1001914867 5:175551418-175551440 CTTATAAAGGGGAAAGCAGAGGG - Intergenic
1005299667 6:24458277-24458299 ATTAGAATGGGCAAAGCAGAAGG - Intronic
1006789641 6:36691372-36691394 ATTCTGATAGGGAAAGAATGGGG - Intergenic
1007037036 6:38684634-38684656 ATTTTAATGGAATAAGCAGGAGG + Intronic
1007254095 6:40516570-40516592 TTTCTAATTAGCAAAGCAGGTGG - Intronic
1007702497 6:43773022-43773044 ATTGTCAGGGGGAAGGCAGGGGG + Intronic
1007843851 6:44738287-44738309 ATTGTTAGTGGGAAAGCAGGTGG + Intergenic
1008691604 6:53985275-53985297 ATTATACTTGGGGAAGCAGGAGG - Intronic
1010863547 6:80943509-80943531 ATTCTTATGGGGTCACCAGGTGG + Intergenic
1011940233 6:92833842-92833864 ATTCAAATGGGAAAAGCAAGAGG + Intergenic
1012547412 6:100435365-100435387 ATGCCAAAGAGGAAAGCAGGTGG + Intronic
1013221958 6:108085692-108085714 ATTGGAAGCGGGAAAGCAGGTGG - Intronic
1013618565 6:111867589-111867611 AGTCCAATAAGGAAAGCAGGGGG - Intronic
1015182216 6:130372209-130372231 ATGGAAATGGGGAAATCAGGAGG + Intronic
1015678229 6:135774737-135774759 ATTCTAAAGGGAAAACCATGAGG - Intergenic
1017248077 6:152249260-152249282 ATTCTAAGGAGGAAAGCAACGGG + Exonic
1021332144 7:19351587-19351609 ATTAAAATGAGGAAAGCAGAAGG + Intergenic
1021446136 7:20735680-20735702 ATTCTAAAATGGAAAGCAAGTGG + Intronic
1022010467 7:26304197-26304219 ATTCAGATGGGGAAGGCTGGAGG - Intronic
1023361930 7:39426101-39426123 ATTCCAACAGGGAGAGCAGGAGG - Intronic
1028397758 7:90391030-90391052 ATTCTAATGGGGGAAATAAGAGG + Exonic
1028985469 7:97005653-97005675 ATCCAAGGGGGGAAAGCAGGCGG + Exonic
1029162936 7:98565581-98565603 TTTCTCATGGGGAACTCAGGAGG + Intergenic
1030130490 7:106195485-106195507 ACTGTAATGGGGAAGGCTGGTGG - Intergenic
1030630864 7:111894402-111894424 AATCTAATGGGGCAAGCTGAGGG + Intronic
1030792981 7:113752222-113752244 ATTCTAGTGGGGAAAATAGATGG + Intergenic
1031873708 7:127114305-127114327 ATTGAAATGGGGAAATCATGGGG + Intronic
1032588641 7:133171788-133171810 AGTCTAAGACGGAAAGCAGGTGG + Intergenic
1033251325 7:139762827-139762849 AGCCTAATGGGGAAGGCAGGTGG + Intronic
1036529471 8:9570324-9570346 ACTGTAATGGGGATAGCAGCAGG + Intronic
1036560692 8:9898523-9898545 GTCCTAATGGGGAATCCAGGAGG + Intergenic
1038701177 8:29850546-29850568 ATTGTAATTGGGAAAAGAGGGGG - Intergenic
1039148107 8:34472350-34472372 ATCCTCATGAGGAAAGCAGAAGG - Intergenic
1039166529 8:34687539-34687561 ATTCTTATGTGGAACTCAGGGGG + Intergenic
1039501242 8:38019172-38019194 ATTTAAAGGGGAAAAGCAGGTGG - Intergenic
1040427618 8:47304597-47304619 CTTCACATGGTGAAAGCAGGGGG - Intronic
1041866915 8:62584561-62584583 AGGCAAATGGGGAATGCAGGAGG - Intronic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1046609257 8:116405762-116405784 ATTGTTTTGGGGAAACCAGGAGG + Intergenic
1047218743 8:122901351-122901373 ATTCTCTTGGGGAGAGTAGGAGG - Intronic
1048074688 8:131056544-131056566 ATTCTAAAGGAGAAAGATGGGGG + Intergenic
1048734004 8:137478228-137478250 ACTCTGATTGGAAAAGCAGGTGG + Intergenic
1048864763 8:138751626-138751648 ATTCTGATGGGGAAATTCGGAGG + Intronic
1048986809 8:139739162-139739184 ACTCTACTGGGGAAGGCATGGGG - Intronic
1049687362 8:143944304-143944326 CTTCTGGTGGGGACAGCAGGGGG - Intronic
1050343208 9:4661924-4661946 ATCATAATGGGGAACGCAGAGGG + Exonic
1052686935 9:31768967-31768989 ATTCTGATGGGGGAACCATGAGG - Intergenic
1053524542 9:38815454-38815476 ATTCTCACGGGAAAAGCAGGAGG - Intergenic
1053913538 9:42928458-42928480 ATTTTAATGGGGAAAGTTAGAGG + Intergenic
1054196778 9:62039873-62039895 ATTCTCACGGGAAAAGCAGGAGG - Intergenic
1054641627 9:67548821-67548843 ATTCTCACGGGAAAAGCAGGAGG + Intergenic
1056070679 9:82983665-82983687 ATTCTATTGGTCAAAGCAGGTGG - Intronic
1059586719 9:115615242-115615264 ATCCTCATGGGGTTAGCAGGAGG - Intergenic
1059737915 9:117120715-117120737 ATCATAATGGGGAAGGCAAGTGG + Intronic
1061081690 9:128374625-128374647 ATTGTCATGGGGAAAACATGGGG - Intronic
1061510057 9:131055050-131055072 GTTGTAATGGGGAAAACTGGAGG - Intronic
1062701205 9:137904680-137904702 ATTCTTGAGGGGACAGCAGGAGG - Intronic
1187956221 X:24521641-24521663 ATTCTAAAGGCCAAAGCAGCAGG + Intronic
1188953992 X:36412925-36412947 GTTATAATGGGGAAACCAAGGGG - Intergenic
1189168124 X:38881791-38881813 ATTTTCATGTGCAAAGCAGGAGG + Intergenic
1190719424 X:53135129-53135151 AAGCTAGTGGAGAAAGCAGGGGG + Intergenic
1193393438 X:80956562-80956584 ATTCTCATTGGGAACGCAGAAGG + Intergenic
1193672447 X:84404660-84404682 AGTCAAAAGGAGAAAGCAGGGGG + Intronic
1193873237 X:86828085-86828107 ATCCTAGTGGGGTAAGTAGGTGG + Intronic
1194455636 X:94099459-94099481 ATTTTAATGGGAAAATCAGAGGG + Intergenic
1194985483 X:100485436-100485458 ATGCTAAGGGTGAGAGCAGGAGG - Intergenic
1197609903 X:128626435-128626457 ATTCTAATGAGGAAGGATGGAGG + Intergenic
1198768915 X:140107641-140107663 ATTATAATAGGGAAGGAAGGTGG + Intergenic
1200758501 Y:7014296-7014318 ATTCACATGGGAAAAGCAGGAGG - Intronic