ID: 1163088543

View in Genome Browser
Species Human (GRCh38)
Location 19:15001629-15001651
Sequence TGGCTTTACAACCAATAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163088543_1163088549 12 Left 1163088543 19:15001629-15001651 CCCACCTATTGGTTGTAAAGCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1163088549 19:15001664-15001686 CCTTCTTATTTTCTTGAGACAGG 0: 1
1: 1
2: 63
3: 687
4: 5432
1163088543_1163088550 13 Left 1163088543 19:15001629-15001651 CCCACCTATTGGTTGTAAAGCCA 0: 1
1: 0
2: 1
3: 5
4: 76
Right 1163088550 19:15001665-15001687 CTTCTTATTTTCTTGAGACAGGG 0: 1
1: 4
2: 249
3: 3059
4: 23372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163088543 Original CRISPR TGGCTTTACAACCAATAGGT GGG (reversed) Intronic
900005814 1:49727-49749 TGGCTTTAACACTAATAAGTGGG - Intergenic
906270292 1:44472428-44472450 TTGCTTTACACCCACTAGGATGG - Intronic
906720600 1:48001384-48001406 TGACTTTAGGACCAAGAGGTTGG + Intergenic
907878878 1:58524014-58524036 TTGCTTTACAACCAAAAGACTGG + Intronic
908874703 1:68659644-68659666 TTGCTTTACAAACAATAAGCAGG + Intergenic
913701475 1:121378735-121378757 TGGCTTCAGAACCACTAGGAAGG - Intronic
914042032 1:144059196-144059218 TGGCTTCAGAACCACTAGGAAGG - Intergenic
914136057 1:144901291-144901313 TGGCTTCAGAACCACTAGGAAGG + Intronic
917639885 1:176973211-176973233 TGGCATTAGAAACAATAAGTTGG - Intronic
920207547 1:204303600-204303622 TGGAATTACAACAAATATGTGGG - Intronic
1064107094 10:12509277-12509299 TGGCTTTTCAAACAAGAGCTGGG - Intronic
1069566253 10:69465242-69465264 TGGCTTTCCAACCACTAGGTGGG + Intronic
1073357519 10:102869333-102869355 AGGCTTTCCAACCAGGAGGTCGG - Intronic
1073935721 10:108629363-108629385 TGGCATTACAAGCCTTAGGTAGG - Intergenic
1086204766 11:84244471-84244493 TTGCTTTATAAGCAAGAGGTGGG - Intronic
1091561813 12:1620270-1620292 TGGCTTAACCACCAATGTGTGGG + Intronic
1093068429 12:14683587-14683609 TGGCTTTACAACAACTATGGTGG - Intronic
1097487988 12:60230403-60230425 TGGCTTTGCAACTCATAGGTTGG + Intergenic
1109542337 13:63795495-63795517 TGGCTTTTTAAACAAGAGGTGGG - Intergenic
1113237267 13:108292621-108292643 TGGCTTCACACCCAGTAGGAAGG - Intronic
1118096612 14:62544898-62544920 TGGCTTTATAAAAAATAAGTTGG + Intergenic
1118737126 14:68709684-68709706 TGTCTCTACAAAAAATAGGTGGG - Intronic
1122477230 14:102018789-102018811 TGTCTCTACAAAAAATAGGTGGG + Intronic
1126681228 15:51204074-51204096 TGTCTTTCCAACCAACAGCTAGG - Intergenic
1127828803 15:62731295-62731317 TGGCTGAAAAACCAAGAGGTGGG - Intronic
1130159667 15:81385937-81385959 AGGCTGTCCAACCCATAGGTAGG + Intergenic
1131413446 15:92230481-92230503 TTGCTTTACCACCAAGAGTTGGG - Intergenic
1132447701 15:101941195-101941217 TGGCTTTAACACTAATAAGTGGG + Intergenic
1133847139 16:9465777-9465799 TGGCTTTAAAACCATTACTTTGG + Intergenic
1135186821 16:20322714-20322736 TGGCTTTACAGCAAATGGATTGG + Intronic
1149939447 17:60847526-60847548 TAACTTTACAGCCACTAGGTTGG - Intronic
1153679978 18:7491439-7491461 TGGCTTTAAATACTATAGGTGGG - Intergenic
1155236180 18:23821646-23821668 TGGCTTTTCAACCTAGAGGAGGG - Intronic
1160637571 19:91339-91361 TGGCTTTAACACTAATAAGTGGG - Intergenic
1163088543 19:15001629-15001651 TGGCTTTACAACCAATAGGTGGG - Intronic
927100035 2:19781079-19781101 TGGCTTTAGGACCAGTAGTTGGG + Intergenic
929676544 2:43937860-43937882 TTGCTTTACAACCAAAATGTGGG + Intronic
938907554 2:135853144-135853166 TGGCTTTAAAAACAATAGTAGGG + Intronic
941425076 2:165333103-165333125 TGGCATTAAAACCAAGAGCTAGG - Intronic
941863681 2:170311301-170311323 TCGCTTTACACCCACTAGGATGG - Intronic
944303377 2:198151061-198151083 TGACTTCACACCAAATAGGTTGG + Intronic
1168776988 20:456110-456132 TGTCTCTACAAAAAATAGGTGGG + Intronic
1177648443 21:23929979-23930001 TTGCTTTACAAACTATAGGTAGG + Intergenic
1179548447 21:42127285-42127307 GGGCTTTATTAACAATAGGTAGG + Intronic
1184084089 22:42247980-42248002 AGCCTTTACAACAAATATGTTGG + Intronic
955960722 3:64338957-64338979 TGACTTCACAACCATTAGGATGG + Intronic
958701483 3:97596610-97596632 TGCCTTTACATCTTATAGGTTGG - Intronic
959113539 3:102149408-102149430 GGGCTCTACAATCAGTAGGTGGG - Intronic
959859861 3:111204826-111204848 TGGCTTTAACACCAGTAGGAAGG - Intronic
962975301 3:140441061-140441083 TGGGTCTACAACCATCAGGTTGG - Intronic
971869608 4:32217511-32217533 TGGCTGCAAAACCAATAGGATGG - Intergenic
981364752 4:143889412-143889434 TGGCTTTGCCACCAAATGGTTGG + Intronic
981385868 4:144129884-144129906 TGGCTTTGCCACCAAATGGTTGG + Intronic
984305285 4:177981506-177981528 TGGCTTCACAGCAAATAAGTAGG + Intronic
985336480 4:188901876-188901898 TGACTTCATAACCAGTAGGTTGG - Intergenic
986795628 5:11208902-11208924 TCACTTTACAGCCAATAGATGGG - Intronic
990839429 5:60060341-60060363 TGTCTTTATAACCAAAATGTTGG - Intronic
993315499 5:86400528-86400550 TGGATTTTCAACTATTAGGTTGG - Intergenic
993407555 5:87530263-87530285 TAGTTCTAAAACCAATAGGTAGG - Intergenic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
998100845 5:139432746-139432768 TTGCTGTACAACCAAAAGGCTGG + Intronic
998988127 5:147784532-147784554 TGGCTTTCCATCCACTTGGTGGG + Intergenic
1006111334 6:31747536-31747558 TTGCTTTACTACTACTAGGTGGG - Intronic
1007058182 6:38909500-38909522 TGACTTTGCTATCAATAGGTTGG + Exonic
1012443714 6:99287554-99287576 TGGCTTTATAAATAATATGTTGG + Intronic
1013714783 6:112945806-112945828 GTCCTTGACAACCAATAGGTAGG + Intergenic
1017248589 6:152255586-152255608 TGTCTCTTCAACCAAGAGGTAGG - Exonic
1020997359 7:15280560-15280582 TGGATTTTCAAGCTATAGGTGGG - Intronic
1025049725 7:55724021-55724043 TGACTTAACACCCAATAGGGTGG + Intergenic
1028966870 7:96811834-96811856 TGCATTGACCACCAATAGGTGGG - Intergenic
1036522353 8:9503522-9503544 CTGCTTTACAACTAATTGGTAGG + Intergenic
1040321139 8:46304287-46304309 TTTCTTTTCAACCAGTAGGTTGG - Intergenic
1040439898 8:47430243-47430265 TGGCATTTCAACAAATGGGTAGG - Intronic
1043842242 8:85121122-85121144 TGCCTTTACACCCACTAGGATGG - Intronic
1049035914 8:140075755-140075777 TGGCTCTACATCCAATGTGTCGG - Intronic
1051148338 9:14053990-14054012 TGGCATTATAACCAAGATGTTGG + Intergenic
1051672532 9:19525793-19525815 TCACTTCACAACCACTAGGTTGG - Intronic
1051717345 9:19998897-19998919 TGGCTTTAGAACAAATAGGATGG - Intergenic
1055917148 9:81416088-81416110 AGGCATTACTATCAATAGGTTGG - Intergenic
1056731937 9:89173303-89173325 TGGCTTTCCAGCCAACAGGCTGG - Intronic
1191797536 X:65036332-65036354 TGGCTTAAAAACCAATAGGGAGG - Intergenic
1196499825 X:116366728-116366750 AGGCTTCACATCCAAAAGGTTGG - Intergenic
1199848877 X:151711221-151711243 TGGCTTTCAAACCAGCAGGTAGG - Intergenic