ID: 1163093831

View in Genome Browser
Species Human (GRCh38)
Location 19:15041303-15041325
Sequence CAGTTGTGGGGTGGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20629
Summary {0: 2, 1: 275, 2: 992, 3: 9304, 4: 10056}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163093831 Original CRISPR CAGTTGTGGGGTGGGGGAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr