ID: 1163096809

View in Genome Browser
Species Human (GRCh38)
Location 19:15064627-15064649
Sequence CTTTATTAGCAGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163096809_1163096816 22 Left 1163096809 19:15064627-15064649 CCATCCTCATTCTGCTAATAAAG No data
Right 1163096816 19:15064672-15064694 TATAAAGAAAAGAGGTTTGATGG 0: 4
1: 170
2: 1028
3: 1280
4: 2417
1163096809_1163096815 14 Left 1163096809 19:15064627-15064649 CCATCCTCATTCTGCTAATAAAG No data
Right 1163096815 19:15064664-15064686 GGGTAATTTATAAAGAAAAGAGG 0: 3806
1: 9545
2: 9195
3: 5640
4: 5267
1163096809_1163096812 -6 Left 1163096809 19:15064627-15064649 CCATCCTCATTCTGCTAATAAAG No data
Right 1163096812 19:15064644-15064666 ATAAAGACATACCCAAGACTGGG 0: 2136
1: 4078
2: 7251
3: 8542
4: 9456
1163096809_1163096811 -7 Left 1163096809 19:15064627-15064649 CCATCCTCATTCTGCTAATAAAG No data
Right 1163096811 19:15064643-15064665 AATAAAGACATACCCAAGACTGG 0: 851
1: 2918
2: 5260
3: 7049
4: 8377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163096809 Original CRISPR CTTTATTAGCAGAATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr