ID: 1163098409

View in Genome Browser
Species Human (GRCh38)
Location 19:15078143-15078165
Sequence CAGTAAAGACAGAAGTAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163098409_1163098418 20 Left 1163098409 19:15078143-15078165 CCCCGCTACTTCTGTCTTTACTG No data
Right 1163098418 19:15078186-15078208 CCGTGGGAGTGTGCTCAGCAGGG No data
1163098409_1163098413 3 Left 1163098409 19:15078143-15078165 CCCCGCTACTTCTGTCTTTACTG No data
Right 1163098413 19:15078169-15078191 GGACATCTTCTCCAGCACCGTGG No data
1163098409_1163098414 4 Left 1163098409 19:15078143-15078165 CCCCGCTACTTCTGTCTTTACTG No data
Right 1163098414 19:15078170-15078192 GACATCTTCTCCAGCACCGTGGG No data
1163098409_1163098419 21 Left 1163098409 19:15078143-15078165 CCCCGCTACTTCTGTCTTTACTG No data
Right 1163098419 19:15078187-15078209 CGTGGGAGTGTGCTCAGCAGGGG No data
1163098409_1163098416 19 Left 1163098409 19:15078143-15078165 CCCCGCTACTTCTGTCTTTACTG No data
Right 1163098416 19:15078185-15078207 ACCGTGGGAGTGTGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163098409 Original CRISPR CAGTAAAGACAGAAGTAGCG GGG (reversed) Intergenic
No off target data available for this crispr